Anti-inhibin B single-chain antibody or fragment thereof, preparation method, DNA molecule, and kit

Abstract

The present invention discloses an anti-inhibin B single-chain antibody or fragment thereof, a preparation method, a DNA molecule, and a kit. The antibody or fragment thereof comprises a light chain variable region CDR1-3 and a heavy chain variable region CDR1-3, wherein the amino acid sequences of the light chain variable regions VLCDR1-3 are as follows: VLCDR1 is as shown in SEQ ID No: 3 in the sequence listing; VLCDR2 is as shown in SEQ ID No: 4 in the sequence listing; and VLCDR3 is as shown in SEQ ID No: 5 in the sequence listing; and the amino acid sequences of the heavy chain variable regions VHCDR1-3 are as follows: VHCDR1 is as shown in SEQ ID No: 6 in the sequence listing; VHCDR2 is as shown in SEQ ID No: 7 in the sequence listing; and VHCDR3 is as shown in SEQ ID No: 8 in the sequence listing. The present invention obtains an anti-inhibin B single-chain antibody sequence with strong specificity and high affinity.

Description

Technical Field

[0001] The present invention relates to the technical field of antibody bioengineering, and in particular to an anti-inhibin B single-chain antibody or a fragment thereof, a preparation method, a DNA molecule, and a kit. Background Art

[0002] Infertility is a common problem worldwide. Surveys show that male factors are the primary or sole cause of infertility in approximately 20-50% of cases. Azoospermia accounts for 10%-20% of male infertility.

[0003] Inhibin B is a glycoprotein hormone secreted by cells of the reproductive system. Serum inhibin B directly reflects testicular spermatogenesis and is a more effective indicator of male fertility. Inhibin B testing can guide male infertility analysis, assisted reproductive technology, detect damage to male spermatogenesis caused by chemotherapy and radiotherapy, and diagnose precocious puberty and delayed puberty. In women, INHB is secreted by ovarian granulosa cells and theca cells. Inhibin B can guide ovarian reserve function assessment, assist in the diagnosis of polycystic ovary syndrome (PCOS), assist in the diagnosis of endometriosis, diagnose and monitor ovarian granulosa cell carcinoma, and guide the selection of assisted reproductive technology options.

[0004] Current methods for measuring inhibin B include radioimmunoassay, enzyme-linked immunosorbent assay, time-resolved fluorescence assay, and colloidal gold assay. Most of these methods require highly specific and high-affinity anti-inhibin B antibodies. However, traditional hybridoma technology, in order to obtain highly specific and high-affinity antibodies, has a long screening cycle, high costs, and a low screening success rate.

[0005] In view of this, this patent application is filed. Summary of the Invention

[0006] To solve the above problems, the present invention provides an anti-inhibin B single-chain antibody or its fragment, a preparation method, and a kit. The anti-inhibin B single-chain antibody is selected using phage display technology. Compared with traditional hybridoma technology, the present invention has the advantages of large antibody capacity, simple operation, low cost, and high screening success rate.

[0007] The first object of the present invention is to provide an anti-inhibin B single-chain antibody or a fragment thereof, wherein the antibody comprises a light chain variable region VLCDR1-3 and a heavy chain variable region VHCDR1-3, and the antibody fragment comprises a light chain variable region VLCDR1-3 and a heavy chain variable region VHCDR1-3, wherein the amino acid sequence of the light chain variable region VLCDR1-3 is:

[0008] VLCDR1: as shown in SEQ ID No: 3 in the sequence listing, specifically: SSRYYGRYGYMYG;

[0009] VLCDR2: as shown in SEQ ID No: 4 in the sequence listing, specifically: INRPRPS;

[0010] VLCDR3: as shown in SEQ ID No: 5 in the sequence listing, specifically SGTEGSFDSF;

[0011] The amino acid sequence of the heavy chain variable region VHCDR1-3 is:

[0012] VHCDR1: as shown in SEQ ID No: 6 in the sequence listing, specifically SDGMG;

[0013] VHCDR2: as shown in SEQ ID No: 7 in the sequence listing, specifically SISDDGSLTNYASPVRG;

[0014] VHCDR3: as shown in SEQ ID No: 8 in the sequence listing, specifically SPGGGWLANAIDA.

[0015] In an optional embodiment, the nucleotide sequence of the light chain variable region is shown as SEQ ID No: 1, and the nucleotide sequence of the heavy chain variable region is shown as SEQ ID No: 2.

[0016] The sequence SEQ ID No: 1 is specifically:

[0017] ACCGCCGCACTAACACAACCAAGCAGCGTATCACCAAACCTAGGAGGCCAAGTAAAATCACA

[0018] TGCAGCAGCAGATATTACGGCAGATACGGCTACATGTACGGATGGTATCAACAGAAATCACCAGG

[0019] CAGCGCCCCCGTAACACTAATATACATCAACAGACCACGCCCCAGCAACATCCCGTCACGCTTC

[0020] AGCGGCAGCCTAAGCGGCTCAACAAACACCCTAACAATAACAGGCGTCCAAGCCGAAGACGAA

[0021] GCAGTATACTTCTGCAGCGGCACAGAAGGCTCGTTCGACAGCTTTGGCGCCGGCACAACACTAACAGTACTA;

[0022] The sequence SEQ ID No: 2 is specifically:

[0023] GCCGTCACCCCGGACGAGTCAGGCGGAGGCTTCCAAACACCGGGAGGGGCCCTAGTCTGTAAG

[0024] AACTCCGGCTTCACCTTCTCATCAGACGGCATGGGCTGGGTCAGACAAGCCCCAGGAAAAGGA

[0025] CTAGAATATGTAGCCAGCATCAGCGACGACGGCTCCCTAACAAACTACGCCTCACCTGTCAGAG

[0026] GCAGAGCTACAATCTCACGAGATAACGGCCAATCAACCGTAAAACTGCAACTAAACAACCTACG

[0027] CGCCGAAGACACAGGCACATACTACTGCGCCAAAAGCCCAGGCGGCGGCTGGCTGGCCAACGCCATCGACGCATGGGGCCGAGGCCAAGAAGTAATGGTCAGCAGC.

[0028] The second object of the present invention is to provide a DNA molecule encoding the anti-inhibin B single-chain antibody or fragment thereof as described in any one of the above items.

[0029] The third object of the present invention is to provide a method for preparing the anti-inhibin B single-chain antibody or fragment thereof as described in any one of the above, comprising the following steps:

[0030] (1) Mice were immunized with recombinant inhibin B antigen, spleen tissues were collected, RNA was extracted, and the light chain variable region and heavy chain variable region sequences were amplified by RT-PCR and PCR;

[0031] Design primer sequences with flexible linkers to splice the obtained light and heavy chain variable regions into multiple pairs of ScFVs using overlapping PCR technology;

[0032] (2) ScFv and pCANTAB5e phage plasmid were double-digested with Sfi I and Not I, respectively, and then ligated to construct the pCANTAB5e-ScFV recombinant plasmid;

[0033] (3) The pCANTAB5e-ScFV recombinant plasmid was electroporated into TG1 competent cells to construct a phage single-chain antibody library;

[0034] (4) Specific panning is performed on the above library to obtain a high-affinity ScFV antibody library or fragment library.

[0035] In an optional embodiment, in step (1), the sequence of the primer used for PCR amplification of the light chain is: VLF1: ​​as shown in SEQ ID No: 9, specifically:

[0036] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACTGAAGTCATGTAACGTCGAGC;

[0037] VLF2: as shown in SEQ ID No: 10, specifically:

[0038] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACTGAGGTCTATTGTTGAATCGC;

[0039] VLF3: as shown in SEQ ID No: 11, specifically:

[0040] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACACACTTACGCTACATCCTTCA;

[0041] VLF4: as shown in SEQ ID No: 12, specifically:

[0042] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACTGAGGTGCTCTAACATGCGAG;

[0043] VLR1: as shown in SEQ ID No: 13, specifically:

[0044] ATAAGAATGCGGCCGCGGCAAAATGGTCGAAAAACGACGGGATAGG;

[0045] VLR2: as shown in SEQ ID No: 14, specifically:

[0046] ATAAGAATGCGGCCGCGGCAAAATAATACCAGAACCAATTAGAGCG;

[0047] VLR3: as shown in SEQ ID No: 15, specifically:

[0048] ATAAGAATGCGGCCGCGGCAAAATGGTAAACGCACATACTGAAATC.

[0049] In an optional embodiment, in step (1), the sequence of the primer used for PCR amplification of the heavy chain is: VHF1: as shown in SEQ ID No: 16, specifically:

[0050] CGGAGTCAGGCCACCGGCCTACCTCAGACCCGCTGGGAGTCTCTTCCGA;

[0051] VHF2: as shown in SEQ ID No: 17, specifically:

[0052] CGGAGTCAGGCCACCGGCCTACCTCAGACCGTATCCGGATCCCTTAACT;

[0053] VHF3: as shown in SEQ ID No: 18, specifically:

[0054] CGGAGTCAGGCCACCGGCCTACCTCAGACCCGCTCTTGAACACGAAGGA;

[0055] VHF4: as shown in SEQ ID No: 19, specifically:

[0056] CGGAGTCAGGCCACCGGCCTACCTCAGAGTAGCTGCGAAGCAAAATGTA;

[0057] VHR1: as shown in SEQ ID No: 20, specifically:

[0058] ACTTGGTGGTGGTGGACTTGGTGGTGGTGGACTTGGTGGTGGTGGAAACCGACTCTTCTGAGAGTGTCAAAACCG;

[0059] VHR2: as shown in SEQ ID No: 21, specifically:

[0060] ACTTGGTGGTGGTGGACTTGGTGGTGGTGGACTTGGTGGTGGTGGAAACCGACTACCCTGCCACTATCAGAGCGG;

[0061] VHR3: as shown in SEQ ID No: 22, specifically:

[0062] ACTTGGTGGTGGTGGACTTGGTGGTGGTGGACTTGGTGGTGGTGGAAACCGACTCCTCGGCGACTCACATGGGAT.

[0063] In an optional embodiment, in step (2), ScFv and pCANTAB5e phage plasmid are digested and then ligated at a mass ratio of 1:3;

[0064] In step (2), the primer sequences used to construct the pCANTAB5e-ScFV recombinant plasmid are:

[0065] ScFv F Sfi I: as shown in SEQ ID No: 23, specifically:

[0066] CGGAGTCAGGCCACCGGCCTACCGCAGGCCC;

[0067] ScFv R Not I: as shown in SEQ ID No: 24, specifically:

[0068] ATAAGAATGCGGCCGCGCCCGCCTAACG.

[0069] In an optional embodiment, in step (3), during the process of electroporating the pCANTAB5e-ScFV recombinant plasmid into TG1 competent cells, helper phage M13K07 is added to obtain the ScFv antibody library;

[0070] In step (4), the inhibin B antigen is used to coat the ELISA plate, and 3-5 rounds of antibody library selection are performed to obtain the ScFv antibody library or fragment library with the highest affinity to the antigen.

[0071] A fourth object of the present invention is to provide a kit comprising the anti-inhibin B single-chain antibody or fragment thereof as described in any one of the above items, or the anti-inhibin B single-chain antibody or fragment thereof obtained by the preparation method as described in any one of the above items.

[0072] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0073] The light chain variable region sequences and heavy chain variable region sequences of the anti-inhibin B single-chain antibodies or fragments thereof disclosed in the embodiments of the present invention provide a foundation for constructing anti-inhibin B single-chain antibodies with strong specificity and high affinity. Furthermore, phage display technology was successfully used to screen for anti-inhibin B single-chain antibody sequences with strong specificity and high affinity. This approach offers advantages such as a large antibody library capacity, relatively simple operation, low cost, and a high screening success rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following briefly introduces the drawings required for use in the examples. It should be understood that the following drawings only illustrate certain embodiments of the present invention and should not be considered as limiting the scope. A person of ordinary skill in the art can also derive other relevant drawings based on these drawings without inventive effort. In the drawings:

[0075] Figure 1 This is the PCR agarose gel electrophoresis diagram of the DNA fragments of the heavy chain variable region (VH) and the light chain variable region (VL) in Example 1.

[0076] Figure 2 This is the agarose gel electrophoresis diagram of PCR of ScFv in Example 1.

[0077] Figure 3 This is a map of the pCANTAB5e vector.

[0078] Figure 4 This is the ELISA titer determination diagram of ScFv and coated antigen in Example 2. DETAILED DESCRIPTION

[0079] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with examples and drawings. The exemplary embodiments of the present invention and their descriptions are only used to explain the present invention and are not intended to limit the present invention.

[0080] Throughout this specification, references to "one embodiment," "an embodiment," "an example," or "an example" mean that a particular feature, structure, or characteristic described in connection with the embodiment or example is included in at least one embodiment of the present invention. Therefore, appearances of the phrases "one embodiment," "an embodiment," "an example," or "an example" in various places throughout this specification are not necessarily all referring to the same embodiment or example. Furthermore, the particular features, structures, or characteristics may be combined in one or more embodiments or examples in any suitable combinations and / or subcombinations. Furthermore, it will be understood by those of ordinary skill in the art that the figures provided herein are for illustrative purposes only and are not necessarily drawn to scale. As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0081] Example 1: Construction of antibody library

[0082] 1. Animal immunization and extraction of total RNA from spleen cells

[0083] Mice were immunized with human inhibin B antigen. After multiple immunizations until the antibody titer reached the required level, the spleen tissues were collected, frozen in liquid nitrogen, and ground into powder. Total RNA from the spleen was extracted using the TRIzol method.

[0084] 2. RT-PCR (reverse transcription amplification) amplification of cDNA

[0085] First, add total RNA, Oligo(dT)18 primer, and purified water, and treat at 65°C for 5 minutes to open the secondary structure. Then, add RT enzyme (reverse transcriptase), Reaction Mix, and gDNA remover, and treat at 42°C for 30 minutes to reverse transcribe and amplify cDNA.

[0086] 3. PCR amplification of light and heavy chain variable region sequences

[0087] The primers for amplifying the light chain variable region come from any one of VLF1-VLF4 and any one of VLR1-VLR3 in pairwise combination (a total of 12 groups), and the primers for amplifying the heavy chain variable region come from any one of VHF1-VHF4 and any one of VHR1-VHR3 in pairwise combination (a total of 12 groups).

[0088] The light chain upstream primer introduced an Sfi I restriction enzyme site and a protective base, and the heavy chain downstream primer introduced a Not I restriction enzyme site and a protective base. A 15-amino acid sequence (GGGGS)3 was introduced into the light chain downstream primer and the heavy chain upstream primer as a linker sequence. Specifically, using cDNA as a template, denaturation at 94°C for 30s, annealing at 56°C for 30s, and extension at 72°C for 40s were performed for 30 cycles of amplification. Agarose gel electrophoresis was performed (results are shown in Figure 1 ), recover the amplified heavy chain variable region and light chain variable region DNA fragments (i.e., corresponding to the VH and VL products described in step 4 below, respectively). Figure 1 It can be seen that the antibody light chain and heavy chain variable regions were amplified.

[0089] The above primer sequences are specifically:

[0090] Light chain amplification primer: VLF1 (SEQ ID No: 9):

[0091] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACTGAAGTCATGTAACGTCGAGC.

[0092] VLF2 (SEQ ID No: 10):

[0093] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACTGAGGTCTATTGTTGAATCGC.

[0094] VLF3 (SEQ ID No: 11):

[0095] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACACACTTACGCTACATCCTTCA.

[0096] VLF4 (SEQ ID No: 12):

[0097] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACTGAGGTGCTCTAACATGCGAG.

[0098] VLR1 (SEQ ID No: 13):

[0099] ATAAGAATGCGGCCGCGGCAAAATGGTCGAAAAACGACGGGATAGG.

[0100] VLR2 (SEQ ID No: 14):

[0101] ATAAGAATGCGGCCGCGGCAAAATAATACCAGAACCAATTAGAGCG.

[0102] VLR3 (SEQ ID No: 15):

[0103] ATAAGAATGCGGCCGCGGCAAAATGGTAAACGCACATACTGAAATC.

[0104] Heavy chain amplification primer:

[0105] VHF1 (SEQ ID No: 16):

[0106] CGGAGTCAGGCCACCGGCCTACCTCAGACCCGCTGGGAGTCTCTTCCGA.

[0107] VHF2 (SEQ ID No: 17):

[0108] CGGAGTCAGGCCACCGGCCTACCTCAGACCGTATCCGGATCCCTTAACT.

[0109] VHF3 (SEQ ID No: 18):

[0110] CGGAGTCAGGCCACCGGCCTACCTCAGACCCGCTCTTGAACACGAAGGA.

[0111] VHF4 (SEQ ID No: 19):

[0112] CGGAGTCAGGCCACCGGCCTACCTCAGAGTAGCTGCGAAGCAAAATGTA.

[0113] VHR1 (SEQ ID No: 20):

[0114] ACTTGGTGGTGGTGGACTTGGTGGTGGTGGACTTGGTGGTGGTGGAAACCGACTCTTCTGAGAGTGTCAAAACCG.

[0115] VHR2 (SEQ ID No: 21):

[0116] ACTTGGTGGTGGTGGACTTGGTGGTGGTGGACTTGGTGGTGGTGGAAACCGACTACCCTGCCACTATCAGAGCGG.

[0117] VHR3 (SEQ ID No: 22):

[0118] ACTTGGTGGTGGTGGACTTGGTGGTGGTGGACTTGGTGGTGGTGGAAACCGACTCCTCGGCGACTCACATGGGAT.

[0119] 4. ScFV sequence amplification

[0120] The upstream primer of ScFv introduces the Sfi I restriction enzyme site and protective base, and the downstream primer of ScFv introduces the Not I restriction enzyme site and protective base. The sequences of ScFv F Sfi I and ScFv R Not I are shown below. Specifically, the VH and VL products obtained by PCR amplification were used as mixed templates, denatured at 94℃ for 30s, annealed at 62℃ for 30s, extended at 72℃ for 40s, and amplified for 30 cycles. The ScFv was randomly spliced ​​using the overlap extension PCR technique. Agarose gel electrophoresis was performed (the results are shown in FIG. Figure 2 ), the amplified ScFv DNA fragment was recovered. Figure 2 It was found that the ScFv fragment was recovered.

[0121] The above primer sequences are:

[0122] ScFv F Sfi I (SEQ ID No: 23): CGGAGTCAGGCCACCGGCCTACCGCAGGCCC.

[0123] ScFv R Not I (SEQ ID No: 24):ATAAGAATGCGGCCGCGCCCGCCTAACG.

[0124] 5. Double enzyme digestion of ScFv and pCANTAB5e

[0125] The ScFv fragment was combined with the pCANTAB5e vector (map as shown in Figure 3 Specifically, Not I was first added to the reaction system and digested in a constant temperature water bath at 37°C for 10 h. After the Not I digestion was complete, Sfi I was added and digested in a constant temperature water bath at 50°C for 6 h. Agarose gel electrophoresis was performed to recover the target fragment.

[0126] 6. Preparation of pCANTAB5e-ScFv recombinants

[0127] Specifically, a ligation reaction system was prepared at a mass ratio of ScFv to pCANTAB5e of 1:3, and the reaction was incubated at 16°C for 18 hours. Agarose gel electrophoresis was performed to recover the target fragment.

[0128] 7. Electroporation of pCANTAB5e-ScFv into TG1

[0129] Specifically, the ligation product (pCANTAB5e-ScFV) was added to TG1 competent cells, mixed well, and quickly transferred to a dry, pre-cooled electroporation cuvette. Electroporation was performed at 2.5kV and 10ms. Immediately after completion, 37°C pre-heated SOC medium (without antibiotics) was added and cultured on a shaker at 37°C and 200rpm for 1 hour. Centrifuge at 4000rpm for 10 minutes, retain 1 / 5 of the supernatant, gently resuspend the cells, take a small amount to coat 2xYT-A plates (containing Amp resistance), and culture in an inverted incubator at 37°C overnight; the remaining bacterial solution was added with 50% final concentration of glycerol and frozen for storage as the primary ScFv antibody library, that is, the phage single-chain antibody library.

[0130] Example 2: Panning of high affinity ScFv

[0131] 1. Identification of positive clones

[0132] Specifically, on the second day, a single colony was picked from the plate and inoculated into 2xYT-A liquid medium (containing Amp resistance), and the culture was shaken at 37°C and 200 rpm for 4 hours. The bacterial liquid was used for PCR identification, and the PCR procedure was the same as in 2.3 of Example 2; the positive clone was expanded and the plasmid was extracted for double enzyme digestion identification. The clones with expected bands were sequenced and identified, and the strain was retained.

[0133] 2. Phage rescue and proliferation

[0134] Specifically, the positive strains were rejuvenated in 2xYT-A liquid medium (containing Amp resistance) at 37°C and 200 rpm for 4 hours, and the helper phage M13K07 was added at an MOI of 20:1. The culture was incubated at 37°C for 1 hour, and then incubated at 37°C and 200 rpm for 1 hour. The bacteria were precipitated by centrifugation at 400 rpm for 10 minutes, and the supernatant was discarded. 2xYT-A liquid medium (containing Amp and Kan resistance) was added to resuspend the bacteria, and the culture was shaken at 37°C and 200 rpm overnight. The bacterial solution was collected and centrifuged at 10,000 rpm for 20 minutes, the supernatant was retained, and 1 / 5 volume of PEG-8000 / NaCl was added and ice-bathed for 1 hour to precipitate the phage. The phage was centrifuged at 4,000 rpm for 20 minutes to ensure that all the supernatant was removed. 1 / 50 volume of PBS was added to resuspend the precipitate, and the precipitate was centrifuged at 8,000 rpm for 10 minutes. The supernatant was retained as the ScFv library.

[0135] 3. ScFv selection

[0136] Specifically, the alanyl-tRNA synthetase target antigen was diluted in sodium carbonate coating solution and coated on the ELISA plate with an antigen concentration of 100 μg / mL and a coating volume of 100 μL, and the plate was incubated at 4°C overnight; the coating solution was discarded and the plate was washed 5 times with PBST; blocking solution (5% skim milk powder-PBST) was added and blocked at 37°C for 2 hours; the blocking solution was discarded and the plate was washed 5 times with PBST; the phage library diluted with PBS was added and bound at 37°C for 2 hours; the plate was washed 10 times with PBST; 2M Gly-HCl (pH 2.2) was added and incubated at 37°C for 10 minutes, the liquid in the well was blown to elute the phage and transferred to a centrifuge tube, Tris-HCl (pH 8.0) was quickly added to neutralize it, TG1 bacterial solution was added, and the plate was cultured on a shaking table at 200 rpm for 1 hour after being incubated in a 37°C water bath for 30 minutes, thus completing the first round of panning.

[0137] Phage from the first round of panning were rescued and propagated according to step 2 of this example before subsequent panning. Starting from the second round of panning, the antigen coating concentration was reduced to 50 μg / mL. The number of washes after phage incubation increased with each panning round (by five washes per round). The remaining panning procedures were the same as for the first round. After a total of three rounds of panning, the final antibody library with the highest affinity was obtained.

[0138] Test example:

[0139] The binding of the high-affinity ScFv antibody library to the target antigen was detected by ELISA. The specific method is as follows:

[0140] The inhibin B target antigen (here, the immunogen and the natural antigen were coated separately) was diluted in sodium carbonate coating solution and coated on the ELISA plate at an antigen concentration of 2 μg / mL and a coating volume of 100 μL. The plate was incubated at 4°C overnight. The coating solution was discarded the next day and the plate was washed three times with PBST. Blocking solution (5% skim milk powder-PBST) was added and blocked at 37°C for 2 h. The blocking solution was discarded and the plate was washed three times with PBST. The ultimate phage ScFv antibody library after panning was added with PBS diluted with PBS and bound at 37°C for 1 h. The plate was washed five times with PBST. Mouse anti-M13 antibody (HRP-labeled) was added and incubated at 37°C for 1 h. The plate was washed five times with PBST. TMB color development solution was added and incubated at 37°C for 15 min. The reaction stop solution was added (blue turned to yellow and color developed within 20 min). The absorbance was measured at a wavelength of 450 nm on a microplate reader (the results are shown in FIG. Figure 4 ), determine the ability of the antibody to bind to the target antigen. Figure 4 The comparison shows that the binding ability of anti-inhibin B single-chain antibody to natural antigen is equivalent to that of coated antigen. Figure 4 The conclusion was drawn that the anti-inhibin B single-chain antibody has good binding ability with the natural antigen. Figure 4 The control antigen in represents the natural inhibin B target antigen, and the coating antigen represents the immunogen.

[0141] The present invention successfully utilizes phage surface display technology to screen for anti-inhibin B single-chain antibody sequences with strong specificity and high affinity. The present invention has the advantages of large antibody library capacity, relatively simple operation, low cost and high screening success rate, and has broad prospects in the development of diagnostic kits using this antibody.

[0142] The above specific implementation methods further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above are only specific implementation methods of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. An anti-inhibin B single-chain antibody or a fragment thereof, wherein the antibody comprises a light chain variable region CDR1-3 and a heavy chain variable region CDR1-3, and the antibody fragment comprises a light chain variable region VLCDR1-3 and a heavy chain variable region VHCDR1-3, characterized in that: The amino acid sequences of the light chain variable regions VLCDR1-3 are: VLCDR1: as shown in SEQ ID No: 3 in the sequence listing; VLCDR2: as shown in SEQ ID No: 4 in the sequence listing; VLCDR3: as shown in SEQ ID No: 5 in the sequence listing; The amino acid sequence of the heavy chain variable region VHCDR1-3 is: VHCDR1: as shown in SEQ ID No: 6 in the sequence listing; VHCDR2: as shown in SEQ ID No: 7 in the sequence listing; VHCDR3: as shown in SEQ ID No: 8 in the sequence listing.

2. The anti-inhibin B single-chain antibody or fragment thereof according to claim 1, wherein The nucleotide sequence of the light chain variable region is shown in SEQ ID No: 1, and the nucleotide sequence of the heavy chain variable region is shown in SEQ ID No:

2.

3. A DNA molecule encoding the anti-inhibin B single-chain antibody or a fragment thereof according to any one of claims 1 to 2.

4. A kit, characterized in that The invention comprises the anti-inhibin B single-chain antibody or a fragment thereof according to any one of claims 1 to 2.

Images