Acid-resistant α-amylase mutant and preparation method thereof

By modifying the surface loop structure of Bacillus α-amylase and mutating it into an acidic amino acid, the problem of low enzyme activity of α-amylase under acidic conditions is solved, and wider application and higher enzyme activity are achieved, improving the efficiency and quality of starch processing.

CN119120428BActive Publication Date: 2025-08-22NANJING UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411298447.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-18
Publication Date
2025-08-22
Estimated Expiration
2044-09-18

AI Technical Summary

Technical Problem

The existing α-amylase has low enzyme activity or inactivated under non-optimal pH conditions, which limits its application effect under acidic conditions, especially in the fields of production efficiency and product quality in food processing, medicine and energy.

Method used

By modifying the secondary structure of Bacillus α-amylase of Bacillus vera, the amino acids of the mutated surface loop structure are acidic amino acids, such as S242E, N569E, and N605D, which increase the negative charge on the surface to improve the acid resistance of the enzyme.

Benefits of technology

The enzyme activity of mutated α-amylase is significantly improved within the pH range of 1.9-4.0, which improves the raw material utilization rate and product quality of starch processing, reduces production costs, and meets the needs of energy, food and feed fields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119120428B_ABST
    Figure CN119120428B_ABST
Patent Text Reader

Abstract

The present invention discloses an acid-resistant α-amylase mutant and a preparation method thereof, and is effective in inhibiting the growth of Bacillus velezinis ( Bacillus from Velez ) α-amylase from source is subjected to site-directed mutagenesis, and the mutation is at least one of S242E, N569E, and N605D. The α-amylase mutant provided by the present invention has good acid stability, and at pH 1.9-4.0, the ability of the α-amylase mutant catalyzing starch hydrolysis provided by the present invention is significantly improved, and the availability of α-amylase under wider pH conditions is increased, and the problem of limited application caused by the poor acid resistance of existing α-amylase is solved. The present invention has a remarkable effect on improving the raw material utilization and product quality in starch processing industry and reducing production costs, meets the demand for acid-resistant α-amylase in the fields of energy, food and feed, has important social and economic benefits, and has broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to an alpha-amylase mutant, in particular to an alpha-amylase mutant with enhanced pH tolerance, and belongs to the field of bioengineering. Background Art

[0002] α-Amylase (α-1,4-glucan-4-glucoside hydrolase, EC 3.2.1.1) is an endoglycoside hydrolase that hydrolyzes α-1,4-glucosidic bonds within starch molecules to produce dextrins, oligosaccharides, maltotriose, maltose, and a small amount of glucose. Under the action of α-amylase, starch is degraded, viscosity is reduced, and liquefaction is achieved. The importance of α-amylase is demonstrated by its widespread application in numerous fields, such as starch gelatinization and syrup production in the sugar industry, paper desizing in the textile industry, resource recycling for converting agricultural waste into animal feed or biofuel, and analytical testing and municipal wastewater purification in the pharmaceutical and chemical industries. Currently, α-amylase is primarily produced industrially through microbial fermentation. Microbial α-amylases primarily come from Bacillus amyloliquefaciens and Bacillus licheniformis, and their optimal pH is 5.0-6.0. When the enzyme solution catalyzes starch hydrolysis under conditions outside this pH range, the enzyme activity is low or even inactivated. Therefore, artificial modification of α-amylase to improve its stability under extreme conditions has become an important research direction for α-amylase.

[0003] Acid α-amylases are a class of α-amylases that maintain high activity at relatively low pH levels, with an optimum pH typically between 4.0 and 5.0. This characteristic enables acid-resistant α-amylases to outperform standard α-amylases in specific applications such as food processing, medicine, and energy, demonstrating their unique advantages. For example, in areas such as silage, fermented beverages, pharmaceutical production, and the processing of industrial by-products, acid-resistant α-amylases can simplify starch processing, allowing processes such as liquefaction and saccharification to proceed under the same pH conditions. This avoids the complex pH adjustment required in traditional processes and helps improve production efficiency and product quality. Another example is in liquor brewing, where acid-resistant α-amylases can fully utilize excess starch, thereby increasing raw material utilization and liquor yield, and reducing production costs.

[0004] Current methods for obtaining acid α-amylase include genetic modification of acid α-amylase, breeding of strains with high acid α-amylase production, and optimization of fermentation conditions for producing acid α-amylase. Chinese invention patent application CN114457058A discloses a method for mutational modification of feed α-amylase and its application. The invention uses Bacillus velezensis α-amylase as a template to construct a series of new α-amylase mutants, specifically including mutations at positions 546, 572, 614, and 622, which are respectively from proline to glutamate, histidine to aspartic acid, alanine to glutamate, and lysine to glutamate. These α-amylase variants have high catalytic activity under acidic conditions of pH 2.5-5.5 and high temperatures above 80°C. Developing more acid-resistant α-amylases will help meet the industry's demand for efficient and high-quality starch hydrolysis. Summary of the Invention

[0005] Purpose of the invention: The purpose of the present invention is to provide an acid-resistant α-amylase mutant having higher enzyme activity under acidic conditions, and to provide a nucleic acid molecule encoding the mutant, a vector or recombinant cell or product containing the mutant, as well as a preparation method and application of the mutant.

[0006] Technical solution: The first aspect of the present invention provides an acid-resistant α-amylase mutant, wherein the amino acid sequence of the α-amylase mutant is obtained by mutation of the sequence shown in SEQ ID NO.1, and the mutation is at least one of S242E, N569E, and N605D.

[0007] The present invention uses α-amylase from Bacillus velezensis as the base enzyme and modifies the surface loops within the protein's secondary structure, mutating them to acidic amino acids. Screening revealed that mutating amino acids at positions 242, 569, or 605 of the α-amylase to acidic amino acids increased the surface negative charge and improved the acid resistance of the mutant enzyme.

[0008] The present invention uses standard single-letter amino acid substitution notation: S242E means that the serine (S) at position 242 of the N-terminus is mutated to glutamic acid (E); N605D / S242E means that the asparagine (N) at position 605 of the N-terminus is mutated to aspartic acid (D), and the serine (S) at position 242 of the N-terminus is mutated to glutamic acid (E).

[0009] In a second aspect, the present invention provides a nucleic acid molecule encoding the α-amylase mutant described in the first aspect. The nucleic acid molecule is capable of expressing the acid-resistant α-amylase mutant.

[0010] Furthermore, the nucleotide sequence of the nucleic acid molecule is obtained by base mutation of the sequence shown in SEQ ID NO.2.

[0011] In a third aspect, the present invention provides a vector comprising the nucleotide sequence described in the second aspect, wherein the vector is capable of amplifying or expressing the nucleotide sequence.

[0012] Furthermore, the vector includes a cloning vector or an expression vector. The vector can be a plasmid or a virus.

[0013] In a fourth aspect, the present invention provides a recombinant cell comprising the vector described in the third aspect.

[0014] In a fifth aspect, the present invention provides a method for preparing the α-amylase mutant according to the first aspect, comprising the following steps:

[0015] (1) Using the α-amylase gene as a template, a PCR reaction was performed using point mutation primers to obtain the α-amylase mutant gene;

[0016] (2) inserting the α-amylase mutant gene into an expression vector and then transferring it into a host cell to obtain a recombinant cell;

[0017] (3) Collect the recombinant cells expressing the α-amylase mutant, resuspend the cells and then break the cells, centrifuge and take the supernatant to obtain the crude enzyme solution containing the α-amylase mutant.

[0018] The alpha-amylase mutant obtained by the preparation method has good acid stability.

[0019] Furthermore, in (2), the α-amylase mutant gene is inserted into an expression vector using a DNA homologous recombination method.

[0020] Preferably, the 3D model of the original α-amylase is predicted by computer modeling, and primers for the relevant mutation sites are designed. The point mutation primers are shown in Table 1:

[0021] Table 1 Point mutation primers

[0022] Primer name Sequence (5'-3') S242E-F CAACACGGAAGCGGAATTTCAGTATGGCGAAATTC S242E-R GAAATTCCCGCTTCCGTGTTGGTAATGTTCGGCCAAAAC N569E-F TCAGGAACCGGATCATTGGGGCCAAGTGAACGC N569E-R CAATGATCCGGTTCCTGATAGCCAATAATGTTGG N605D-F CGCGGATGGCATGTATACCCTGACCCTGCCGGC N605D-R GTATACATGCCATCCGCGTTTTTGGTCATCGCTTTG

[0023] The underlined sites in the primers are mutation sites

[0024] The system of the PCR reaction is shown in Table 2:

[0025] Table 2 PCR reaction system

[0026]

[0027] The PCR reaction conditions are shown in Table 3:

[0028] Table 3 PCR reaction conditions

[0029]

[0030] In a sixth aspect, the present invention provides a product comprising the α-amylase mutant described in the first aspect, the nucleic acid molecule described in the second aspect, the vector described in the third aspect, or the recombinant cell described in the fourth aspect.

[0031] In a seventh aspect, the present invention provides a use of the product described in the sixth aspect in catalyzing starch hydrolysis.

[0032] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The α-amylase mutant provided by the present invention has good acid stability. Between pH 1.9 and 4.0, the ability of the enzyme mutant to catalyze starch hydrolysis is significantly improved; at a pH of 1.9, the specific enzyme activity of the enzyme mutant is increased by 217.8% compared with the original enzyme; 2. The present invention increases the availability of α-amylase under a wider pH condition, has a significant effect on improving the raw material utilization and product quality in the starch processing industry and reducing production costs, meets the demand for acid-resistant α-amylase in the fields of energy, food and feed, has important social and economic benefits, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The diagram shows the protein structure of the original α-amylase and the amino acid position 242;

[0034] Figure 2 The diagram shows the protein structure of the original α-amylase and the amino acid position 569;

[0035] Figure 3 The diagram shows the protein structure of the original α-amylase and the amino acid position 605;

[0036] Figure 4 Standard curve for colorimetric determination of enzyme activity;

[0037] Figure 5 Schematic diagram of the relative enzyme activities of the original enzyme and enzyme mutants under different pH conditions. DETAILED DESCRIPTION

[0038] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0039] The materials used in the examples were obtained from:

[0040] 1. Strains and plasmids

[0041] E. coli DH5α strain was used for plasmid construction, and E. coli BL21(DE3) strain was used for exogenous protein expression. Both strains were commercially available. Synthesis of the pET-22b(+) plasmid carrying the original Bacillus velezensis α-amylase gene, synthesis of mutagenesis primers and plasmid construction primers, and sequencing of the gene sequence within the plasmid were completed by Jin Weizhi (Suzhou). The pET-22b(+) plasmid expressing the α-amylase mutant was constructed by the applicant.

[0042] 2. Experimental reagents and culture medium

[0043] Key reagents included: PCR enzymes and buffer components from the MutUFO Fast Mutagenesis Kit (Nanjing Jujiang Biotechnology), plasmid extraction kit (Shanghai Bioengineering), DNA Marker (Shanghai Bioengineering), DNS reagent (Phygene), and endonuclease DpnI (Adamas). Other conventional reagents were domestically produced, analytically grade. LB medium consisted of: 5 g / L yeast extract, 10 g / L tryptone, and 5 g / L NaCl. If using solid medium, 15 g / L agar powder was added. TB liquid medium consisted of: 12 g / L yeast extract, 12 g / L tryptone, 4 ml / L glycerol, 12.5 g / L dipotassium phosphate, and 2.3 g / L potassium dihydrogen phosphate.

[0044] Example 1 Acid-resistant α-amylase mutant N605D

[0045] In this example, the α-amylase of Bacillus velezensis was used as the original enzyme, and the asparagine (N) at position 605 of the N-terminal amino acid sequence shown in SEQ ID No. 1 was mutated to aspartic acid (D). The model structure of the mutation site is shown in FIG. Figure 3 The nucleotide sequence is shown in SEQ ID No. 2.

[0046] The preparation method of mutant N605D is as follows: 1. constructing a recombinant plasmid; 2. expressing the enzyme mutant; 3. preparing a crude enzyme solution.

[0047] 1. Construction of recombinant plasmid

[0048] The primers for the N605D mutation site are shown in Table 4. PCR was performed using the pET-22b(+) plasmid carrying the original α-amylase gene as a template. The PCR system is shown in Table 5, and the PCR reaction conditions are shown in Table 6.

[0049] Table 4 Point mutation primers and plasmid construction primers

[0050] Primer name Sequence (5'-3') N605D-F CGCGGATGGCATGTATACCCTGACCCTGCCGGC N605D-R GTATACATGCCATCCGCGTTTTTGGTCATCGCTTTG

[0051] Note: The underlined markers in the primers are mutation sites, “F” represents the upstream primer, and “R” represents the downstream primer.

[0052] Table 5 PCR reaction system

[0053]

[0054] Table 6 PCR reaction conditions

[0055]

[0056] After verification of the PCR product by electrophoresis, the template was digested with the endonuclease DpnI. Prepare the reaction system as shown in Table 7 and digest at 37°C for 1-2 hours.

[0057] Table 7 Template digestion system

[0058] Ingredients content DpnI 1 μl PCR products 0.06 pmol

[0059] After template digestion, the product was subjected to DNA homologous recombination. The reaction system was prepared as shown in Table 8 and reacted at 37°C for 30 minutes for one-step cloning to construct the expression plasmid of the mutant enzyme.

[0060] Table 8 Homologous recombination system

[0061] Ingredients content DpnI digest 0.06 pmol 5×UFOBuffer 4 μl UvsXase 2 μl ddH2O to 20 μl

[0062] The obtained plasmid was transformed into the engineered bacterium E. coli DH5α for amplification, and the recombinant plasmid was extracted and sequenced for verification.

[0063] 2. Expression of enzyme mutants

[0064] Transform the recombinant plasmid into the expression host E. coli BL21 (DE3) and plate on LB plates containing 100 ng / mL ampicillin for screening. Inoculate the transformants into 5 mL of LB liquid medium containing 100 ng / mL ampicillin and culture overnight at 37°C, 140 rpm in a shaker. Inoculate 2.5 mL of the bacterial culture into 50 mL of TB liquid medium containing 100 ng / mL ampicillin and culture at 37°C, 140 rpm in a shaker for 6 hours. Add filter-sterilized IPTG to the fermentation broth to a final concentration of 0.4 mM and continue incubating at 22°C, 140 rpm for 22 hours.

[0065] 3. Preparation of crude enzyme solution

[0066] Transfer the recombinant bacterial fermentation broth to a centrifuge tube and collect the cells by centrifugation at 11,000 rpm. Resuspend the cells in 20 mL of the appropriate buffer, disrupt the cells by sonication for 10 minutes, and centrifuge again at 11,000 rpm to remove cell debris. The resulting supernatant is the crude enzyme solution containing the enzyme mutant.

[0067] Example 2 Acid-resistant α-amylase mutant N605D / S242E

[0068] In this example, the plasmid of the enzyme mutant N605D constructed in Example 1 was used as a template to mutate the serine (S) at position 242 of the N-terminus of its amino acid sequence to glutamic acid (E). The rest of the preparation method was the same as in Example 1.

[0069] The model structure of the mutation site is as follows Figure 1 As shown, its point mutation primers and plasmid construction primers are shown in Table 9:

[0070] Table 9 Point mutation primers and plasmid construction primers

[0071] Primer name Sequence (5'-3') S242E-F CAACACGGAAGCGGAATTTCAGTATGGCGAAATTC S242E-R GAAATTCCCGCTTCCGTGTTGGTAATGTTCGGCCAAAAC

[0072] Example 3 Acid-resistant α-amylase mutant N605D / S242E / N569E

[0073] In this example, the plasmid of the enzyme mutant N605D / S242E constructed in Example 2 was used as a template to mutate the asparagine (N) at position 569 of the N-terminal amino acid sequence to glutamic acid (E). The rest of the preparation method was the same as in Example 1.

[0074] The model structure of the mutation site is as follows Figure 2 As shown, its point mutation primers and plasmid construction primers are shown in Table 10:

[0075] Table 10 Point mutation primers and plasmid construction primers

[0076] Primer name Sequence (5'-3') N569E-F TCAGGAACCGGATCATTGGGGCCAAGTGAACGC N569E-R CAATGATCCGGTTCCTGATAGCCAATAATGTTGG

[0077] Example 4 Comparison of specific enzyme activities of the original α-amylase and its mutants under different pH conditions

[0078] The original α-amylase and the crude enzyme solution prepared in Examples 1-3 were treated with glycine-HCl buffer at pH 4.0, 3.0, 2.0, and 1.9, respectively, and the residual enzyme activity was determined using the DNS method. The DNS method is one of the commonly used methods for determining enzyme activity. It is based on the color reaction between the reducing sugars produced by the enzyme-catalyzed reaction and 3,5-dinitrosalicylic acid (DNS) under alkaline conditions. The specific method is as follows:

[0079] Add 30 μL of crude enzyme solution to 120 μL of 1% starch solution and mix thoroughly. Incubate at 65°C for 5 minutes, then add 150 μL of DNS solution. Boil the mixture in a boiling water bath for 10 minutes, immediately cool to room temperature in an ice bath, and measure absorbance at 540 nm. For a negative control experiment, replace the crude enzyme solution with buffer solution; all other procedures remain the same.

[0080] Draw a standard curve: prepare 1.0000, 0.8000, 0.6000, 0.4000, 0.2000, 0.1000, and 0.0000 mg / mL glucose standard solutions, treat them using the above method, and measure the absorbance to obtain a glucose-540 nm standard curve (y = 3.8975x + 0.0432, R2 = 0.9994), as shown in Figure 5. Figure 4 shown.

[0081] Definition of crude enzyme activity: One unit (U) is the amount of enzyme required to catalyze starch hydrolysis to produce 1 nmol of glucose per minute under enzymatic reaction conditions. Specific activity is the catalytic capacity of the enzyme per unit volume of crude enzyme solution (U / mL). Specific activity of crude enzyme solution is calculated based on the absorbance at 540 nm and a standard curve.

[0082] The results are as follows Figure 5 As shown in the results, after high-temperature reaction at 65°C, the mutants N605D, N605D / S242E, and N605D / S242E / N569E maintained high enzyme activity compared to the original enzyme. In a pH 2.0 buffer, the specific activity of the mutant N605D enzyme increased by 39.2% compared to the original enzyme; the specific activity of the mutant N605D / S242E enzyme increased by 82.5% compared to the original enzyme; and the specific activity of the mutant N605D / S242E / N569E enzyme increased by 185.9% compared to the original enzyme. In a pH 1.9 buffer, the specific activity of the mutant N605D enzyme increased by 42.5% compared to the original enzyme; the specific activity of the mutant N605D / S242E enzyme increased by 80.9% compared to the original enzyme; and the specific activity of the mutant N605D / S242E / N569E enzyme increased by 217.8% compared to the original enzyme.

Claims

1. An acid-resistant α-amylase mutant, characterized in that The amino acid sequence of the α-amylase mutant is obtained by mutation of the sequence shown in SEQ ID NO. 1, wherein the mutation is N605D / S242E or N605D / S242E / N569E.

2. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the α-amylase mutant according to claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that The nucleic acid molecule is obtained by base mutation of the nucleotide sequence shown in SEQ ID NO.

2.

4. A carrier, characterized in that Comprising the nucleotide sequence of claim 3.

5. The carrier according to claim 4, characterized in that The vector includes a cloning vector or an expression vector.

6. A recombinant cell, characterized in that The recombinant cell comprises the vector of claim 4.

7. A method for preparing the α-amylase mutant according to claim 1, characterized in that: The steps include: (1) Using the α-amylase gene as a template, a PCR reaction was performed using point mutation primers to obtain the α-amylase mutant gene; (2) Inserting the α-amylase mutant gene into an expression vector and then transferring it into host cells to obtain recombinant cells; (3) Collect the recombinant cells expressing the α-amylase mutant, resuspend the cells, break the cells, and centrifuge to obtain the supernatant to obtain the crude enzyme solution containing the α-amylase mutant.

8. The preparation method according to claim 7, characterized in that In (2), the α-amylase mutant gene was inserted into an expression vector using DNA homologous recombination method.

9. A product, characterized in that The product comprises the α-amylase mutant according to claim 1 or the nucleic acid molecule according to any one of claims 2 to 3 or the vector according to claim 4 or the recombinant cell according to claim 6.

10. Use of the product according to claim 9 in catalyzing starch hydrolysis.

Citation Information

Patent Citations

  • Mutation improvement method and application of alpha amylase for feed

    CN114457058A