Target gene segment of VdNrdp1 gene, dsRNA, expression vector and biopesticide composition

Abstract

The invention discloses a target gene segment of a VdNrdp1 gene, dsRNA, an expression vector and a biopesticide composition. The target gene segment is a target gene segment of verticillium dahliae VdNrdp1 gene, and is selected from any one nucleotide sequence as shown in SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3, the target segment as shown in SEQ ID No.1 has the best interference effect on the target gene, and the target segment as shown in SEQ ID No.2 has the best interference effect on the target gene; the invention also discloses dsRNA (double-stranded ribonucleic acid) obtained by transcription of the target gene segment. Disease index statistics and fungal biomass and gene silencing efficiency detection show that the target gene segment and dsRNA can effectively reduce the pathogenicity of verticillium dahliae to cotton; a control effect determination result shows that the composite nano pesticide composition composed of the dsRNA, the nano carrier and the pesticide has a good control effect on the verticillium wilt of crops.

Description

Technical Field

[0001] The present invention relates to a target gene segment for preventing and controlling plant diseases, a dsRNA and a nano-pesticide composition compounded with a nano-pesticide, in particular to a target segment for preventing and controlling crop Verticillium wilt, a dsRNA prepared by using the target gene segment, and a nano-biopesticide composition for preventing and controlling crop Verticillium wilt obtained by compounding the dsRNA with a nano-pesticide, and belongs to the field of RNA bio-pesticides for preventing and controlling crop Verticillium wilt. Background Art

[0002] Verticillium wilt is a devastating plant vascular disease, mainly caused by the plant pathogenic fungus Verticillium dahliae, which infects the vascular tissue from the plant roots. It may occur throughout the entire growth period of the plant and may cause plant death in severe cases. Verticillium dahliae has a wide range of host plants. It has been found that it can infect more than 400 dicotyledonous plants, including annual herbs, perennial herbs and woody plants. Many crops with important economic value, such as cotton, tomato, potato, pepper, sunflower, etc., are threatened by Verticillium dahliae (KLOSTERMAN SJ, ATALLAH ZK, VALLAD GE, et al. Diversity, pathogenicity, and management of Verticillium species [J]. Annual Review of Phytopathology, 2009, 47 (1): 39-62.), among which cotton is particularly seriously affected by Verticillium dahliae.

[0003] As the world's main natural fiber crop, cotton is one of the most important sources of fiber for the textile industry, accounting for half of the total fiber used by humans (HAGENBUCHER S, OLSON DM, RUBERSON JR, et al. Resistance mechanisms against arthropod herbivores in cotton and their interactions with natural enemies [J]. Critical Reviews in Plant Sciences, 2013, 32 (6): 458-482.). Verticillium wilt caused by Verticillium dahliae is a soil-borne disease, so it is very difficult to control the disease. There is currently no effective control agent, so cotton Verticillium wilt is called the "cancer" of cotton (ZHANG G, ZHAO Z, MA P, et al. Integrative transcriptomic and gene co-expression network analysis of host responses upon Verticillium dahliae infection in Gossypium hirsutum [J]. Scientific Reports, 2021, 11 (1): 20586-20598.).

[0004] RNA biopesticides use the principle of RNA interference (RNAi) to inhibit the expression of important functional genes of organisms, causing the development of harmful organisms to stagnate or die, thereby achieving the purpose of pest control. This technology will not change the genome of harmful organisms, nor will it have adverse effects on the ecosystem. RNA biopesticides have the advantages of precision, high efficiency, greenness and pollution-free, and are currently one of the new technologies most likely to be applied to pest control. Due to the specificity and high efficiency of RNAi in silencing target genes, it can be used as a convenient means to carry out pest control and screening and identification of new pesticide targets. At present, RNAi technology has been widely studied and applied in the field of modern agriculture. According to the genes Chs3b, Ave1, Sge1 and NLP1 related to the virulence of pathogens infecting hosts, and the pathogenic effector protein SvrPm3a1 / f1, dsRNA transiently transfected plants or stably transfected plants constructed using these target genes can resist a variety of fungal diseases to a certain extent (Zhao, J Hand and H.S. Guo (2022). RNA silencing: From discovery and elucidation to application and perspectives. Journal of Integrative Plant Biology 64 (2): 476-498.). Although many studies have shown that RNA biopesticides have strong application prospects, their stability seriously restricts their commercial use. As the core component of RNAi, double-stranded RNA (dsRNA) is extremely unstable in its natural state. dsRNA existing alone in soil and water environments is completely degraded within 48 hours. Environmental factors such as nucleases, rain, ultraviolet rays and microorganisms will directly affect the stability of dsRNA (Rank AP, Koch A. Lab-to-Field Transition of RNA Spray Applications-How Far Are We? Front Plant Sci. 2021 Oct 15; 12: 755-203.). Therefore, how to ensure the stability of dsRNA is one of the biggest challenges in realizing the commercial use of RNA biopesticides.

[0005] Nanoparticles (1-100 nm) can quickly encapsulate drug molecules, change the physical and chemical properties of pesticides, improve the water solubility and dispersibility of pesticides, give full play to the biological activity of active ingredients, eliminate harmful solvents and minimize the amount of adjuvants, and overcome pesticide residue pollution (Peters RJB, Bouwmeester H, Gottardo S, et al. Nanomaterials for products and application in agriculture, feed and food. Trends in Food Science and Technology, 2016, 54: 155-164.). Yu et al. (Yu M, Sun C, Xue Y, et al. Tannic acid-based nanopesticides coating with highly improved foliage adhesion to enhance foliar retention. RSC Advances, 2019, 9: 27096-27104.) used tannic acid to prepare avermectin and myclobutanil nanopesticides, both of which showed better light resistance and sustained release ability, and could better adhere to the leaf surface, increasing the leaf retention rate by more than 50%, greatly improving the utilization rate of pesticides. Selyutina et al. (Selyutina OY, Khalikov SS, Polyakov NE. Arabinogalactan and glycyrrhizin based nanopesticides as novel delivery systems for plant protection. Environmental Science and Pollution Research, 2020, 27: 5864-5872.) established a pesticide delivery system with natural polysaccharides and polysaccharides as the core, which can not only improve the water solubility of pesticides, but also improve the ability of pesticides to penetrate the epidermis of corn and rapeseed seeds. The epidermal penetration of imazalil and prochloraz is enhanced by more than 10 times. Therefore, the target gene segment and dsRNA that effectively prevent and control crop wilt are obtained, and then the pesticides that synergize with the dsRNA are further screened and encapsulated with nanocarriers to obtain a composite nanobiological pesticide composition, which has important application prospects for improving the stability of dsRNA and preventing and controlling crop wilt. Summary of the invention

[0006] One of the purposes of the present invention is to provide a target gene segment for effectively preventing and controlling Verticillium wilt in crops;

[0007] The second purpose of the present invention is to prepare dsRNA using the target gene segment for preventing and controlling crop Verticillium wilt;

[0008] The third purpose of the present invention is to compound dsRNA for preventing and treating Verticillium wilt of crops with nano-carriers and pesticides to obtain a composite nano-biopesticide composition.

[0009] The above object of the present invention is achieved through the following technical solutions:

[0010] One aspect of the present invention is to provide a target gene segment for controlling Verticillium wilt in crops, wherein the target gene segment is the target gene segment of the VdNrdp1 gene of Verticillium dahliae, which is selected from any one of dsVdNrdp1-1, dsVdNrdp1-2 or dsVdNrdp1-3, and its nucleotide sequence is shown in SEQ ID.No.1, SEQ ID.No.2 or SEQ ID.No.3 respectively; preferably, the target gene segment for controlling Verticillium wilt in cotton is dsVdNrdp1-1 (its nucleotide sequence is shown in SEQID.No.1).

[0011] Another aspect of the present invention is to provide a vector containing a target gene segment for preventing and controlling Verticillium wilt in crops. The vector can be an RNA interference vector or a gene expression vector that transcribes the target gene segment to obtain dsRNA.

[0012] As a preferred specific embodiment of the present invention, the RNA interference vector is a Gateway interference vector. For reference, the present invention provides a method for constructing a Gateway interference vector, comprising: connecting the target gene segment of the Verticillium dahliae VdNrdp1 gene to pDONR207 through a BP reaction and then constructing it into pK7GWIWG2 (I) through an LR reaction to obtain a Gateway interference vector.

[0013] As a preferred specific embodiment of the present invention, the gene expression vector for transcribing the target gene segment to obtain dsRNA can be an L4440 gene expression vector, which has a bidirectional T7 promoter inside. The target gene fragment can be inserted between the bidirectional T7 promoters through the internal restriction site. Under the induction of IPTG, the two reverse T7 promoters play a role and can form complementary dsRNA molecules.

[0014] Another aspect of the present invention is to provide a dsRNA for controlling crop Verticillium wilt obtained by transcription of the target gene segment of the VdNrdp1 gene of Verticillium dahliae.

[0015] As a preferred specific embodiment of the present invention, the dsRNA for controlling crop Verticillium wilt transcribed from the target gene segment of the Verticillium dahliae VdNrdp1 gene consists of the nucleotide sequence shown in SEQ ID No.4 and a nucleotide sequence that is reverse complementary to the nucleotide sequence shown in SEQ ID No.4; wherein the nucleotide sequence shown in SEQ ID No.4 is as follows:

[0016] CCGAAGACUACGGCUUGCACUUCGACACCGCGCGGCGCAUUGC

[0017] CAAUCUGUAGCAGAAGCAACCCGGUCCGACCGUGACACUAUCCCC

[0018] UUGACGCCAACCACCGGCACCGGCGCCGGUGCUGGCACGCCAUUCA

[0019] ACCUUGGCCUGCCCACCAGCACAAGGUCUGCCAACGAAAGUGCUCA

[0020] CCGACUCAGCCUGCGGUCCUUGCGACGCCUCGCUCGACAGUCUGCC

[0021] GCCGAGGCACCGGGCGCCGGCCCCCUGUUCGACAUCCUCACAUGU

[0022] CGGAUCCUCACACGUUCCCGGAUCUAGGUGGUCCAGAAGGGCAUG

[0023] GCGAUGCCGCCUUCGACGGUCCGAAUCUCAGGGACAUAUCCAUGCC

[0024] UCUGACCCAUCCCCCCAAUCGAUGGCCGGUCGAAAACCUACUCGAG

[0025] UUUGAAUACACGCGCCAUGCGGGCAUCAGUCCCGAGACAGCCCUCG

[0026] AGCUUGUCGACUUCUCCGCCCUCGUCUACCCUGAGGCGGUCGAUGA

[0027] CAAUCUGACCUGCCCAAUCUGCAAGGCACCCUUCGUUACGCCUGUU

[0028] ACUACCACGUGUGACCAUACCUUCUGCAACGCAUGUCUCAAGC.

[0029] In another aspect of the present invention, the dsRNA for preventing and controlling crop Verticillium wilt is compounded with a nano-carrier and a pesticide for preventing and controlling crop Verticillium wilt to obtain a composite nano-biological pesticide composition.

[0030] As a preferred embodiment of the present invention, the nanocarrier is a dendritic macromolecule functionalized with an amino functional group, and its structural formula is shown in Formula I:

[0031]

[0032] Wherein, the value of n in Formula I is any integer between 1 and 100.

[0033] As a preferred specific embodiment of the present invention, the pesticide is preferably any one of pentozolin (AMAS), myclobutanil (AMISID), fludioxonil (CELEX), methyl thiophanate or allyl isothiocyanate, preferably methyl thiophanate.

[0034] As a preferred specific embodiment of the present invention, the ratio of dsRNA, nanocarrier and pesticide is (1-9):1:1 calculated by mass ratio. More preferably, the composite nanopesticide composition obtained by compounding dsRNA, nanocarrier and pesticide in a ratio of 5:1:1 has the best control effect on Verticillium wilt and the least amount of dsRNA is used.

[0035] Another aspect of the present invention is to apply the target gene segment, the dsRNA transcribed from the target gene segment, and the composite nano-biopesticide composition obtained by combining the dsRNA with a nano-carrier and a pesticide to prevent and control crop wilt.

[0036] As a reference embodiment of the present invention, the present invention provides the use of the target gene segment for preventing and controlling Verticillium wilt in crops, comprising:

[0037] (1) constructing an RNA interference vector containing the target gene segment;

[0038] (2) transforming the constructed RNA interference vector into crop tissues or cells;

[0039] (3) Screening and obtaining transgenic crops with improved resistance to Verticillium dahliae.

[0040] As a preferred specific embodiment of the present invention, the present invention provides a method for cultivating crop varieties with improved disease resistance to Verticillium dahliae, comprising: (1) constructing an RNA interference vector containing the target gene segment of claim 1; (2) transforming the constructed RNA interference vector into crop tissues or cells; and (3) screening to obtain crop varieties with improved disease resistance to Verticillium dahliae.

[0041] The transformation schemes and the schemes for introducing the nucleotides into plants of the present invention vary according to the type of plant or plant cell applicable to the transformation. Suitable methods for introducing the nucleotides into plant cells include microinjection, electroporation, Agrobacterium-mediated transformation, and direct gene transfer.

[0042] As a reference embodiment of the present invention, the present invention provides a method for controlling crop Verticillium wilt using the dsRNA and nano-carriers or composite nano-pesticide compositions, comprising: before sowing the crops, treating the crop seeds with dsRNA or the composite nano-pesticide composition; after sowing, irrigating the roots with dsRNA or the composite nano-pesticide composition.

[0043] The crop of the present invention is a host plant of Verticillium dahliae, preferably an agricultural crop or vegetable, including any one of cotton, tobacco, tomato, potato, melon, watermelon, cucumber or peanut.

[0044] The invention adopts the nano-compounding technology of dsRNA and chemical agents, takes the highly pathogenic Verticillium dahliae strain V991 as the experimental material, firstly screens and obtains the target segment which can significantly inhibit the pathogen E3 ubiquitin ligase protein Nrdp1 and reduce the disease index of the plant through in vitro dsRNA synthesis technology, then screens the best ratio through compounding with a variety of pesticides and nano-materials, performs seed dressing and drip irrigation, finally obtains the best target gene segment for preventing and controlling cotton Verticillium wilt, and compounding with nano-carriers and chemical pesticides to obtain the nano-biopesticide composition which has significant prevention and control effect on Verticillium wilt.

[0045] Detailed description of the overall technical solution of the present invention

[0046] In order to screen the target gene segment with the best interference effect, three pairs of specific primers were designed according to the coding sequence of Verticillium dahliae VdNrdp1 (E3ubiquitin-protein ligase NRDP1, VDAG_07731). The primers contained HindⅢ and Kpn I restriction sites at both ends. The target fragments were amplified respectively, and the target gene segments dsVdNrdp1-1, dsVdNrdp1-2 and dsVdNrdp1-3 of the Verticillium dahliae VdNrdp1 gene were amplified. The nucleotide sequences were shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, respectively. The cloned target fragment was digested by HindⅢ and KpnⅠ, and then constructed into the L4440 vector to become the RNAi-VdNrdp1-N vector. After verification by PCR amplification and DNA sequencing, it was found that the sequence was completely consistent with the target fragment sequence. Then, the confirmed positive plasmid was transformed into Escherichia coli HT115 (DE3) for induced expression of dsRNA.

[0047] The L4440 expression vector used in this experiment has a bidirectional T7 promoter inside. The target gene fragment can be inserted between the bidirectional T7 promoters through the internal restriction site. Under the induction of IPTG, the two reverse T7 promoters play a role in forming complementary dsRNA molecules. Among them, the engineered strain HT115 has Tet resistance and lacks RNaseⅢ-like endonuclease in the body. Therefore, the dsRNA expressed by L4440 in the bacteria can remain in the form of large fragments.

[0048] The correct sequenced monoclonal clones were added to 2×YT medium, IPTG (final concentration of about 0.4mM) was added for induction, and then the bacteria were collected. RNA was extracted using the acid phenol method to detect the expression of dsRNA. Electrophoresis revealed a large amount of dsRNA of about 591bp. After the extracted RNA of each group was treated with RNase for 2h, agarose gel electrophoresis revealed that the total RNA was completely degraded, and dsRNA still existed, which showed that the dsRNA structure was quite stable and was not affected by RNase. The extracted dsRNA was mixed with a concentration of 10 7cfu / mL of V991 spore suspension was co-incubated for 24 hours, and inoculated into cotton seedlings grown to "two leaves and one heart", and the cotton disease index was calculated after 15 days. The results showed that compared with the untreated V991 inoculated, the disease index of cotton inoculated with V991 co-incubated with dsRNA decreased, and the pathogenicity of spores co-incubated with dsVdNrdp1-1 (nucleotide sequence shown in SEQ ID No.1) decreased most significantly, preliminarily indicating that co-incubation of spores with dsRNA can reduce the disease index of cotton, and the interference effect of the dsVdNrdp1-1 segment is the best.

[0049] The present invention further extracts cotton root DNA and uses qRT-PCR to analyze fungal biomass. The results show that the fungal biomass of cotton inoculated with V991 co-incubated with dsRNA is significantly reduced, about 28% of the wild type. In order to further verify the relationship between the reduction of plant disease index and the expression of target genes, by analyzing the expression of target genes of plant root pathogens, it can be observed that compared with wild-type plants, the expression of target genes in transgenic plants decreased by about 70%, which shows that designing dsRNA using dsVdNrdp1-1 as the target gene segment of the VdNrdp1 gene can effectively reduce the pathogenicity of pathogens.

[0050] The present invention selects five pesticides, namely, fluopicolide (Amaz), azoxystrobin (Amicid), fludioxonil (Celosi), methyl thiophanate and allyl isothiocyanate, and respectively applies them to cotton seeds, and uses water as a control. On the 6th and 12th days, the pesticides and water are used for root irrigation, with 1 L of water applied to every 10 pots of cotton seedlings, and 4 cotton seedlings per pot. On the 15th day, the root dipping method is used, and 10 7 cfu / mL of spore suspension of Verticillium dahliae was inoculated into cotton seedlings with two leaves and one heart. On the 15th day after inoculation, the severity of the disease of the plants was investigated; the experimental results showed that compared with the water treatment, the disease index of the cotton treated with pesticides decreased, and the disease index of the methyl-thiophanate treatment group decreased most significantly. DNA from the roots of transgenic cotton was extracted, and fungal biomass was analyzed by qRT-PCR. The analysis results showed that the fungal biomass of the cotton roots was significantly reduced after pesticide treatment, and the cotton treated with methyl-thiophanate decreased most significantly, about 42% of the wild type.

[0051] The present invention further mixes SPc (60.4 mg / mL) and methyl thiophanate in a mass ratio of 1:1 to prepare nanopesticides, mixes 100 ng / μL dsRNA with the nanopesticides in different ratios for incubation, and performs seed dressing treatment on cotton. On the 6th and 12th days, the nanopesticides and nanopesticide compound liquids are used for root irrigation treatment, 1 L of root irrigation is applied to every 10 pots of cotton seedlings, and 4 cotton seedlings are applied to each pot. After the cotton grows to "two leaves and one heart", the bacteria are inoculated using the 2.4 method, and the incidence is counted according to the 2.5 method 15 days after inoculation. Each group is inoculated with 12 cotton seedlings, the inoculation experiment is repeated 3 times, and the control effect (CE) is calculated; the indoor control effect determination results show that the control effect is best when the mass ratio of dsRNA, SPc and methyl thiophanate is equal to or greater than 5:1:1 among the 9 compound combinations, and the CE can reach 74.65%, which has a good synergistic effect, and the compound control effect of the dsRNA mass ratio less than 5:1:1 is second. In summary, the combination of dsRNA, SPc and methyl thiophanate is more effective than applying them separately, and the mass ratio of 5:1:1 has the best protection effect and the most economical dosage.

[0052] Definitions of terms used in this invention

[0053] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0054] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioate, phosphoramidate, etc.). Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including but not limited to degenerate codon substitutions) and complementary sequences as well as explicitly specified sequences. In particular, degenerate codon substitutions can be achieved by generating a sequence in which the 3rd position of one or more selected (or all) codons is substituted with a mixed base or deoxyinosine residue.

[0055] The term "recombinant host cell" or "host cell" means a cell comprising a nucleic acid of the invention, regardless of the method used for insertion to produce the recombinant host cell. The host cell may be a prokaryotic cell or a eukaryotic cell.

[0056] The term "RNA interference (RNAi)" refers to the phenomenon in which exogenous or endogenous double-stranded RNA induces silencing of gene expression of homologous sequences in cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 This is the relevant information of L4440 vector.

[0058] Figure 2 Amplification results of different segments of RNAi-VdNrdp1; M: marker, 1-3 are amplification results of different segments of VdNrdp1 gene.

[0059] Figure 3 : PCR verification of the bacterial solution of RNAi-VdNrdp1 vector; M is a marker, and 1-3 are the PCR verification results of the bacterial solution of RNAi plasmid constructed against VdNrdp1 gene.

[0060] Figure 4 is the expression of dsRNA; M is marker, and 1-3 are the verification results of the extracted dsVdNrdp1.

[0061] Figure 5 Statistical results of disease index of cotton inoculated with dsRNA and V991.

[0062] Figure 6 The results of fungal biomass detection in cotton roots inoculated with dsRNA and V991.

[0063] Figure 7 These are the results of relative target gene expression in cotton after co-inoculation of dsRNA and V991.

[0064] Figure 8 These are the statistical results of disease index of cotton treated with different pesticides and drip irrigated.

[0065] Fig. 9 The results of fungal biomass detection on cotton seed treated with different pesticides and drip irrigated.

[0066] Fig.10 The statistical results of disease index of cotton treated with composite nano-biopesticide compositions in different proportions.

[0067] Fig.11 The results are statistical results of the control effect of cotton treated with composite nano-biopesticide compositions in different proportions. DETAILED DESCRIPTION

[0068] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0069] Experimental Example 1 Screening of target segments for controlling cotton wilt, preparation of dsRNA, and composite nanobiological pesticide composition obtained by compounding dsRNA with nanocarriers and pesticides, and experiment on controlling cotton wilt

[0070] 1 Materials and methods

[0071] 1.1 Plant materials

[0072] Kezi cotton 312 was selected as the experimental material. The cotton seeds were first soaked in 70% alcohol for 1 minute, rinsed with sterile water once, and then soaked in 30% H2O2 for 30 minutes, and rinsed with sterile water three times. The cotton seeds were soaked in sterile water overnight, and then transferred to sterilized nutrient soil, which was placed in a bottomless disposable paper cup. The paper cup was placed in an artificial climate box for cultivation; the temperature was 25±2℃, the relative humidity was 75±5%, and the photoperiod L:D was 16h:8h.

[0073] 1.2 Strains and plasmids

[0074] Cotton wilt pathogen: Verticillium dahliae V991, a highly pathogenic deciduous strain.

[0075] Viral vector: L4440 vector was donated by Professor Andrew Fire of Stanford University (Stanford University, CA, USA).

[0076] Bacteria strains: Escherichia coli (E. coli) HT115 (DE3); Escherichia coli (E. coli) DH5α strains, preserved by the inventor's laboratory.

[0077] 1.3 Preparation of relevant solutions

[0078] LB (Luria-Bertani) medium: yeast extract 5 g / L, tryptone 10 g / L, NaCl 10 g / L;

[0079] Complete medium (CM): yeast extract 6 g / L, acid hydrolyzed casein 6 g / L, sucrose 10 g / L;

[0080] 2×YT liquid medium (PH=7.0): yeast extract 10 g / L, trypsin 16 g / L, NaCl 5 g / L.

[0081] 1.4 Fungal culture and plant inoculation methods

[0082] (1) Cultivate the spores of Verticillium dahliae in liquid CM medium and shake at 25°C for 5-7 days. Filter through 5 layers of gauze and collect the spores by centrifugation. Dilute with distilled water and observe under a microscope. Adjust the spore concentration to 10 7 cfu / mL for later use.

[0083] (2) When the cotton seedlings grow to "two leaves and one heart", the spore suspension of Verticillium dahliae is inoculated using the bottomless paper pot dipping method, and each paper cup is inoculated with 10 mL of the above spore suspension. After the inoculation is completed, the seedlings are placed in an artificial climate chamber for further cultivation and watered every 3 days. Each group is inoculated with 12 cotton seedlings, and the inoculation experiment is repeated 3 times.

[0084] 1.5 Plant disease index statistics

[0085] After 15 days of inoculation, the disease of cotton after inoculation with Verticillium dahliae was observed and the disease index was calculated. The disease was graded into 5 levels: Level 0, no symptoms; Level 1, cotyledons turned yellow and true leaves showed no symptoms; Level 2, all cotyledons showed symptoms and 1-3 true leaves showed symptoms; Level 3, including cotyledons, more than 5 cotton leaves showed symptoms; Level 4, all leaves showed symptoms, leaves fell off, and the plants died. The disease rate was calculated and the disease index was calculated as follows:

[0086] Observe the disease, disease index = [∑(number of diseased plants at each level × corresponding disease level) / (10×4)]×100;

[0087] Cotton stem segment longitudinal section: For cotton seedlings inoculated with Verticillium dahliae, observe the disease of the plants on the 15th day after inoculation, cut off a stem segment about 2 cm above the cotyledon, and make a longitudinal section from the center of the stem segment to observe the color of the vascular bundle. Repeat the inoculation 3 times and the observation 3 times.

[0088] 1.6 Determination of fungal biomass in plants

[0089] (1) On the 15th day after inoculation with Verticillium dahliae, cotton root tissue was selected to extract genomic DNA. The DNA extraction method was referred to the instructions of the kit. Vd-F / Vd-R were used as detection primers:

[0090] Vd-F: CCGCCGGTCCATCAGTCTCTCTGTTTATAC;

[0091] Vd-R: CGCCTGCGGGACTCCGATGCGAGCTGTAAC.

[0092] (2) Detection of the ITS1 and ITS2 regions of the ribosomal RNA genes in the genomic DNA of Verticillium dahliae in the mixed DNA sample (Z29511).

[0093] (3) Cotton housekeeping gene Ployubiquitin was used as an internal reference gene, and its detection primers were Pu-F / Pu-F:

[0094] Pu-F: AGCTCGGATACGATTGATAACG;

[0095] Pu-F:GAAGACGAAGAACAAGGGGAAG.

[0096] (4) Data using 2 -△△CT Analysis of relative gene expression data using real-time quantitative PCR and the 2 -△△CT Method[J].Methods.2001Dec;25(4):402-8.).

[0097] 1.7 Construction of RNAi-VdNrdp1 interference vector

[0098] (1) In order to screen the target gene segment with the best interference effect, three pairs of specific primers were designed based on the coding sequence of Verticillium dahliae VdNrdp1 (E3ubiquitin-protein ligase NRDP1, VDAG_07731). The two ends of the primers contained HindⅢ and KpnⅠ restriction sites (as shown in Table 1), and the target fragments were amplified respectively. Then, the PCR amplification products were detected by 1% agarose gel electrophoresis, and the fragments were recovered. The target fragments were subjected to restriction digestion reactions with the vectors and constructed into the L4440 vector. Finally, the verified positive plasmids were transformed into the Escherichia coli (E. coli) DH5α strain using PCR amplification detection and sequencing analysis.

[0099] Table 1 Primer information for different segments of VdNrdp1

[0100]

[0101] Note: The bold italic parts are restriction enzyme cutting sites.

[0102] (2) Select the positive clones with correct sequencing, shake the bacteria again, and extract the plasmid. Use HindⅢ and KpnⅠ for double digestion, perform 1% agarose electrophoresis after 2 hours, and store the recovered target band at -20℃ for later use.

[0103] Table 2 Double enzyme digestion system

[0104]

[0105] (3) First, the L4440 interference vector was double-digested, and the ligation step was performed according to the T4 ligase instruction manual. The ligation reaction system is as shown in Table 3:

[0106] Table 3 Ligation reaction system

[0107]

[0108] (4) Place in a 16°C water bath overnight.

[0109] 1.8 Preparation of E. coli HT115 (DE3) competent cells

[0110] (1) The E. coli HT115 (DE3) strain used in the laboratory was provided by the National Nematode Genetics Center of the United States. The strain itself has tetracycline resistance. The competent cell preparation method refers to the method provided by Dr. Timmons of the United States. The specific steps are as follows:

[0111] (2) Pick a single colony of Escherichia coli HT115 (DE3) and inoculate it into 5 mL LB liquid medium (Tet + , final concentration of 12.5 μg / mL) and cultured with shaking at 37°C overnight.

[0112] (3) The next day, the cells were inoculated into 25 mL LB liquid medium (Tet + ), cultured at 37°C with shaking.

[0113] (4) Waiting for OD 595nm When the concentration was about 0.4, the bacterial solution was centrifuged at 4°C and 3000 rpm for 10 min.

[0114] (5) Remove the supernatant and add pre-cooled sterile 50 mM CaCl2 equivalent to 1 / 2 volume of the original culture (12.5 mL). Gently pipette up and down to mix and resuspend the precipitate.

[0115] (6) Incubate on ice for 30 min and centrifuge at 4°C, 3000 rpm for 10 min.

[0116] (7) Remove the supernatant and add pre-cooled sterile 50 mM CaCl2 equivalent to 1 / 10 volume (2.5 mL) of the original culture, and then add the corresponding volume of 75% sterile glycerol to make the final concentration 10%. Mix by gently pipetting up and down, quickly freeze on ice, aliquot (150 μL / tube), and store in a -80°C refrigerator until needed.

[0117] 1.9 Transformation of E. coli HT115 (DE3) competent cells

[0118] The transformation method of E. coli HT115 (DE3) competent cells is slightly different from that of DH5a competent cells. The specific method is as follows:

[0119] Add 1 μL of recombinant interference vector plasmid to 150 μL of competent cells and place on ice for 30 minutes; place the centrifuge tube in a circulating water bath at 42°C for 1 minute; quickly transfer the tube to an ice bath for 2 minutes; add 1 mL of SOC liquid culture medium to each tube in a clean bench and culture in a shaker at 37°C for 1 hour; transfer the LB liquid culture medium containing the transformed competent cells to a double-antibody LB solid culture medium plate containing Amp and Tet (the final concentration of Amp is 0.1 mg / mL, and the final concentration of Tet is 12.5 μg / mL); place the plate in a clean bench until the surface bacterial liquid is absorbed, and invert the plate and culture at 37°C; after a single colony grows on the plate, pick a single clone and inoculate it into 5 mL of LB culture medium (containing Amp and Tet resistance), culture it overnight, extract the plasmid, perform enzyme digestion identification, and save the correctly identified recombinant vector for later use.

[0120] 1. Inducible expression of 10sRNA

[0121] The correctly identified bacteria were inoculated into 15 mL of LB medium (Amp + ), 37°C, 240r / min shaking overnight culture, take the overnight culture solution, inoculate in 100mL LB liquid medium (Amp + ) and cultured at 37°C, 240 rpm, for about 3 h until the bacterial solution OD 595nm is 0.4-0.45; add IPTG treated with filtered bacteria to make its final concentration 0.4mmol / L, continue shaking culture for 4h; collect the bacterial solution for extracting HT115 (DE3) total RNA.

[0122] 1.11 Extraction of total RNA from Escherichia coli HT115 (DE3) using Trizol

[0123] Take 50mL of induced bacterial solution, centrifuge at 12000r / min for 2min, and discard the supernatant; add 1mL Trizol to fully lyse the bacteria, be careful not to leave small bacterial lumps, mix well and let stand at room temperature for 5min; add 200μL chloroform, shake vigorously for 15s until the solution becomes milky white, and let stand for 2min; centrifuge at 4℃12000r / min for 15min, carefully pipette the supernatant into a centrifuge tube; add 500μL isopropanol, gently invert the liquid in the tube to mix 10 times, and let stand at room temperature for 10min; centrifuge at 4℃12000r / min for 10min, and discard the supernatant; add 1mL 75% ethanol, gently wash the precipitate, then 4℃7500r / min for 5min, and completely remove the supernatant; let stand at room temperature to dry for 10min, and add 30μL Nuclease Free Water to dissolve the precipitate. The extracted total RNA was subjected to electrophoresis detection, and the dsRNA extracted from the empty plasmid L4440 was used as a control. The fragment length was about 200 bp. If the product was about 600 bp, the induced extraction was successful.

[0124] 1.12 Antimicrobial Pesticide Screening

[0125] Five pesticides, including fluopicolide (Amaz), azoxystrobin (Amicid), fludioxonil (Celosi), methyl thiophanate and allyl isothiocyanate, were selected and applied to cotton seeds. Water was used as a control. On the 6th and 12th days, the roots were irrigated with pesticides and water. 1L of water was applied to every 10 pots of cotton seedlings, with 4 cotton seedlings per pot. On the 15th day, the root dipping method was used to irrigate the roots with 10 7 cfu / mL of spore suspension of Verticillium dahliae was inoculated into cotton seedlings with two leaves and one heart. 15 days after inoculation, the severity of the disease on the plants was investigated according to 2.4.

[0126] 1.13 Structural characteristics of nanocarrier SPc

[0127]

[0128] Structural characteristics of SPc: It is a dendritic macromolecule functionalized with amino functional groups, and its structural formula is shown in Formula I, and the value of n is 1-100.

[0129] 1.14 Screening of the optimal compound ratio of dsRNA and nanopesticides

[0130] SPc (60.4 mg / mL) was mixed with methyl thiophanate in a mass ratio of 1:1, and 100 ng / μL dsRNA was mixed with nanopesticides in different ratios for incubation, and cotton was treated with seeds. Nanopesticides and nanopesticide compound solutions were used for root irrigation on the 6th and 12th days. 1L of root irrigation was applied to every 10 pots of cotton seedlings, with 4 cotton seedlings per pot. After the cotton grew to "two leaves and one heart", the bacteria were inoculated using method 2.4, and the incidence was counted according to method 2.5 15 days after inoculation. Twelve cotton seedlings were inoculated in each group, and the inoculation experiment was repeated 3 times. The control effect (CE) was calculated using the following formula:

[0131]

[0132] 2 Test results

[0133] 2.1 Construction of the target segment plasmid of Verticillium dahliae VdNrdp1

[0134] The L4440 expression vector used in this experiment contains a bidirectional T7 promoter ( Figure 1 ). The target gene fragment can be inserted between the bidirectional T7 promoters through the internal restriction site. Under the induction of IPTG, the two reverse T7 promoters play a role and can form complementary dsRNA molecules. The engineered strain HT115 has Tet resistance and lacks RNaseIII-like endonucleases in the body, so the dsRNA expressed by L4440 in the bacteria can remain in the form of large fragments. According to the coding sequence information of Verticillium dahliae VdNrdp1, primers were designed to amplify and obtain three different segments of the target gene ( Figure 2 ). The cloned target fragment was digested by HindⅢ and KpnⅠ, and then constructed into the L4440 vector to become the RNAi-VdNrdp1 vector. After PCR amplification and DNA sequencing verification, it was found that the sequence was completely consistent with the target fragment sequence ( Figure 3 Then, the verified positive plasmid was transformed into Escherichia coli HT115 (DE3) for induced expression of dsRNA.

[0135] 2.2 dsRNA extraction

[0136] The correct clones were added to 2×YT medium, IPTG (final concentration of about 0.4 mM) was added for induction, and then the cells were collected. RNA was extracted using the acid phenol method to detect the expression of dsRNA ( Figure 4), electrophoresis found that there was a large amount of dsRNA of about 591bp. After the extracted RNA of each group was treated with RNase for 2 hours, agarose gel electrophoresis showed that the total RNA was completely degraded, and dsRNA still existed. This shows that the structure of dsRNA is quite stable and is not affected by RNase.

[0137] 2. Statistics of disease index of cotton inoculated with 3dsRNA and V991

[0138] The extracted dsRNA was mixed with a concentration of 10 7 cfu / mL of V991 spore suspension was incubated for 24 hours and inoculated into cotton seedlings that had grown to "two leaves and one heart". The cotton disease index was calculated after 15 days. The results showed that ( Figure 5 ), compared with the untreated V991 inoculated, the disease index of cotton inoculated with V991 co-incubated with dsRNA decreased, and the pathogenicity of spores co-incubated with dsVdNrdp1-1 decreased most significantly, preliminarily indicating that co-incubation of spores with dsRNA can reduce the disease index of cotton, and the interference effect of the dsVdNrdp1-1 segment is the best.

[0139] 2.4 Detection of fungal biomass and gene silencing efficiency in cotton roots inoculated with dsRNA and V991

[0140] DNA was extracted from cotton roots and fungal biomass was analyzed using qRT-PCR. Figure 6 The results showed that the fungal biomass of cotton inoculated with V991 co-incubated with dsRNA was significantly reduced, about 28% of the wild type. In order to further verify the relationship between the reduction of plant disease index and the expression of target genes, the expression of target genes of pathogens in plant roots was analyzed, and it was observed that the expression of target genes in transgenic plants decreased by about 67% compared with wild-type plants ( Figure 7 ). This indicates that segment 1 of the VdNrdp1 gene can be used as a target fragment to design dsRNA, which can effectively reduce the pathogenicity of the pathogen.

[0141] 2.5 Statistics of disease index of cotton treated with different pesticides and drip irrigation

[0142] Cotton seed treated with different pesticides and drip irrigated were inoculated with the root dipping method, and the disease index of cotton was calculated after 15 days. The results showed that ( Figure 8 ), compared with the water treatment, the disease index of cotton treated with pesticides decreased, and the disease index of the methyl-thiophanate treatment group decreased most significantly. DNA was extracted from the roots of transgenic cotton, and fungal biomass was analyzed using qRT-PCR. Fig. 9 The results showed that the fungal biomass in the roots of cotton treated with pesticides was significantly reduced, and the decrease was most obvious in cotton treated with methyl-thiophanate, which was about 42% of the wild type.

[0143] 2.6 Screening of the optimal compound ratio of dsRNA and nanopesticides

[0144] According to the indoor control effect test results in Table 4, the application of dsRNA and methylthiophanate alone can reduce the disease index of diseased plants and alleviate the symptoms of Verticillium wilt in plants, and the effect of the combination of dsRNA, SPc and methylthiophanate is better than that of the single application. Among the 9 compound combinations, the control effect gradually increased with the increase of the dsRNA application ratio, until the control effect reached 74.65% at 5:1:1, and the control effect was no longer significantly improved by increasing the application ratio ( Figure 10-11 ). In summary, the combination of dsRNA, SPc and methyl-thiophanate has better effect than the single application, and the mass ratio of dsRNA, SPc and methyl-thiophanate is 5:1:1, which has the best control effect and the most economical dosage of dsRNA.

[0145] Table 4 Indoor control effect and synergistic effect of compound agents

[0146]

[0147] Note: Data are mean ± standard deviation; different letters after the data indicate significant differences (P < 0.05).

Claims

1. Target gene segments for controlling crop wilt, It is characterized in that The target gene segment is the target gene segment of the Verticillium dahliae VdNrdp1 gene, which is selected from any one of the nucleotide sequences described in SEQ ID.No.1, SEQ ID.No.2 or SEQ ID.No.

3.

2. A vector containing the target gene segment according to claim 1, It is characterized in that The vector is an RNA interference vector, or the vector is a gene expression vector that transcribes the target gene segment to obtain dsRNA.

3. dsRNA for the prevention and treatment of crop wilt, It is characterized in that The dsRNA is composed of two RNAs transcribed from the target gene segment of claim 1.

4. The dsRNA according to claim 3, It is characterized in that The dsRNA consists of the nucleotide sequence shown in SEQ ID No.4 and a nucleotide sequence that is reverse complementary to the nucleotide sequence shown in SEQ ID No.

4.

5. A composite nano-biopesticide composition for preventing and controlling Verticillium wilt in crops, It is characterized in that The composition is composed of the dsRNA according to claim 3 or 4, a nanocarrier and a pesticide.

6. The composite nanobiological pesticide composition according to claim 5, It is characterized in that The structural formula of the nanocarrier is shown in Formula I: Wherein, the value of n in Formula I is any integer between 1 and 100; The pesticide is selected from any one of pentozoxanil, azoxystrobin, fludioxonil, methyl thiophanate or allyl isothiocyanate.

7. The composite nanobiological pesticide composition according to claim 5, It is characterized in that The mass ratio of dsRNA, nanocarrier and pesticide is (1-9):1:

1.

8. The composite nanopesticide biological composition according to claim 7, It is characterized in that The ratio of dsRNA, nanocarrier and pesticide was 5:1:

1.

9. Use of the target gene segment according to claim 1, the vector according to claim 2, the dsRNA according to claim 3, or the composite nano-biopesticide composition according to any one of claims 5 to 8 in preventing and controlling Verticillium wilt in crops; in, The crop includes any one of cotton, tobacco, tomato, potato, melon, watermelon, cucumber or peanut.

10. A method for cultivating crop varieties with improved resistance to Verticillium dahliae, It is characterized in that include: (1) constructing an RNA interference vector containing the target gene segment of claim 1; (2) transforming the constructed RNA interference vector into crop tissues or cells; (3) screening and obtaining crop varieties with improved resistance to Verticillium dahliae; wherein the crop comprises any one of cotton, tobacco, tomato, potato, melon, watermelon, cucumber or peanut.

Images