A bionic bone / cartilage double-layer composite scaffold material and a preparation method and application thereof
By designing a biomimetic bone/cartilage bilayer composite scaffold material, the differences in structure and biological function between bone and cartilage tissues were resolved, enabling simultaneous regeneration of cartilage and bone. This promoted the directed differentiation of stem cells and the transport of nutrients, exhibiting excellent cell affinity and osteogenic/cartilage activity.
Patent Information
- Application Number
- CN202411117013.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-14
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2044-08-14
AI Technical Summary
Existing technologies cannot simultaneously meet the multi-level repair needs of bone and cartilage tissues. A single scaffold material cannot simultaneously promote the regeneration of cartilage and bone, and bone/cartilage tissues have significant differences in structure and biological function.
A biomimetic bone/cartilage bilayer composite scaffold material is designed, comprising an upper cartilage repair hydrogel layer and a lower bone repair scaffold layer. The upper layer is composed of polyethylene glycol diacrylate-chitosan whisker liquid crystal composite hydrogel, and the lower layer is composed of a 3D-printed polymer scaffold modified with biofunctionalized chitosan whisker liquid crystal hydrogel channels. It has micron-sized radial liquid crystal channels and longitudinal large liquid crystal channels, and its mechanical properties match those of cancellous bone. Functionally, it promotes cell proliferation and differentiation.
It achieves directed differentiation of stem cells, promotes cartilage and bone formation, nutrient transport, cell migration and adhesion, and has excellent cell affinity and osteogenic/cartilage activity, making it suitable for bone/cartilage tissue repair.
Smart Images

Figure CN119113207B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biomedical materials, and particularly relates to a bionic bone / cartilage double-layer composite scaffold material and a preparation method and application thereof. BACKGROUND
[0002] Joint injury is often caused by trauma, inflammation or improper load, and is a common clinical disease. Most joint injuries are manifested as damage to the upper cartilage and the lower bone, accompanied by pain, swelling and stiffness, which seriously affects people's physical health and quality of life. The development of tissue engineering has made great progress in the research of inducing tissue growth and functional regeneration based on bioactive materials. The related research of joint injury repair has gradually changed from single cartilage repair to bone / cartilage integrated regeneration repair. Implanting a tissue engineering scaffold material similar to the characteristics of natural bone / cartilage is an effective repair strategy. However, bone / cartilage tissue is composed of continuous but different cartilage layers and subchondral bone layers in structure, and there are great differences between them in cell phenotype, extracellular matrix (ECM) composition, microstructure and mechanical properties. Therefore, it is still a great challenge to develop a tissue engineering scaffold material that can promote the regeneration of cartilage and bone at the same time.
[0003] Clarifying the composition and characteristics of bone / cartilage can help researchers design reasonable bone / cartilage scaffold materials. On the one hand, the key to cartilage injury treatment lies in promoting chondrocytes to secrete collagen and aggregate proteoglycans to remodel the extracellular matrix of chondrocytes. However, the cartilage tissue itself has no rich blood supply, which cannot provide enough nutrients for chondrocyte proliferation; at the same time, the cartilage also does not have the presence of stem cells, which cannot obtain enough chondrocytes through differentiation. On the other hand, bone injury research mainly focuses on developing suitable bone tissue engineering scaffold materials to promote the recruitment, adhesion, spreading, osteogenic differentiation and mineralization of stem cells. The porous structure of the scaffold is considered to be an important factor affecting the behavior and osteogenic differentiation of stem cells, such as cell migration, mineral deposition, scaffold mechanical properties, and transportation of nutrients and waste. In order to improve the growth of new bone tissue, various methods have been proposed to regulate the structure of the porous scaffold. For example, salting-out method, freeze-drying method and 3D printing customized design of pore structure, etc. Using these means is expected to realize the preparation of bone / cartilage repair scaffold materials.
[0004] However, the current single technical means cannot meet the multi-level requirements of bone / cartilage defects on the scaffold material, and the strategy of improving or combining multiple technical means is expected to prepare a scaffold material with ideal bone / cartilage repair performance. In addition, the ECM of bone and cartilage has a liquid crystal state and a viscoelastic microenvironment, and by reasonable means and strategies, the bone / cartilage scaffold is endowed with a liquid crystal state and a viscoelastic microenvironment, which will achieve better bone / cartilage repair. Based on the above, it is of great significance to design a multifunctional scaffold material that meets the integrated efficient repair of bone / cartilage injury in composition, structure and biological function. SUMMARY
[0005] In order to overcome the shortcomings of the prior art, the primary purpose of the present application is to provide a bionic bone / cartilage double-layer composite scaffold material. The scaffold material can promote cartilage, bone and angiogenesis; the upper layer is a polyethylene glycol diacrylate-chitin whisker liquid crystal composite hydrogel loaded with a drug for promoting cartilage activity as a cartilage repair hydrogel layer, which has a chiral topological structure in structure, elasticity in mechanics, and can promote cell proliferation and chondrogenic differentiation in function; the lower layer is a 3D printed polymer scaffold material modified by a biofunctionalized chitin whisker composite liquid crystal hydrogel channel as a bone repair layer, which has micron radial liquid crystal channels and drug-loaded longitudinal liquid crystal large channels in structure, modulus and strength matching with cancellous bone in mechanics, and can recruit stem cells and osteogenic differentiation, promote new bone mineralization and angiogenesis in function.
[0006] Another purpose of the present application is to provide a preparation method of the above-mentioned bionic bone / cartilage double-layer composite scaffold material.
[0007] Still another purpose of the present application is to provide the application of the above-mentioned bionic bone / cartilage double-layer composite scaffold material.
[0008] To achieve the above-mentioned purposes of the application, the technical scheme adopted by the present application is as follows:
[0009] A bionic bone / cartilage double-layer composite scaffold material, which is composed of an upper cartilage repair hydrogel layer and a lower bone repair scaffold layer; the upper cartilage repair hydrogel layer is a polyethylene glycol diacrylate-chitin whisker liquid crystal composite hydrogel containing a photoinitiator and a drug for promoting chondrogenic activity; the lower bone repair scaffold layer comprises a base scaffold and a liquid crystal channel structure, the base scaffold is a polymer scaffold with horizontal large channels and vertical large channels modified by polydopamine; the liquid crystal channel structure is constructed with the base scaffold as a template, wherein the horizontal large channels have chitosan-chitin whisker liquid crystal composite hydrogel micron radial channels with a diameter gradient change, and the vertical large channels contain polyethylene glycol diacrylate-chitin whisker liquid crystal composite hydrogel loaded with a drug for promoting osteogenic and angiogenic activity.
[0010] In the upper cartilage repair hydrogel layer:
[0011] The components in the polyethylene glycol diacrylate-chitin whisker liquid crystal composite hydrogel are as follows in terms of mass percentage: 0.002%-0.01% of a photoinitiator, 0.005%-0.1% of a cartilage formation promoting active drug, 4%-10% of chitin whisker liquid crystal, and 1%-10% of polyethylene glycol diacrylate; preferably, the components are as follows: 0.005%-0.01% of a photoinitiator, 0.01%-0.06% of a cartilage formation promoting active drug, 5%-8% of chitin whisker liquid crystal, and 4%-9% of polyethylene glycol diacrylate.
[0012] The polyethylene glycol diacrylate-chitin whisker liquid crystal composite hydrogel further contains a solvent, and the solvent is the balance.
[0013] The solvent is preferably water; more preferably, the solvent is deionized water.
[0014] The photoinitiator is preferably at least one of lithium phenyl (2,4,6-trimethylbenzoyl) phosphate and 1-hydroxycyclohexyl phenyl ketone.
[0015] The cartilage formation promoting active drug is preferably at least one of insulin-like growth factor, baicalin, bone morphogenetic protein, human parathyroid hormone related protein, and transforming growth factor.
[0016] The weight average molecular weight of the polyethylene glycol diacrylate is preferably 200-10,000; more preferably, the weight average molecular weight is 200-5,000.
[0017] In the lower bone repair scaffold layer, the polymer is at least one of poly-L-lactic acid, polycaprolactone, and polyether ether ketone.
[0018] The polymer is at least one of poly-L-lactic acid, polycaprolactone, and polyether ether ketone.
[0019] The weight average molecular weight of the poly-L-lactic acid is preferably 0.5-3.5 million; more preferably, the weight average molecular weight is 1-3 million.
[0020] The weight average molecular weight of the polycaprolactone is preferably 0.5-2 million; more preferably, the weight average molecular weight is 1 million.
[0021] The weight average molecular weight of the polyether ether ketone is 0.2-0.8 million; more preferably, the weight average molecular weight is 0.5-0.7 million.
[0022] The polymer scaffold is preferably obtained by 3D printing.
[0023] The step of modifying the polymer scaffold by polydopamine is preferably as follows: placing the polymer scaffold in a dopamine reaction solution to obtain a base scaffold.
[0024] The concentration of the dopamine reaction solution is preferably 0.5-5 g / L; more preferably, the concentration is 1.5-4 g / L.
[0025] The reaction conditions are preferably 10-40°C for 1-48 hours; more preferably 15-30°C for 5-24 hours.
[0026] The transverse macro-channels are preferably 1-4 layers, with 3-9 channels per layer; more preferably 2-3 layers, with 4-8 channels per layer.
[0027] The transverse macro-channels preferably have an outer diameter of 1-4 mm and an inner diameter of 0.2-1.2 mm; more preferably 2-3 mm and 0.4-1 mm, respectively.
[0028] The chitosan-chitin whisker liquid crystal composite hydrogel comprises a crosslinking agent, chitosan and chitin whisker liquid crystals; the components are present in the following amounts by mass percentage: chitosan 0.5-5.0%, crosslinking agent 0.05-0.6% and chitin whisker liquid crystals 5-12%; more preferably: chitosan 1-5%, crosslinking agent 0.1-0.5% and chitin whisker liquid crystals 7-12%.
[0029] The chitosan-chitin whisker liquid crystal composite hydrogel also comprises a solvent, which is present in the balance.
[0030] The solvent is mainly water, which contains acetic acid. The presence of acetic acid facilitates the dissolution of chitosan.
[0031] The concentration of acetic acid is preferably 1-3% (v / v).
[0032] The crosslinking agent is preferably at least one of genipin, glutaraldehyde and epichlorohydrin.
[0033] The diameter of the longitudinal macro-channels is preferably 0.05-5 mm; more preferably 0.5-4 mm.
[0034] The size of the micrometer radial channels is 1-100 μm.
[0035] The polyethylene glycol diacrylate-chitin whisker liquid crystal composite hydrogel for loading osteogenic and angiogenic drugs comprises an osteogenic and angiogenic drug, chitin whiskers and polyethylene glycol diacrylate; the components are present in the following amounts by mass percentage: photoinitiator 0.001-0.05%, chitin whisker liquid crystals 5-15%, polyethylene glycol diacrylate 8-15%, osteogenic and angiogenic drug 0.01-1%; preferably: photoinitiator 0.005-0.01%, chitin whisker liquid crystals 8-12%, polyethylene glycol diacrylate 9-11%, osteogenic and angiogenic drug 0.05-0.3%.
[0036] The polyethylene glycol diacrylate-chitin whisker liquid crystal composite hydrogel for loading the osteogenic and angiogenic active drug further comprises a solvent.
[0037] The solvent is preferably water, and more preferably deionized water.
[0038] The weight average molecular weight of the polyethylene glycol diacrylate is preferably 200-10000, and more preferably 200-5000.
[0039] The osteogenic and angiogenic active drug is preferably at least one of bone morphogenetic protein, hypoxia-inducible factor, vascular endothelial growth factor, transforming growth factor and deferoxamine.
[0040] The photoinitiator is preferably at least one of lithium phenyl (2,4,6-trimethylbenzoyl) phosphate and 1-hydroxycyclohexyl phenyl ketone.
[0041] The preparation method of the above-mentioned bionic bone / cartilage double-layer composite scaffold material comprises the following steps:
[0042] (1) a polymer scaffold is constructed by using a fused deposition 3D printing technology, the polymer scaffold is immersed in a dopamine reaction solution for reaction, and a base scaffold is obtained after vacuum drying;
[0043] (2) a chitosan, crosslinking agent and chitin whisker composite liquid crystal precursor solution is prepared, and is injected into a transverse large channel of the base scaffold obtained in step (1) for pre-crosslinking;
[0044] (3) a copper rod inserted into a liquid nitrogen pool is inserted into a longitudinal large channel of the base scaffold, radial freezing and freeze-drying are performed, and a scaffold with a micron radial channel is obtained;
[0045] (4) an osteogenic and angiogenic active drug, polyethylene glycol diacrylate, a photoinitiator and chitin whisker liquid crystal are prepared into a precursor solution, and are perfused into the longitudinal large channel for photocrosslinking, so as to obtain a lower layer bone repair scaffold material;
[0046] (5) a cylindrical silica gel mold is sleeved on the upper end of the lower layer bone repair scaffold material, an active drug for promoting cartilage, polyethylene glycol diacrylate, a photoinitiator and chitin whisker liquid crystal are prepared into a precursor solution, and are dropped into the mold for photocrosslinking, and the bionic bone / cartilage double-layer composite scaffold material is obtained after demolding.
[0047] The polymer in step (1) is preferably a left-handed poly-lactic acid, poly-caprolactone or poly-ether-ether-ketone wire.
[0048] When the polymer is L-polylactic acid, the 3D printing conditions are preferably that the nozzle extrusion temperature is 150-250℃ and the printing rate is 25-60 mm / min; more preferably, the nozzle extrusion temperature is 180-220℃ and the printing rate is 35-50 mm / min.
[0049] When the polymer is polycaprolactone, the 3D printing conditions are preferably that the nozzle extrusion temperature is 60-80℃ and the printing rate is 20-40 mm / min; more preferably, the nozzle extrusion temperature is 60-80℃ and the printing rate is 20-40 mm / min.
[0050] When the polymer is polyether ether ketone, the 3D printing conditions are preferably that the nozzle extrusion temperature is 340-380℃ and the printing rate is 30-50 mm / min; more preferably, the nozzle extrusion temperature is 350-360℃ and the printing rate is 40-45 mm / min.
[0051] The concentration of the dopamine reaction solution is preferably 0.5-5 g / L; more preferably, 1.5-4 g / L.
[0052] The reaction conditions are preferably 10-40℃ for 1-48 hours; more preferably, 15-30℃ for 5-24 hours.
[0053] The precursor solution in step (2) contains, by mass percentage, 0.5-5.0% chitosan, 0.05-0.6% crosslinking agent, and 5-12% chitin whisker liquid crystal; more preferably, 1-5% chitosan, 0.1-0.5% crosslinking agent, and 7-12% chitin whisker liquid crystal.
[0054] The crosslinking agent in step (2) is preferably at least one of genipin, glutaraldehyde, and epichlorohydrin.
[0055] When the crosslinking agent is genipin, the pre-crosslinking time is preferably 2-72 hours; more preferably, 10-48 hours; most preferably, 2-12 hours.
[0056] When the crosslinking agent is glutaraldehyde, the pre-crosslinking time is preferably 0.2-24 hours; more preferably, 5-20 hours; most preferably, 9-15 hours.
[0057] When the crosslinking agent is epichlorohydrin, the pre-crosslinking time is preferably 0.1-48 hours; more preferably, 2-36 hours; most preferably, 8-10 hours.
[0058] The diameter of the copper rod in step (3) is preferably 0.1-5 mm; more preferably, 0.5-4 mm.
[0059] The radial freezing time in step (3) is preferably 0.2-6 hours; more preferably 0.5-5 hours.
[0060] The freeze-drying temperature in step (3) is preferably -40 to -10°C, and the time is preferably 4-24 hours.
[0061] The precursor solution in step (4) contains the following components by mass percentage: photoinitiator 0.001-0.05%, chitin whisker liquid crystal 5-15%, polyethylene glycol diacrylate 8-15%, and osteogenic and angiogenic active drug 0.01-1%; preferably: photoinitiator 0.005-0.01%, chitin whisker liquid crystal 8-12%, polyethylene glycol diacrylate 9-11%, and osteogenic and angiogenic active drug 0.05-0.3%.
[0062] The photoinitiator is preferably at least one of lithium phenyl (2,4,6-trimethylbenzoyl) phosphate and 1-hydroxycyclohexyl phenyl ketone.
[0063] The polyethylene glycol diacrylate preferably has a weight average molecular weight of 200-10,000; more preferably 200-5,000.
[0064] The osteogenic and angiogenic active drug is preferably at least one of bone morphogenetic protein, hypoxia-inducible factor, vascular endothelial growth factor, transforming growth factor, and deferoxamine.
[0065] The photo-crosslinking time in step (4) is preferably 1-25 minutes; more preferably 5-20 minutes.
[0066] The cylindrical silica gel mold in step (5) preferably protrudes 0.5-5 mm, more preferably 1-3 mm, above the lower bone repair scaffold material.
[0067] The components of the precursor solution in step (5) are as follows by mass percentage: photoinitiator 0.002-0.01%, chondrogenic active drug 0.005-0.1%, chitin whisker liquid crystal 4-10%, and polyethylene glycol diacrylate 1-10%; preferably: photoinitiator 0.005-0.01%, chondrogenic active drug 0.01-0.06%, chitin whisker liquid crystal 5-8%, and polyethylene glycol diacrylate 4-9%.
[0068] The photoinitiator is preferably at least one of lithium phenyl (2,4,6-trimethylbenzoyl) phosphate and 1-hydroxycyclohexyl phenyl ketone.
[0069] The chondrogenic activity promoting drug is preferably at least one of insulin-like growth factor, baicalin, bone morphogenetic protein, human parathyroid hormone related protein and transforming growth factor.
[0070] The weight average molecular weight of the polyethylene glycol diacrylate is preferably 200-10000; more preferably 200-5000.
[0071] The photo-crosslinking time in step (5) is preferably 1-25 min; more preferably 5-20 min.
[0072] The application of the above-mentioned bionic bone / cartilage double-layer composite scaffold material in preparing biomedical products.
[0073] The biomedical application product is a bionic bone / cartilage repair scaffold.
[0074] Compared with the prior art, the present application has the following advantages and beneficial effects:
[0075] 1. The present application designs and prepares a bionic bone / cartilage double-layer composite scaffold material, the lower layer is a scaffold material loaded with a vascularization drug with a bionic bone structure channel, and the upper layer is a liquid crystal hydrogel material loaded with a chondrogenic activity drug, so that the directional differentiation of stem cells into bone and cartilage can be realized.
[0076] 2. The present application designs a unique radial freezing device to construct micron radial channels in the scaffold transverse large channels, which promotes the transportation of nutrients and the migration of cells, and the micron radial channels have good liquid crystal property maintenance and gradient size distribution, which can promote the recruitment, migration and adhesion of cells.
[0077] 3. The mechanical properties of the composite liquid crystal hydrogel constructed by the present application are easy to regulate, can also maintain the liquid crystal state, and can realize the sustained release of drugs, so as to further regulate the chondrogenic differentiation of stem cells and promote the generation of vascularized bone.
[0078] 4. The bionic bone / cartilage double-layer composite scaffold material prepared by the present application has excellent cell affinity, osteogenic / chondrogenic activity and vascularization promoting ability, and is expected to have good application prospect in the field of biomedical materials such as bone / cartilage tissue repair materials. BRIEF DESCRIPTION OF DRAWINGS
[0079] Figure 1 It is a structural schematic diagram of the double-layer scaffold material in Example 1 of the present application.
[0080] Figure 2 It is a top view, side view and sectional view of the 3D printing model and the actual object in Example 2 of the present application.
[0081] Figure 3The scanning electron microscope photos of the micro radial channels in Example 3 of the present application and the enlarged photos of the proximal end and the distal end thereof.
[0082] Figure 4 The polarized microscope photos and enlarged photos of the micro radial channels in Example 4 of the present application, and the circular dichroism spectra of the chitosan-chitin whisker liquid crystal precursor before and after crosslinking.
[0083] Figure 5 The cumulative release curves of deferoxamine and baicalin in Example 5 of the present application.
[0084] Figure 6 The scanning electron microscope photos of the interface between the upper cartilage repair hydrogel and the lower scaffold in Example 6 of the present application.
[0085] Figure 7 The cyclic compression curves and partial enlarged curve graphs of the upper cartilage repair hydrogel in Example 7 of the present application.
[0086] Figure 8 The laser confocal photos of the mouse mesenchymal stem cells cultured on the polylactic acid, drug-loaded or non-drug-loaded lower bone repair scaffold material for 24 hours in Example 8 of the present application.
[0087] Figure 9 The results graphs of the alkaline phosphatase staining (a) and quantitative analysis (d), type I collagen staining (b) and calcium nodule deposition staining (c) and quantitative analysis (e) of the mouse mesenchymal stem cells on the polylactic acid, drug-loaded or non-drug-loaded lower bone repair scaffold material in Example 9 of the present application.
[0088] Figure 10 The expression results graphs of VEGF and HIF-1α of the human umbilical vein endothelial cells cultured on the polylactic acid, drug-loaded or non-drug-loaded lower bone repair scaffold material for 5 days in Example 10 of the present application.
[0089] Figure 11 The expression results graphs of Acan, Sox-9 and Col-II of the mouse mesenchymal stem cells cultured on the polyethylene glycol diacrylate, drug-loaded or non-drug-loaded upper cartilage repair hydrogel for 7 days in Example 11 of the present application.
[0090] Figure 12 The alcian blue staining photos and quantitative analysis results graphs of the mouse mesenchymal stem cells cultured on the polyethylene glycol diacrylate, drug-loaded or non-drug-loaded upper cartilage repair hydrogel for 7 days in Example 12 of the present application. DETAILED DESCRIPTION
[0091] The application will be described in further detail below with reference to the drawings and examples. It is to be noted that the examples described below are intended to facilitate an understanding of the application and that the application is not limited to the examples. Based on the examples of the application, those skilled in the art can make various modifications or changes to the application, and these equivalent forms also fall within the scope defined by the claims of the present application.
[0092] Unless otherwise specified, all raw materials and reagents used in the present application are commercially available conventional raw materials and reagents.
[0093] Preparation of solutions involved in the examples:
[0094] Chitosan solution: Chitosan was dissolved in 2% acetic acid aqueous solution (Chitosan was purchased from Shanghai Aldrin Biochemical Technology Co., Ltd., item number: C105801).
[0095] Genipin solution: Genipin was dissolved in deionized water (purchased from Shanghai Aldrin Biochemical Technology Co., Ltd., item number: G101204) to obtain.
[0096] Chitin whisker liquid crystal: Chitin whiskers were dispersed in deionized water (chitin raw material was purchased from Shanghai Maikelin Biochemical Technology Co., Ltd., item number: C769123, and then subjected to acid hydrolysis treatment to obtain chitin whiskers), and then subjected to ultrasonic treatment for 2 h at a power of 450 W by a cell disruptor to obtain.
[0097] The acid hydrolysis treatment of chitin raw material was performed as follows: a certain amount of chitin powder was added to a 3 mol / L hydrochloric acid solution, and boiled in a three-necked flask at 90°C under a nitrogen atmosphere for 3 h; then, the reacted solution was centrifuged three times to remove excess acid and impurities, and then transferred to a dialysis bag with a molecular weight of 5000 Da for dialysis for three days; finally, the dialyzed sample was placed in a freeze dryer at -40 to -10°C for freeze-drying, and the obtained sample was ground to obtain chitin whiskers.
[0098] Recombinant human bone morphogenetic protein 2 solution: Recombinant human bone morphogenetic protein 2 (purchased from MedChemExpress Biotechnology Co., Ltd., item number: HY-P72854) was dissolved in deionized water to obtain.
[0099] Polyethylene glycol diacrylate solution: Polyethylene glycol diacrylate was dissolved in deionized water.
[0100] Phenyl(2,4,6-trimethylbenzoyl) lithium phosphate solution: Phenyl(2,4,6-trimethylbenzoyl) lithium phosphate (purchased from Shanghai Aldrin Biochemical Technology Co., Ltd., item number: L157759) was dissolved in deionized water to obtain.
[0101] Recombinant human insulin-like growth factor 1 solution: Recombinant human insulin-like growth factor 1 (purchased from Yixing Biotech Co., Ltd., Shanghai, China, Catalog No. 92211ES10) was dissolved with deionized water to obtain.
[0102] Human hypoxia-inducible factor-1 alpha solution: Human hypoxia-inducible factor-1 alpha (Union Biomed, EK1392S) was dissolved with deionized water to obtain.
[0103] 1-hydroxycyclohexyl phenyl methyl ketone solution: 1-hydroxycyclohexyl phenyl methyl ketone (purchased from Shanghai Jizhi Biotechnology Co., Ltd., CAS: 947-19-3) was dissolved with deionized water to obtain.
[0104] Vascular endothelial growth factor A solution: Vascular endothelial growth factor A (purchased from MedChemExpress Biotechnology Co., Ltd., Catalog No. HY-P73473) was dissolved with deionized water to obtain.
[0105] Human parathyroid hormone-related protein solution: Human parathyroid hormone-related protein (purchased from Shanghai Yankun Biotechnology Co., Ltd., Catalog No. F05609) was dissolved with deionized water to obtain
[0106] Glutaraldehyde solution: Glutaraldehyde (purchased from Shanghai Macklin Biochemical Technology Co., Ltd., Catalog No. G849973) was dissolved with deionized water to obtain.
[0107] Recombinant human transforming growth factor-β1 solution: Recombinant human transforming growth factor-β1 (TGFbeta 1 / TGFβ1 protein, purchased from MedChemExpress Biotechnology Co., Ltd., Catalog No. HY-P7118) was dissolved with deionized water to obtain.
[0108] Desferrioxamine solution: Desferrioxamine (purchased from MedChemExpress Biotechnology Co., Ltd., Catalog No. HY-B1625) was dissolved with deionized water to obtain.
[0109] Baicalin solution: Baicalin (purchased from MedChemExpress Biotechnology Co., Ltd., Catalog No. HY-N0197) was dissolved with deionized water to obtain.
[0110] Epichlorohydrin solution: Epichlorohydrin (purchased from Shanghai Macklin Biotechnology Co., Ltd., Catalog No. E808937) was dissolved with deionized water to obtain.
[0111] Example 1
[0112] Step one: polycaprolactone (purchased from Shanghai Aladdin Biochem Technology Co., Ltd., item number: P579406, weight average molecular weight 8-10 million) was used for fused deposition printing, the nozzle extrusion temperature was set to 70°C, and the printing speed was 30 mm / min. The printed polycaprolactone scaffold had two layers of transverse large channels, each layer had 8 channels, and the transverse large channels were connected with the longitudinal large channels. The outer diameter of the transverse large channels was 3 mm, and the inner diameter was 0.8 mm; the diameter of the longitudinal large channels was 3 mm. Then, 2 g / L dopamine (purchased from Shanghai Aladdin Biochem Technology Co., Ltd., item number: D408026, same below) reaction solution was prepared, and the polycaprolactone scaffold material was immersed in the dopamine reaction solution for 10 hours at a reaction temperature of 25°C. Finally, the reacted scaffold was vacuum dried to obtain a polydopamine modified polycaprolactone scaffold material.
[0113] Step two: chitosan solution, genipin solution and chitin whisker liquid crystal were mixed to obtain a liquid crystal hydrogel precursor, wherein the content of each substance was 1% chitosan, 0.3% genipin, 7% chitin whisker, and the balance was solvent. The self-assembled liquid crystal precursor was injected into the transverse large channels of the scaffold and pre-crosslinked for 2 hours; then, a copper rod with a diameter of 3 mm was inserted into the liquid nitrogen pool at one end and inserted into the longitudinal large channels of the scaffold at the other end, and radial freezing was carried out for 0.5 hours, followed by freeze-drying at -20°C for 6 hours to obtain a scaffold with micron radial channels.
[0114] Step three: a recombinant human bone morphogenetic protein 2 solution, a polyethylene glycol diacrylate (average molecular weight ~600) solution, a phenyl (2,4,6-trimethylbenzoyl) lithium phosphate solution and a chitin whisker liquid crystal were mixed to obtain a liquid crystal precursor, wherein the content of each substance was 0.05% recombinant human bone morphogenetic protein 2, 10% polyethylene glycol diacrylate, 0.005% phenyl (2,4,6-trimethylbenzoyl) lithium phosphate, 9% chitin whisker, and the balance was solvent. The precursor was injected into the longitudinal large channels, and after crosslinking with ultraviolet light with a wavelength of 365 nm for 5 minutes, a lower bone repair scaffold material was obtained.
[0115] Step four: a cylindrical silica gel mold is sleeved on the upper end of the lower bone repair scaffold material, and the height is 1 mm. A recombinant human insulin-like growth factor 1 solution, a polyethylene glycol diacrylate (average molecular weight of ~ 600) solution, a phenyl (2,4,6-trimethylbenzoyl) lithium phosphate solution, and a chitin whisker liquid crystal are mixed to obtain a liquid crystal precursor solution, wherein the content of each substance is 0.05% recombinant human insulin-like growth factor 1, 5% polyethylene glycol diacrylate, 0.005% phenyl (2,4,6-trimethylbenzoyl) lithium phosphate, 5% chitin whisker, and the solvent accounts for the rest. The liquid crystal precursor solution is injected into the upper mold, and a wavelength of 365 nm ultraviolet light is used for crosslinking for 5 minutes. After complete crosslinking, the mold is removed to obtain a bionic bone / cartilage double-layer composite scaffold material as shown in Figure 1 .
[0116] Example 2
[0117] Step one: left-handed polylactic acid (weight average molecular weight of 200,000, purchased from Shenzhen Poly Bio-technology Co., Ltd.) is used for fused deposition printing, and the nozzle extrusion temperature is set to 200°C, and the printing speed is 50 mm / min. As shown in Figure 2 , the transverse large channels of the printed polylactic acid scaffold are two layers, each layer has 8 channels, and is penetrated with the longitudinal large channels. The outer diameter of the transverse large channels of the scaffold ranges from 2.5 mm to 0.8 mm, and the diameter of the longitudinal large channels is 3 mm. Then, a 2 g / L dopamine reaction solution is prepared, and the polylactic acid scaffold material is immersed in the reaction solution for 5 hours, and the reaction temperature is 20°C. Finally, the reacted scaffold is vacuum dried to obtain a polydopamine modified polylactic acid scaffold material.
[0118] Step two: chitosan solution, genipin solution, and chitin whisker liquid crystal are mixed to obtain a liquid crystal hydrogel precursor solution, wherein the content of each substance is 1.5% chitosan, 0.3% genipin, and 9% chitin whisker, and the solvent accounts for the rest. The self-assembled liquid crystal precursor solution is injected into the transverse large channels of the scaffold and pre-crosslinked for 12 hours; then, one end of a copper rod with a diameter of 2.5 mm is inserted into a liquid nitrogen pool, and the other end is inserted into the longitudinal large channels of the scaffold, and radial freezing is performed for 1 hour, and then freezing drying is performed at -15°C for 7 hours, and a scaffold with micron radial channels is obtained by freezing drying.
[0119] Step three: mixing human hypoxia-inducible factor-1 alpha solution, polyethylene glycol diacrylate (weight average molecular weight of 2000) solution, 1-hydroxycyclohexyl phenyl ketone solution, and chitin whisker liquid crystal to obtain a liquid crystal precursor, wherein the content of each substance is 0.5% human hypoxia-inducible factor-1 alpha, 9% polyethylene glycol diacrylate, 0.01% 1-hydroxycyclohexyl phenyl ketone, 8% chitin whisker, and the rest is solvent. The precursor is perfused into the longitudinal large channel, and after crosslinking for 10 minutes under ultraviolet light with a wavelength of 365 nm, a lower bone repair scaffold material is obtained.
[0120] Step four: a cylindrical silica gel mold is sleeved on the upper end of the lower bone repair scaffold material, and the mold is 1 millimeter higher. Recombinant human bone morphogenetic protein 2 solution, polyethylene glycol diacrylate (weight average molecular weight of 2000) solution, 1-hydroxycyclohexyl phenyl ketone solution, and chitin whisker liquid crystal are mixed to obtain a liquid crystal precursor, wherein the content of each substance is 0.02% recombinant human bone morphogenetic protein 2, 7% polyethylene glycol diacrylate, 0.01% 1-hydroxycyclohexyl phenyl ketone, 7% chitin whisker, and the rest is solvent. The liquid crystal precursor is injected into the upper mold, and after crosslinking for 10 minutes under ultraviolet light with a wavelength of 365 nm, the mold is removed to obtain a biomimetic bone / cartilage double-layer composite scaffold material.
[0121] Example 3
[0122] Step one: using left-handed polylactic acid (weight average molecular weight of 100,000) for fused deposition printing, the nozzle extrusion temperature is set to 180°C, and the printing rate is 40 mm / min. The printed polylactic acid scaffold has two layers of transverse large channels, each layer has 8 channels, and the channels are connected with the longitudinal large channel. The outer diameter of the transverse large channel of the scaffold ranges from 2.5 mm to 0.7 mm, and the diameter of the longitudinal large channel is 3 mm. Then, a 2 g / L dopamine reaction solution is prepared, and the polylactic acid scaffold material is immersed in the reaction solution for 10 hours at a reaction temperature of 25°C. Finally, the reacted scaffold is vacuum dried to obtain a polydopamine modified polylactic acid scaffold material.
[0123] Step two: mixing chitosan solution, genipin solution, and chitin whisker liquid crystal to obtain a liquid crystal hydrogel precursor, wherein the content of each substance is 2% chitosan, 0.3% genipin, 10% chitin whisker, and the rest is solvent. The liquid crystal precursor is self-assembled and injected into the transverse large channel of the scaffold for pre-crosslinking for 12 hours; then, one end of a copper rod with a diameter of 2.5 mm is connected to a liquid nitrogen pool, and the other end is inserted into the longitudinal large channel of the scaffold for radial freezing for 2 hours, and then freeze-drying at -20°C for 11 hours to obtain a scaffold with micron radial channels. As Figure 3As shown, the scanning electron microscope images show that, in structure, the micron radial channels are arranged in order within the large channels, the channel structure is complete, and a gradient orientation structure is presented. In size, the distal end size of the micron radial channels is greater than the proximal end size, which may be conducive to the recruitment and migration of cells.
[0124] Step three: mixing vascular endothelial growth factor A solution, polyethylene glycol diacrylate (weight average molecular weight of 2000) solution, 1-hydroxycyclohexyl phenyl ketone solution and chitin whisker liquid crystal to obtain a liquid crystal precursor, wherein the content of each substance is 0.2% vascular endothelial growth factor A, 10% polyethylene glycol diacrylate, 0.01% 1-hydroxycyclohexyl phenyl ketone and 9% chitin whisker by mass percent, and the solvent is the balance. The precursor is perfused into the longitudinal large channel, and after crosslinking under ultraviolet light with a wavelength of 365 nm for 5 minutes, a lower bone repair scaffold material is obtained.
[0125] Step four: a cylindrical silica gel mold is sleeved on the upper end of the lower bone repair scaffold material, which is 2 millimeters higher, and human parathyroid hormone-related protein solution, polyethylene glycol diacrylate (weight average molecular weight of 2000) solution, 1-hydroxycyclohexyl phenyl ketone solution and chitin whisker liquid crystal are mixed to obtain a liquid crystal precursor, wherein the content of each substance is 0.01% human parathyroid hormone-related protein, 6% polyethylene glycol diacrylate, 0.01% 1-hydroxycyclohexyl phenyl ketone and 7% chitin whisker by mass percent, and the solvent is the balance. The liquid crystal precursor is injected into the upper mold, and after crosslinking under ultraviolet light with a wavelength of 365 nm for 5 minutes, the biomimetic bone / cartilage double-layer composite scaffold material is obtained after demolding.
[0126] Example 4
[0127] Step one: using left-handed polylactic acid (weight average molecular weight of 200,000) for fused deposition printing, the nozzle extrusion temperature is set to 185°C, and the printing rate is 45 mm / min. The printed polylactic acid scaffold has two layers of transverse large channels, each layer has 4 channels, and penetrates the longitudinal large channel. The outer diameter of the transverse large channel of the scaffold ranges from 3 mm to 0.5 mm; the longitudinal large channel has a diameter of 3 mm. Then, 1 g / L of dopamine reaction solution is prepared, and the polylactic acid scaffold material is immersed in the reaction solution for 8 hours, and the reaction temperature is 20°C. Finally, the reacted scaffold is vacuum dried to obtain a polydopamine modified polylactic acid scaffold material.
[0128] Step two: mix the chitosan solution, glutaraldehyde solution, and chitin whisker liquid crystal to obtain a liquid crystal hydrogel precursor, wherein the content of each substance is 1% chitosan, 0.1% glutaraldehyde, and 8% chitin whisker, and the solvent accounts for the rest. The self-assembled liquid crystal precursor is injected into the horizontal large channel of the scaffold for pre-crosslinking for 15 hours; then, one end of a copper rod with a diameter of 3 mm is inserted into a liquid nitrogen pool, and the other end is inserted into the vertical large channel of the scaffold for radial freezing for 1.5 hours; then, the scaffold is frozen and dried at -25°C for 10 hours to obtain a scaffold with micron radial channels. As shown in FIG. 2, the micron radial channels exhibit a liquid crystal colorful texture, which is a typical feature of cholesteric liquid crystal. Further testing by circular dichroism spectroscopy shows that the micron radial channels also have chiral characteristics. Based on the above conclusions, the micron radial channels are considered to have good cholesteric liquid crystal texture. Figure 4
[0129] Step three: mix the recombinant human transforming growth factor-β1 solution, polyethylene glycol diacrylate (weight average molecular weight 1000) solution, phenyl (2,4,6-trimethylbenzoyl) lithium phosphate solution, and chitin whisker liquid crystal to obtain a liquid crystal precursor, wherein the content of each substance is 0.1% recombinant human transforming growth factor-β1, 10% polyethylene glycol diacrylate, 0.01% phenyl (2,4,6-trimethylbenzoyl) lithium phosphate, and 10% chitin whisker. The precursor is injected into the vertical large channel, and a lower bone repair scaffold material is obtained after crosslinking for 10 minutes under ultraviolet light with a wavelength of 365 nm.
[0130] Step four: a cylindrical silica gel mold is sleeved on the upper end of the lower bone repair scaffold material, with an overhang of 1.5 mm. A liquid crystal precursor is obtained by mixing a recombinant human transforming growth factor-β1 solution, a polyethylene glycol diacrylate (weight average molecular weight 1000) solution, a phenyl (2,4,6-trimethylbenzoyl) lithium phosphate solution, and a chitin whisker liquid crystal, wherein the content of each substance is 0.01% recombinant human transforming growth factor-β1, 8% polyethylene glycol diacrylate, 0.01% phenyl (2,4,6-trimethylbenzoyl) lithium phosphate, and 7% chitin whisker. The liquid crystal precursor is injected into the upper mold, and an upper bone / cartilage double-layer composite scaffold material is obtained after crosslinking for 5 minutes under ultraviolet light with a wavelength of 365 nm and demolding after complete crosslinking.
[0131] Example 5
[0132] Step one: polyether ether ketone (weight average molecular weight of 50,000, purchased from Shenzhen Polygen Biotechnology Co., Ltd.) was used for fused deposition printing, and the nozzle extrusion temperature was set to 350℃, and the printing speed was 40 mm / min. The printed polyether ether ketone scaffold had two layers of transverse large channels, each layer had 6 channels, and was connected with the longitudinal large channel. The outer diameter of the transverse large channel of the scaffold was 3 mm, and the inner diameter was 0.5 mm; the longitudinal large channel diameter was 4 mm. Then, 1.5 g / L dopamine reaction solution was prepared, and the polyether ether ketone scaffold material was immersed in the reaction solution for 12 hours, and the reaction temperature was 25℃. Finally, the reacted scaffold was vacuum dried to obtain a polydopamine modified polyether ether ketone scaffold material.
[0133] Step two: mix the chitosan solution, glutaraldehyde solution and chitin whisker liquid crystal to obtain a liquid crystal hydrogel precursor, wherein the content of each substance is 3% chitosan, 0.4% glutaraldehyde, 9% chitin whisker, and the solvent is the balance. Inject the self-assembled liquid crystal precursor into the transverse large channel of the scaffold for pre-crosslinking for 15 hours; then, one end of a 4 mm diameter copper rod is inserted into a liquid nitrogen pool, and the other end is inserted into the longitudinal large channel of the scaffold, and radial freezing is carried out for 4 hours, and then freeze-drying is carried out at-30℃ for 14 hours to obtain a scaffold with micron radial channels.
[0134] Step three: mix the deferoxamine solution, polyethylene glycol diacrylate (weight average molecular weight of 1000) solution, phenyl (2,4,6-trimethylbenzoyl) lithium phosphate solution and chitin whisker liquid crystal to obtain a liquid crystal precursor; wherein the content of each substance is 0.1% deferoxamine, 10% polyethylene glycol diacrylate, 0.01% phenyl (2,4,6-trimethylbenzoyl) lithium phosphate and 8% chitin whisker, and the solvent is the balance. Then, the precursor is perfused into the longitudinal large channel, and after crosslinking for 10 minutes under ultraviolet light with a wavelength of 365 nm, a lower bone repair scaffold material is obtained.
[0135] Step four: a cylindrical silica gel mold is sleeved on the upper end of the lower bone repair scaffold material, and the height is 1 mm. Mix the baicalin solution, polyethylene glycol diacrylate (weight average molecular weight of 1000) solution, phenyl (2,4,6-trimethylbenzoyl) lithium phosphate solution and chitin whisker liquid crystal to obtain a liquid crystal precursor; wherein the content of each substance is 0.02% baicalin, 6% polyethylene glycol diacrylate, 0.01% phenyl (2,4,6-trimethylbenzoyl) lithium phosphate, 7% chitin whisker, and the solvent is the balance. Inject the liquid crystal precursor into the upper mold, crosslink for 5 minutes under ultraviolet light with a wavelength of 365 nm, and after complete crosslinking, demold to obtain a biomimetic bone / cartilage double-layer composite scaffold material.
[0136] As Figure 5The release behaviors of the two drugs in the material were detected, and both desferrioxamine and baicalin showed rapid release behavior in the early stage, and then slowed down. Finally, the cumulative release rates of desferrioxamine and baicalin can reach 75.6% and 82.5%, respectively.
[0137] Example 6
[0138] Step one: melt deposition printing was performed using left-handed polylactic acid (weight average molecular weight 200,000), the nozzle extrusion temperature was set to 200℃, and the printing rate was 45 mm / min. The printed polylactic acid scaffold had two layers of transverse large channels, each layer had 8 channels, and the channels were connected with longitudinal large channels. The outer diameter of the transverse large channel of the scaffold ranged from 3 mm to 0.8 mm, and the diameter of the longitudinal large channel was 3 mm. Then, a 2 g / L dopamine reaction solution was prepared, and the polylactic acid scaffold material was immersed in the reaction solution for 15 hours at a reaction temperature of 20℃. Finally, the reacted scaffold was vacuum dried to obtain a polydopamine modified polylactic acid scaffold material.
[0139] Step two: the chitosan solution, the epichlorohydrin solution and the chitin whisker liquid crystal were mixed to obtain a liquid crystal hydrogel precursor solution; the contents of the various substances were 2% chitosan, 0.2% epichlorohydrin, 8% chitin whisker, and the solvent made up the rest. The liquid crystal precursor solution was injected into the transverse large channels of the scaffold for pre-crosslinking for 10 hours; then, one end of a 3 mm diameter copper rod was inserted into a liquid nitrogen pool, and the other end was inserted into the longitudinal large channel of the scaffold, and radial freezing was performed for 3 hours, followed by freeze-drying at-30℃ for 15 hours to obtain a scaffold with micron radial channels.
[0140] Step three: the desferrioxamine solution, the polyethylene glycol diacrylate (weight average molecular weight 5000) solution, the phenyl (2,4,6-trimethylbenzoyl) lithium phosphate solution and the chitin whisker liquid crystal were mixed to obtain a liquid crystal precursor solution; the contents of the various substances were 0.2% desferrioxamine, 10% polyethylene glycol diacrylate, 0.01% phenyl (2,4,6-trimethylbenzoyl) lithium phosphate, 10% chitin whisker, and the solvent made up the rest. The precursor solution was perfused into the longitudinal large channel, and a lower bone repair scaffold material was obtained after crosslinking with ultraviolet light of wavelength 365 nm for 12 minutes.
[0141] Step four: a cylindrical silica gel mold is sleeved on the upper end of the lower bone repair scaffold material, and the height is 1 mm. A baicalin solution, a polyethylene glycol diacrylate (weight average molecular weight 5000) solution, a phenyl (2,4,6-trimethylbenzoyl) lithium phosphate solution, and a chitin whisker solution are mixed to obtain a liquid crystal precursor solution. The content of each substance is 0.05% baicalin, 8% polyethylene glycol diacrylate, 0.008% phenyl (2,4,6-trimethylbenzoyl) lithium phosphate, 8% chitin whisker, and the balance is solvent. The liquid crystal precursor solution is injected into the upper mold, and a wavelength of 365 nm ultraviolet light is used for crosslinking for 12 minutes. After complete crosslinking, the mold is removed to obtain a biomimetic bone / cartilage double-layer composite scaffold material.
[0142] The interface bonding performance between the upper hydrogel and the lower scaffold material of the double-layer scaffold material is observed by scanning electron microscopy, as shown in FIG. 6, and no obvious cracks or separation phenomenon occurs between the upper layer and the lower layer. The results show that the prepared double-layer bone / cartilage scaffold material has good interface bonding performance. Figure 6
[0143] Example 7
[0144] Step one: polyether ether ketone (weight average molecular weight 70,000) is used for fused deposition printing, and the nozzle extrusion temperature is set to 360°C, and the printing speed is 45 mm / min. The printed polyether ether ketone scaffold has two layers of transverse large channels, each layer has 8 channels, and is connected with the longitudinal large channel. The outer diameter of the transverse large channel of the scaffold ranges from 3 mm to 1 mm, and the diameter of the longitudinal large channel is 3 mm. Then, 2 g / L dopamine reaction solution is prepared, and the polyether ether ketone scaffold material is immersed in the reaction solution for 15 hours, and the reaction temperature is 20°C. Finally, the reacted scaffold is vacuum dried to obtain a polydopamine modified polyether ether ketone scaffold material.
[0145] Step two: the chitosan solution, the epichlorohydrin solution, and the chitin whisker liquid crystal are mixed to obtain a liquid crystal hydrogel precursor solution. The content of each substance is 2% chitosan, 0.2% epichlorohydrin, and 8% chitin whisker, and the balance is solvent. The liquid crystal precursor solution is injected into the transverse large channels of the scaffold for 10 hours of pre-crosslinking. Then, one end of a copper rod with a diameter of 3 mm is inserted into a liquid nitrogen pool, and the other end is inserted into the longitudinal large channel of the scaffold. Radial freezing is performed for 3 hours, and then freezing drying is performed at -35°C for 16 hours to obtain a scaffold with micron radial channels.
[0146] Step three: a liquid crystal precursor solution is obtained by mixing deferoxamine solution, polyethylene glycol diacrylate (weight average molecular weight of 3000) solution, phenyl (2,4,6-trimethylbenzoyl) lithium phosphate solution and chitin whisker liquid crystal; the content of each substance is 0.2% deferoxamine, 10% polyethylene glycol diacrylate, 0.01% phenyl (2,4,6-trimethylbenzoyl) lithium phosphate, 10% chitin whisker, and the solvent accounts for the rest. The precursor solution is perfused into the longitudinal large channel, and the lower bone repair scaffold material is obtained after crosslinking for 8 minutes using ultraviolet light with a wavelength of 365 nm.
[0147] Step four: a cylindrical silica gel mold is sleeved on the upper end of the lower bone repair scaffold material, and the height is 1 mm. A liquid crystal precursor solution is obtained by mixing baicalin solution, polyethylene glycol diacrylate (weight average molecular weight of 3000) solution, phenyl (2,4,6-trimethylbenzoyl) lithium phosphate solution and chitin whisker liquid crystal; the content of each substance is 0.05% baicalin, 8% polyethylene glycol diacrylate, 0.01% phenyl (2,4,6-trimethylbenzoyl) lithium phosphate, 8% chitin whisker, and the solvent accounts for the rest. The liquid crystal precursor solution is injected into the upper mold, and the biomimetic bone / cartilage double-layer composite scaffold material is obtained after crosslinking for 8 minutes using ultraviolet light with a wavelength of 365 nm and demolding after complete crosslinking.
[0148] As shown in Figure 7 , the mechanical properties of the upper cartilage hydrogel were evaluated by compression cycle test, and a cylindrical hydrogel with a diameter of 10 mm and a height of 4 mm was selected for testing. After more than 1000 compressions, the hydrogel still maintained its original strength and did not show significant attenuation, indicating that the prepared hydrogel had good compression resistance and mechanical stability.
[0149] Example 8
[0150] Step one: melt deposition printing is performed using left-handed polylactic acid (weight average molecular weight of 300,000), and the nozzle extrusion temperature is set to 210°C, and the printing rate is 40 mm / min. The printed polylactic acid scaffold has two layers of transverse large channels, each layer has 6 channels, and is connected with the longitudinal large channel. The outer diameter of the transverse large channel of the scaffold ranges from 3 mm to 2 mm, and the diameter of the longitudinal large channel is 3 mm. Then, a dopamine reaction solution of 1.5 g / L is prepared, and the polylactic acid scaffold material is immersed in the reaction solution for 12 hours, and the reaction temperature is 15°C. Finally, the reacted scaffold is vacuum dried to obtain a polydopamine modified polylactic acid scaffold material.
[0151] Step two: mix the chitosan solution, glutaraldehyde solution and chitin whisker liquid crystal to obtain a liquid crystal hydrogel precursor; the content of each substance is 1.5% chitosan, 0.2% glutaraldehyde, 8.5% chitin whisker, and the balance is solvent. The self-assembled liquid crystal precursor is injected into the horizontal large channel of the scaffold for pre-crosslinking for 12 hours; then, one end of a 3mm diameter copper rod is inserted into a liquid nitrogen pool, and the other end is inserted into the vertical large channel of the scaffold, and radial freezing is performed for 4.5 hours, followed by freeze-drying at -40°C for 16 hours to obtain a scaffold with micron radial channels.
[0152] Step three: mix the deferoxamine solution, polyethylene glycol diacrylate (800 weight average molecular weight) solution, phenyl (2,4,6-trimethylbenzoyl) lithium phosphate solution and chitin whisker liquid crystal to obtain a liquid crystal precursor; the content of each substance is 0.2% deferoxamine, 9% polyethylene glycol diacrylate, 0.01% phenyl (2,4,6-trimethylbenzoyl) lithium phosphate, 10% chitin whisker, and the balance is solvent. The precursor is perfused into the vertical large channel, and after crosslinking with ultraviolet light of wavelength 365nm for 12 minutes, a lower bone repair scaffold material is obtained.
[0153] Step four: a cylindrical silica gel mold is sleeved on the upper end of the lower bone repair scaffold material, which is 1mm higher, and a human parathyroid hormone related protein solution, polyethylene glycol diacrylate (600 weight average molecular weight) solution, phenyl (2,4,6-trimethylbenzoyl) lithium phosphate solution and chitin whisker liquid crystal are mixed to obtain a liquid crystal precursor; the content of each substance is 0.05% human parathyroid hormone related protein, 8% polyethylene glycol diacrylate, 0.01% phenyl (2,4,6-trimethylbenzoyl) lithium phosphate, 8% chitin whisker, and the balance is solvent. The liquid crystal precursor is injected into the upper mold, and crosslinked with ultraviolet light of wavelength 365nm for 12 minutes, and after complete crosslinking, the biomimetic bone / cartilage double-layer composite scaffold material is obtained after demolding.
[0154] The pure left-handed polylactic acid scaffold material was selected as a control group, and 30 million weight average molecular weight of left-handed polylactic acid was used for fused deposition printing, and the nozzle extrusion temperature was set to 210 DEG C, and the printing rate was 40 mm / min. The transverse large channel of the printed polylactic acid scaffold was two layers, and the number of channels in each layer was 6, and was penetrated with the longitudinal large channel. The outer diameter of the transverse large channel of the scaffold was 3 mm, and the inner diameter was 2 mm; the longitudinal large channel diameter was 3 mm. At the same time, deferoxamine solution, polyethylene glycol diacrylate (800 weight average molecular weight) solution, phenyl (2, 4, 6-trimethylbenzoyl) lithium phosphate solution and chitin whisker liquid crystal were mixed to obtain a liquid crystal precursor, wherein the content of each substance is 0.2% deferoxamine, 9% polyethylene glycol diacrylate, 0.01% phenyl (2, 4, 6-trimethylbenzoyl) lithium phosphate, 10% chitin whisker, and the solvent is the balance. The precursor liquid was perfused into the longitudinal large channel, and after photo-crosslinking for 12 minutes, the lower layer of the bone repair scaffold material without loading the osteogenic and angiogenic drugs was obtained.
[0155] The above three groups of scaffold materials were prepared into cylinders with a diameter of 15 mm and a height of 4 mm, and mouse mesenchymal stem cells (purchased from Saiye (Guangzhou) Biotechnology Co., Ltd., product number: MUBMX-01001) were cultured. The cells were placed in a 25 cm 2 tissue culture flask containing 4 mL of culture medium, and cultured in a 37 DEG C, 5% CO2 concentration and 95% relative humidity incubator. The culture medium used in the cell culture process was complete culture medium containing 10% fetal bovine serum (purchased from the United States Gibco Co., Ltd., product number: 26170035), 1% double antibody (purchased from the United States Gibco Co., Ltd., product number: 15140148) and 89% DMEM (purchased from the United States Gibco Co., Ltd., product number: 11965092), and the cell culture medium needed to be replaced every other day. The sterilized scaffold sample with a diameter of 15 mm was placed in a 24-well plate, and the cells were inoculated on the well plate at a density of 1 x 10 4 cells / well, and three groups of parallel samples were set.
[0156] After 48 hours of culture, rhodamine-labeled phalloidin (purchased from the United States Gibco Co., Ltd., product number: A12379) and 4', 6-diamidino-2-phenylindole (purchased from the United States Gibco Co., Ltd., product number: D1306) were used to observe the cell morphology. As shown in Figure 8 the laser confocal microscope, the morphology of bone marrow mesenchymal stem cells on the scaffold material was observed, compared with the polylactic acid scaffold, the construction of the micron radial channel and the introduction of the angiogenic drug enhanced the expression of actin filaments and the spreading area of the stem cells, which confirmed that it had excellent cell affinity.
[0157] Example 9
[0158] Step one: melt deposition printing was performed using L-polylactic acid (weight average molecular weight of 300,000), the nozzle extrusion temperature was set to 220℃, and the printing rate was 40 mm / min. The printed polylactic acid scaffold had three layers of transverse large channels, each layer had 8 channels, and the channels were connected with the longitudinal large channels. The outer diameter of the transverse large channels of the scaffold ranged from 2.5 mm to 0.4 mm, and the diameter of the longitudinal large channels was 0.5 mm. Then, a 4 g / L dopamine reaction solution was prepared, and the polylactic acid scaffold material was immersed in the reaction solution for 24 hours at a reaction temperature of 30℃. Finally, the reacted scaffold was vacuum dried to obtain a polydopamine modified polylactic acid scaffold material.
[0159] Step two: a chitosan solution, a glutaraldehyde solution, and a chitin whisker liquid crystal were mixed to obtain a liquid crystal hydrogel precursor solution; the contents of the various substances were 5% chitosan, 0.5% glutaraldehyde, and 12% chitin whiskers, and the solvent made up the rest. The liquid crystal precursor solution was injected into the transverse large channels of the scaffold for pre-crosslinking for 12 hours; then, one end of a copper rod with a diameter of 0.5 mm was inserted into a liquid nitrogen pool, and the other end was inserted into the longitudinal large channels of the scaffold, and radial freezing was performed for 5 hours, followed by freeze-drying at -10℃ for 12 hours to obtain a scaffold with micron radial channels.
[0160] Step three: a deferoxamine solution, a polyethylene glycol diacrylate (weight average molecular weight of 4000) solution, a 1-hydroxycyclohexyl phenyl ketone solution, and a chitin whisker liquid crystal were mixed to obtain a liquid crystal precursor solution; the contents of the various substances were 0.2% deferoxamine, 9% polyethylene glycol diacrylate, 0.01% 1-hydroxycyclohexyl phenyl ketone, 12% chitin whiskers, and the solvent made up the rest. The precursor solution was perfused into the longitudinal large channels, and a lower bone repair scaffold material was obtained after crosslinking with ultraviolet light at a wavelength of 365 nm for 20 minutes.
[0161] Step four: a cylindrical silica gel mold was sleeved on the upper end of the lower bone repair scaffold material, and the mold was raised by 3 mm. A recombinant human transforming growth factor-β1 solution, polyethylene glycol diacrylate (weight average molecular weight of 4000), 1-hydroxycyclohexyl phenyl ketone, and a chitin whisker liquid crystal were mixed to obtain a liquid crystal precursor solution; the contents of the various substances were 0.05% recombinant human transforming growth factor-β1, 8% polyethylene glycol diacrylate, 0.01% 1-hydroxycyclohexyl phenyl ketone, 7% chitin whiskers, and the solvent made up the rest. The liquid crystal precursor solution was injected into the upper mold, and a biomimetic bone / cartilage double-layer composite scaffold material was obtained after crosslinking with ultraviolet light at a wavelength of 365 nm for 20 minutes and demolding after complete crosslinking.
[0162] The pure left-handed polylactic acid scaffold material is selected as a control group, and 300,000 weight average molecular weight left-handed polylactic acid is used for fused deposition printing, and the nozzle extrusion temperature is set to 220°C, and the printing rate is 40 mm / min. The transverse large channel of the printed polylactic acid scaffold is three layers, the number of channels in each layer is 8, and is penetrated with the longitudinal large channel. The outer diameter of the transverse large channel of the scaffold is 2.5 mm, and the inner diameter is 0.4 mm; the diameter of the longitudinal large channel is 0.5 mm. At the same time, a solution of polyethylene glycol diacrylate with a weight average molecular weight of 4000, a solution of 1-hydroxycyclohexyl phenyl ketone and a chitin whisker liquid crystal are mixed to obtain a liquid crystal precursor solution; the content of each substance is 9% polyethylene glycol diacrylate, 0.01% 1-hydroxycyclohexyl phenyl ketone, 12% chitin whisker, and the solvent is the balance. The precursor solution is perfused into the longitudinal large channel, and after crosslinking for 20 minutes under ultraviolet light with a wavelength of 365 nm, a lower layer of bone repair scaffold material without loading osteogenic and angiogenic drugs is obtained.
[0163] The above three groups of scaffold materials are prepared into cylinders with a diameter of 15 mm and a height of 4 mm, and mouse mesenchymal stem cells are cultured (as in Example 8), as shown in Figure 9 The monitoring of alkaline phosphatase, type I collagen and calcium nodules secreted by stem cells on the scaffold shows that, compared with the polylactic acid scaffold, the construction of the micron radial channel and the introduction of the angiogenic drug enhance the osteogenic differentiation ability of the stem cells in the early, middle and late stages.
[0164] Example 10
[0165] Step one: left-handed polylactic acid (weight average molecular weight 150,000) is used for fused deposition printing, and the nozzle extrusion temperature is set to 195°C, and the printing rate is 35 mm / min. The transverse large channel of the printed polylactic acid scaffold is two layers, the number of channels in each layer is 5, and is penetrated with the longitudinal large channel. The outer diameter of the transverse large channel of the scaffold is 2.5 mm, and the inner diameter is 0.5 mm; the diameter of the longitudinal large channel is 2.5 mm. Then, a 2.5 g / L dopamine reaction solution is prepared, and the polylactic acid scaffold material is immersed in the reaction solution for 16 hours, and the reaction temperature is 15°C. Finally, the reacted scaffold is vacuum dried to obtain a polydopamine modified polylactic acid scaffold material.
[0166] Step two: chitosan solution, glutaraldehyde solution and chitin whisker liquid crystal are mixed to obtain a liquid crystal precursor solution; the content of each substance is 2.5% chitosan, 0.1% glutaraldehyde, 11% chitin whisker, and the solvent is the balance. The liquid crystal precursor solution is injected into the transverse large channel of the scaffold for pre-crosslinking for 9 hours; then, one end of a copper rod with a diameter of 2.5 mm is inserted into a liquid nitrogen pool, and the other end is inserted into the longitudinal large channel of the scaffold, and radial freezing is performed for 4.5 hours, and then freezing drying is performed at -20°C for 12 hours to obtain a scaffold with micron radial channels.
[0167] Step three: a deferoxamine solution, a polyethylene glycol diacrylate (weight average molecular weight of 200) solution, a 1-hydroxycyclohexyl phenyl ketone solution, and a chitin whisker liquid crystal are mixed to obtain a liquid crystal precursor solution; the content of each substance is 0.3% deferoxamine, 11% polyethylene glycol diacrylate, 0.01% 1-hydroxycyclohexyl phenyl ketone, and 12% chitin whisker, with the balance being solvent. The precursor solution is injected into the longitudinal large channel, and a lower bone repair scaffold material is obtained after crosslinking under ultraviolet light with a wavelength of 365 nm for 8 minutes.
[0168] Step four: a cylindrical silica gel mold is sleeved on the upper end of the lower bone repair scaffold material, with an overhang of 1.5 mm. A recombinant human transforming growth factor-β1 solution, a polyethylene glycol diacrylate (weight average molecular weight of 200) solution, a 1-hydroxycyclohexyl phenyl ketone solution, and a chitin whisker liquid crystal are mixed to obtain a liquid crystal precursor solution; the content of each substance is 0.06% recombinant human transforming growth factor-β1, 4% polyethylene glycol diacrylate, 0.008% 1-hydroxycyclohexyl phenyl ketone, and 7% chitin whisker, with the balance being solvent. The liquid crystal precursor solution is injected into the upper mold, and a bionic bone / cartilage double-layer composite scaffold material is obtained after complete crosslinking under ultraviolet light with a wavelength of 365 nm for 8 minutes.
[0169] Pure left-handed polylactic acid scaffold material is selected as a control group, and 1.5 million weight average molecular weight left-handed polylactic acid is used for fused deposition printing, with the nozzle extrusion temperature set to 195°C and the printing rate set to 35 mm / min. The printed polylactic acid scaffold has two layers of transverse large channels, with 5 channels in each layer and penetrating the longitudinal large channel. The outer diameter of the transverse large channel ranges from 2.5 mm to 0.5 mm, and the diameter of the longitudinal large channel is 2.5 mm. Meanwhile, a polyethylene glycol diacrylate solution with a weight average molecular weight of 200, a 1-hydroxycyclohexyl phenyl ketone solution, and a chitin whisker liquid crystal are mixed to obtain a liquid crystal precursor solution; the content of each substance is 11% polyethylene glycol diacrylate, 0.01% 1-hydroxycyclohexyl phenyl ketone, and 12% chitin whisker, with the balance being solvent. The precursor solution is injected into the longitudinal large channel, and a lower bone repair scaffold material without loading osteogenic and angiogenic drugs is obtained after crosslinking under ultraviolet light with a wavelength of 365 nm for 8 minutes.
[0170] The above three groups of scaffold materials are prepared into cylinders with a diameter of 15 mm and a height of 4 mm, and human umbilical vein endothelial cells (purchased from Beijing Baoerbo Biological Technology Co., Ltd., product number: bio-105890) are cultured. The culture process is the same as in Example 8. As shown in FIG. 8, the cells grow well on the surface of the scaffold material, and the cells grow into a three-dimensional structure on the surface of the scaffold material. Figure 10As shown, by detecting the angiogenic markers of human umbilical vein endothelial cells on the stent (using reverse transcription PCR technology to detect the expression of angiogenic related genes of human umbilical vein endothelial cells, taking GAPDH as the internal reference, and the reaction conditions being 94℃ for 5 minutes, 50℃ for 2 minutes, 72℃ for 5 minutes, a total of 30 cycles (the primer sequence is shown in Table 1 below), we found that the introduction of angiogenic drugs can enhance the angiogenic ability of the stent material.
[0171] Table 1 Angiogenic gene primer sequence
[0172] Primer Forward sequencing (5'-3') Reverse sequencing (3'-5') Vascular endothelial growth factor GCAGATTATGCGGATCAAACC TTTCGTTTTTGCCCCTTTCC Hypoxia-inducible factor GTGGATTACCACAGCTGA GCTCAGTTAACTTGATCCA
[0173] Example 11
[0174] Step one: melt deposition printing is performed using left-handed polylactic acid (with a weight average molecular weight of 200,000), the nozzle extrusion temperature is set to 205℃, and the printing rate is 40 mm / min. The printed polylactic acid stent has three layers of transverse large channels, each layer has 8 channels, and the channels are connected with the longitudinal large channels. The outer diameter of the transverse large channels of the stent ranges from 2 mm to 0.5 mm, and the diameter of the longitudinal large channels is 3 mm. Then, a 3 g / L dopamine reaction solution is prepared, and the polylactic acid stent material is immersed in the reaction solution for 18 hours at a reaction temperature of 30℃. Finally, the stent after reaction is vacuum dried to obtain a polydopamine modified polylactic acid stent material.
[0175] Step two: a chitosan solution, an epichlorohydrin solution, and a chitin whisker liquid crystal are mixed to obtain a liquid crystal hydrogel precursor solution; the content of each substance is 4% chitosan, 0.4% epichlorohydrin, and 10% chitin whisker, and the solvent accounts for the rest. The self-assembled liquid crystal precursor solution is injected into the transverse large channels of the stent for pre-crosslinking for 10 hours; then, one end of a copper rod with a diameter of 3 mm is inserted into a liquid nitrogen pool, and the other end is inserted into the longitudinal large channels of the stent, and radial freezing is performed for 3.5 hours, followed by freezing drying at-20℃ for 12 hours to obtain a stent with micron radial channels.
[0176] Step three: a recombinant human transforming growth factor-β1 solution, a polyethylene glycol diacrylate (with a weight average molecular weight of 2000) solution, a 1-hydroxy cyclohexyl phenyl ketone solution, and a chitin whisker liquid crystal are mixed to obtain a liquid crystal precursor solution; the content of each substance is 0.2% recombinant human transforming growth factor-β1, 9% polyethylene glycol diacrylate, 0.01% 1-hydroxy cyclohexyl phenyl ketone, and 10% chitin whisker, and the solvent accounts for the rest. The precursor solution is perfused into the longitudinal large channels, and a lower bone repair stent material is obtained after crosslinking for 8 minutes using ultraviolet light with a wavelength of 365 nm.
[0177] Step 4: Place a cylindrical silicone mold over the upper part of the lower bone repair scaffold material, extending 2 mm above it. Mix baicalin solution, polyethylene glycol diacrylate solution with a weight-average molecular weight of 2000, 1-hydroxycyclohexylphenyl ketone solution, and chitin whisker liquid crystal to obtain a liquid crystal precursor solution. The content of each substance, by mass percentage, is 0.05% baicalin, 8% polyethylene glycol diacrylate, 0.01% 1-hydroxycyclohexylphenyl ketone, 8% chitin whiskers, with the solvent balance remaining. Inject the liquid crystal precursor solution into the upper mold and crosslink it using ultraviolet light at a wavelength of 365 nm for 8 minutes. After complete crosslinking, demold to obtain the biomimetic bone / cartilage bilayer composite scaffold material.
[0178] Pure polyethylene glycol diacrylate hydrogel was used as a control group. Similarly, a precursor solution containing 8% polyethylene glycol diacrylate with a weight average molecular weight of 2000 and 0.01% 1-hydroxycyclohexylphenyl ketone was prepared by mass fraction and injected into the upper mold. Crosslinking was performed under ultraviolet light at a wavelength of 365 nm for 8 minutes. After complete crosslinking, the material was demolded to obtain the upper cartilage repair hydrogel material. Simultaneously, a solution of polyethylene glycol diacrylate with a weight average molecular weight of 2000, a solution of 1-hydroxycyclohexylphenyl ketone, and chitin whisker liquid crystal were mixed to obtain a liquid crystal precursor solution. The content of each substance by mass percentage was: 8% polyethylene glycol diacrylate with a weight average molecular weight of 2000, 0.01% 1-hydroxycyclohexylphenyl ketone, 8% chitin whiskers, with the solvent balance. The liquid crystal precursor solution was injected into the upper mold and crosslinked with ultraviolet light at a wavelength of 365nm for 8 minutes. After complete crosslinking, the material was demolded to obtain the upper cartilage repair hydrogel material without the inclusion of cartilage-forming drugs.
[0179] The three groups of hydrogel materials were prepared into cylinders with a diameter of 10 mm and a height of 2 mm, and used for the culture of mouse mesenchymal stem cells (same as in Example 8). Figure 11 As shown, by detecting the chondrogenic differentiation markers of mesenchymal stem cells on the upper hydrogel (using reverse transcription PCR to detect the expression of chondrogenic genes in mouse mesenchymal stem cells, with GAPDH as an internal control, and reaction conditions of 94℃ for 5 minutes, 50℃ for 2 minutes, and 72℃ for 5 minutes, for a total of 30 cycles (primer sequences are shown in Table 2 below), we found that chitin whisker liquid crystals can promote the expression of aggregate proteoglycan (ACAN), Y chromosome sex-determining region transcription factor 9 (SOX-9), and type II collagen (COL-II). Furthermore, the introduction of baicalin further promoted the secretion of ACAN and COL-II. These results indicate that chitin whisker liquid crystals and the introduction of baicalin have a certain synergistic effect in promoting chondrogenic differentiation of stem cells.
[0180] Table 2 Primer sequences for chondrogenic genes
[0181] Primer Forward sequencing (5'-3') Reverse sequencing (3'-5') Aggrecan CTAGCTGCTTAGCAGGGATAACG AACCTTCGCTTCCATACTCG SOX-9 AGCGAACGCACATCAAGA GCTGCGTGACTGTAGTAGGA Collagen type II GCAAGACCGTCATCGAGTA AAGCAGACAGGCCCTATGT
[0182] Example 12
[0183] Step one: melt deposition printing was performed using left-handed polylactic acid (weight average molecular weight of 200,000), the nozzle extrusion temperature was set to 205℃, and the printing rate was 40 mm / min. The printed polylactic acid scaffold had three layers of transverse large channels, each layer had 8 channels, and the channels were connected with the longitudinal large channels. The outer diameter of the transverse large channels of the scaffold ranged from 2 mm to 0.5 mm, and the diameter of the longitudinal large channels was 3 mm. Then, a 3 g / L dopamine reaction solution was prepared, and the polylactic acid scaffold material was immersed in the reaction solution for 18 hours at a reaction temperature of 30℃. Finally, the scaffold after reaction was vacuum dried to obtain a polydopamine modified polylactic acid scaffold material.
[0184] Step two: a chitosan solution, an epichlorohydrin solution, and a chitin whisker liquid crystal were mixed to obtain a liquid crystal hydrogel precursor; the contents of the substances were 3.5% chitosan, 0.5% epichlorohydrin, 8% chitin whisker, and the solvent made up the rest. The self-assembled liquid crystal precursor was injected into the transverse large channels of the scaffold for pre-crosslinking for 8 hours; then, one end of a 3 mm diameter copper rod was inserted into a liquid nitrogen pool, and the other end was inserted into the longitudinal large channels of the scaffold, and radial freezing was performed for 5 hours, followed by freeze-drying at -15℃ for 20 hours to obtain a scaffold with micron radial channels.
[0185] Step three: a recombinant human transforming growth factor-β1 solution, a polyethylene glycol diacrylate solution with a weight average molecular weight of 2000, a 1-hydroxy cyclohexyl phenyl ketone solution, and a chitin whisker liquid crystal were mixed to obtain a liquid crystal precursor; the contents of the substances were 0.2% recombinant human transforming growth factor-β1, 9% polyethylene glycol diacrylate, 0.01% 1-hydroxy cyclohexyl phenyl ketone, and 10% chitin whisker, and the solvent made up the rest. The precursor was perfused into the longitudinal large channels, and a lower bone repair scaffold material was obtained after crosslinking for 8 minutes using ultraviolet light with a wavelength of 365 nm.
[0186] Step four: a cylindrical silica gel mold was sleeved on the upper end of the lower bone repair scaffold material, and the mold was 3 mm high. A baicalin solution, a polyethylene glycol diacrylate solution with a weight average molecular weight of 4000, a 1-hydroxy cyclohexyl phenyl ketone solution, and a chitin whisker liquid crystal were mixed to obtain a liquid crystal precursor; the contents of the substances were 0.05% baicalin, 9% polyethylene glycol diacrylate, 0.01% 1-hydroxy cyclohexyl phenyl ketone, and 8% chitin whisker, and the solvent made up the rest. The liquid crystal precursor was injected into the upper mold, crosslinked for 10 minutes using ultraviolet light with a wavelength of 365 nm, and then demolded to obtain a biomimetic bone / cartilage double-layer composite scaffold material.
[0187] The pure polyethylene glycol diacrylate hydrogel is selected as a control group, and a precursor solution containing 9% polyethylene glycol diacrylate with a weight average molecular weight of 4000 and 0.01% 1-hydroxycyclohexyl phenyl ketone is prepared according to the mass fraction, and is injected into the upper mold for photo-crosslinking for 10 minutes, and the upper cartilage repair hydrogel material is obtained after complete crosslinking and demolding. Meanwhile, the polyethylene glycol diacrylate solution with a weight average molecular weight of 4000, the 1-hydroxycyclohexyl phenyl ketone solution and the chitin whisker liquid crystal are mixed to obtain a liquid crystal precursor solution, wherein the content of each substance is 9% polyethylene glycol diacrylate with a weight average molecular weight of 4000, 0.01% 1-hydroxycyclohexyl phenyl ketone and 8% chitin whisker according to the mass percentage, and the solvent accounts for the rest. The liquid crystal precursor solution is injected into the upper mold and crosslinked using ultraviolet light with a wavelength of 365 nm for 10 minutes, and the upper cartilage repair hydrogel material without loading the chondrogenic drug is obtained after complete crosslinking and demolding.
[0188] The three groups of hydrogel materials are prepared into cylinders with a diameter of 10 mm and a height of 3 mm, and the mouse mesenchymal stem cells are cultured (as in Example 8). As shown in Figure 12 The introduction of the chitin whisker liquid crystal can enhance the expression of the blue positive area, and the further introduction of the baicalin promotes the increase of the positive area, and the above results show that the chitin whisker liquid crystal and the baicalin have a certain synergistic effect on promoting the chondrogenic differentiation of the stem cells.
[0189] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above examples, and any changes, modifications, substitutions, combinations and simplifications made without departing from the spirit and principles of the present application should be equivalent replacement methods, and are all included in the protection scope of the present application.
Claims
1. A biomimetic bone / cartilage bilayer composite scaffold material, characterized in that: It consists of an upper cartilage repair hydrogel layer and a lower bone repair scaffold layer; the upper cartilage repair hydrogel layer is a polyethylene glycol diacrylate-chitin whisker liquid crystal composite hydrogel containing a photoinitiator and a cartilage-activating drug; the lower bone repair scaffold layer includes a matrix scaffold and a liquid crystal channel structure, the matrix scaffold is a polymer scaffold with large transverse and longitudinal channels modified with polydopamine; A liquid crystal channel structure was constructed using a matrix scaffold as a template. The transverse large channel contains micron-radial channels of chitosan-chitin whisker liquid crystal composite hydrogel with a diameter gradient, while the longitudinal large channel contains polyethylene glycol diacrylate-chitin whisker liquid crystal composite hydrogel encapsulating osteogenic angiogenic drugs. The polymer is at least one of polylactic acid (PLA), polycaprolactone (PVC), and polyetheretherketone (PEEK). The chondrogenic drug is at least one of insulin-like growth factor, baicalin, bone morphogenetic protein, human parathyroid hormone-related protein, and transforming growth factor. The osteogenic and angiogenic active drug is at least one of bone morphogenetic protein, hypoxia-inducible factor, vascular endothelial growth factor, transforming growth factor, and deferoxamine. The aforementioned biomimetic bone / cartilage bilayer composite scaffold material is prepared through the following steps: (1) A polymer scaffold was constructed using fused deposition modeling (FDM) technology. The polymer scaffold was then immersed in a dopamine reaction solution and dried under vacuum to obtain the matrix scaffold. (2) Prepare a composite liquid crystal precursor solution of chitosan, crosslinking agent and chitin whiskers, and inject it into the transverse large channel of the matrix scaffold obtained in step (1) for pre-crosslinking; (3) Insert the copper rod connected to the liquid nitrogen pool into the longitudinal channel of the substrate support, freeze radially and freeze-dry to obtain a support with micron radial channels; (4) Prepare a precursor solution by combining osteogenic and angiogenic active drugs, polyethylene glycol diacrylate, photoinitiator and chitin whisker liquid crystal, and inject it into the longitudinal large channel for photocrosslinking to obtain the lower layer bone repair scaffold material. (5) Place the cylindrical silicone mold on the upper end of the lower bone repair scaffold material, and drop the precursor liquid prepared by the cartilage-activating drug, polyethylene glycol diacrylate, photoinitiator and chitin whisker liquid crystal into the mold for photocrosslinking. Demolding yields the biomimetic bone / cartilage bilayer composite scaffold material.
2. The biomimetic bone / cartilage bilayer composite scaffold material according to claim 1, characterized in that: In the aforementioned upper cartilage repair hydrogel layer: The components of the polyethylene glycol diacrylate-chitosan whisker liquid crystal composite hydrogel, by mass percentage, are as follows: photoinitiator 0.002%–0.01%, chondroitin-promoting active drug 0.005%–0.1%, chitosan whisker liquid crystal 4%–10%, and polyethylene glycol diacrylate 1%–10%. In the aforementioned lower bone repair scaffold layer: The chitosan-chitin whisker liquid crystal composite hydrogel contains a crosslinking agent, chitosan, and chitin whisker liquid crystal; the components, by mass percentage, are as follows: chitosan 0.5%–5.0%, crosslinking agent 0.05%–0.6%, and chitin whisker liquid crystal 5%–12%; The aforementioned polyethylene glycol diacrylate-chitin whisker liquid crystal composite hydrogel containing osteogenic and angiogenic drugs contains osteogenic and angiogenic drugs, chitin whiskers, and polyethylene glycol diacrylate; the components, by mass percentage, are as follows: photoinitiator 0.001-0.05%, chitin whisker liquid crystal 5%-15%, polyethylene glycol diacrylate 8%-15%, and osteogenic and angiogenic drugs 0.01%-1%.
3. The biomimetic bone / cartilage bilayer composite scaffold material according to claim 2, characterized in that: In the aforementioned upper cartilage repair hydrogel layer: The photoinitiator is at least one of lithium phenyl (2,4,6-trimethylbenzoyl)phosphate and 1-hydroxycyclohexylphenyl ketone; The weight-average molecular weight of the polyethylene glycol diacrylate is 200 to 10,000.
4. The biomimetic bone / cartilage bilayer composite scaffold material according to claim 2, characterized in that: In the aforementioned lower bone repair scaffold layer: The crosslinking agent is at least one of genipin, glutaraldehyde, and epichlorohydrin; The weight-average molecular weight of the polyethylene glycol diacrylate is 200 to 10,000. The photoinitiator is at least one of lithium phenyl (2,4,6-trimethylbenzoyl)phosphate and 1-hydroxycyclohexylphenyl ketone.
5. The biomimetic bone / cartilage bilayer composite scaffold material according to claim 4, characterized in that: The weight-average molecular weight of the L-polylactic acid is 50,000 to 350,000. The weight-average molecular weight of the polycaprolactone is 50,000 to 200,000. The weight-average molecular weight of the polyether ether ketone is 20,000 to 80,000. The concentration of the dopamine reaction solution is 0.5–5 g / L; The reaction conditions are 10–40°C for 1–48 hours.
6. The biomimetic bone / cartilage bilayer composite scaffold material according to claim 2, characterized in that: In the aforementioned lower bone repair scaffold layer: The aforementioned horizontal main passage has 1 to 4 layers, with 3 to 9 passages per layer; The outer diameter and inner diameter of the aforementioned transverse large channel are 1–4 mm and 0.2–1.2 mm, respectively; The diameter of the aforementioned longitudinal channel is 0.05–5 mm; The size of the micron-sized radial channel is 1–100 μm.
7. The method for preparing the biomimetic bone / cartilage bilayer composite scaffold material according to any one of claims 1 to 6, characterized in that... Includes the following steps: (1) A polymer scaffold was constructed using fused deposition modeling (FDM) technology. The polymer scaffold was then immersed in a dopamine reaction solution and dried under vacuum to obtain the matrix scaffold. (2) Prepare a composite liquid crystal precursor solution of chitosan, crosslinking agent and chitin whiskers, and inject it into the transverse large channel of the matrix scaffold obtained in step (1) for pre-crosslinking; (3) Insert the copper rod connected to the liquid nitrogen pool into the longitudinal channel of the substrate support, freeze radially and freeze-dry to obtain a support with micron radial channels; (4) Prepare a precursor solution by combining osteogenic and angiogenic active drugs, polyethylene glycol diacrylate, photoinitiator and chitin whisker liquid crystal, and inject it into the longitudinal large channel for photocrosslinking to obtain the lower layer bone repair scaffold material. (5) Place the cylindrical silicone mold on the upper end of the lower bone repair scaffold material, and drop the precursor liquid prepared by the cartilage-activating drug, polyethylene glycol diacrylate, photoinitiator and chitin whisker liquid crystal into the mold for photocrosslinking. Demolding yields the biomimetic bone / cartilage bilayer composite scaffold material.
8. The preparation method according to claim 7, characterized in that: In step (1): When the polymer is L-polylactic acid, the 3D printing conditions are: nozzle extrusion temperature of 150-250℃ and printing speed of 25-60 mm / min; When the polymer is polycaprolactone, the 3D printing conditions are: nozzle extrusion temperature of 60-80℃ and printing speed of 20-40 mm / min; When the polymer is polyetheretherketone, the 3D printing conditions are: nozzle extrusion temperature of 340-380℃ and printing speed of 30-50 mm / min; In step (2): The crosslinking agent is genipin, and the pre-crosslinking time is 2 to 72 hours; When the crosslinking agent is glutaraldehyde, the pre-crosslinking time is 0.2 to 24 hours; When the crosslinking agent is epichlorohydrin, the pre-crosslinking time is 0.1 to 48 hours; The diameter of the copper rod mentioned in step (3) is 0.1 to 5 mm; The radial freezing time mentioned in step (3) is 0.2 to 6 hours; The freeze-drying temperature in step (3) is -40 to -10°C, and the time is 4 to 24 hours; The photocrosslinking time mentioned in step (4) is 1 to 25 minutes; The cylindrical silicone mold described in step (5) extends 0.5 to 5 mm above the underlying bone repair scaffold material; The photocrosslinking time in step (5) is 1 to 25 minutes.
9. The use of the biomimetic bone / cartilage bilayer composite scaffold material according to any one of claims 1 to 6 in the preparation of biomedical products.
10. The application according to claim 9, characterized in that: The biomedical product described is a biomimetic bone / cartilage repair scaffold.
Citation Information
Patent Citations
Photo-crosslinking chitin whisker composite liquid crystal gel material as well as preparation method and application thereof
CN115197450A
Osteochondral integrated scaffold with directional pore structure and preparation method of osteochondral integrated scaffold
CN116763995A