Novel compound for inducing expression of anti-aging gene klotho

Abstract

The present invention relates to novel compounds that induce the expression of the anti-aging gene klotho. The compound of the present invention not only has an excellent effect of increasing the expression amount of Klotho gene, which is a gene related to aging, but also has a protective effect against oxidative stress in retinal pigment epithelial cells (RPE), and thus can be usefully used as a pharmaceutical composition or a health functional food composition for preventing or treating macular degeneration.

Description

Technical Field

[0001] This application claims the priority of Korean Patent Application No. 10-2022-0035142, filed on Mar. 22, 2023, the entire text of which is incorporated by reference into this application.

[0002] The present invention relates to novel compounds that induce the expression of the anti-aging gene klotho. Background Art

[0003] The senescence-accelerated mice (SAM) reported in 1981 revealed the possibility of genes that can regulate animal aging. During the mating of AKR / J rats, the rats produced by chance aged more rapidly than rats of the same series, and it was confirmed that the rats had multiple gene mutations. Later, a group of genes related to aging were reported in the 1990s. The reported genes belong to the RecQ family, which is a gene that expresses a DNA helicase. It is reported that if a mutation occurs in this gene, it will cause premature aging or cancer, and it is known that it affects DNA repair. The single gene related to aging is the klotho gene reported in 1997. The Klotho gene was accidentally discovered when creating a transformed animal model of hypertensive rats. In rats that cannot express this gene, premature aging occurs and the life span is shortened. More interestingly, the life span of male rats that later increased the expression of this gene was extended by 20.0% to 30.8%, and the life span of female rats was extended by 18.8% to 19.0%. This is the first time that the world has been informed of the fact that the life span of rats can be extended or shortened by the expression of a single gene. In addition, the base sequence of the Klotho gene is very similar between animals, and it is reported that rats and humans have 98% of the same sequence. This means that humans can also regulate their life span by adjusting the expression of the Klotho gene.

[0004] In humans, the klotho gene is located in chromosome 13 and produces a membrane protein with a base sequence similar to that of β-glucosidase. It is reported that the Klotho protein is mainly expressed in renal tubular epithelial cells and the choroid plexus of the brain, and in some parathyroid glands. The Klotho gene is a gene associated with various aging phenotypes. In rats lacking the klotho gene, syndromes similar to the aging process such as shortened lifespan, decreased activity, growth retardation, atherosclerosis, arterial calcification, osteoporosis, immature genitals, infertility, skin atrophy, and emphysema occur. In Klotho mutant rats, arteriosclerosis similar to Monckeberg-type arteriosclerosis caused by human aging is observed in all arteries from the aorta to the arterioles, and disorders occur in angiogenesis and vasculogenesis.

[0005] The expression of Klotho mRNA in kidney tissue is significantly higher than that in other tissues, but the expression of klotho mRNA is reduced in the kidneys of rats with hypertension, type 2 diabetes, diabetic nephropathy, and chronic renal failure models. In rats with reduced Klotho expression, the production of nitric oxide (NO), a relaxing factor derived from the endothelium, is reduced. If the klotho gene is injected into Otsuka Long-Evans Tokushima fatty rats (OLETF) that have many risk factors for cardiovascular disease, the vascular intimal dysfunction is improved, the production of NO is increased, and vascular thickening and fibrosis are inhibited, thereby lowering blood pressure. In addition, the klotho gene affects glucose and insulin metabolism in rats, and statins, which are representative hypercholesterolemia treatment agents, increase the expression of klotho mRNA in renal proximal tubular cells. In rats with reduced Klotho expression, osteopenia with low bone turnover caused by impaired differentiation of osteoblasts and osteoclasts is induced, which is similar to the characteristics of human age-related bone loss and senile osteoporosis. In addition, in Klotho mutant rats, abnormal elongation of epiphyseal trabeculae and abnormal trabecular organization in micro-computed tomography imaging were observed, which is caused by obstacles in the bone resorption process. The clinical phenotypic changes caused by Klotho gene mutations observed in humans are diverse. Functional variants of klotho (KL-VS) with mutations in three sites of Klotho gene exon2 are associated with lipid metabolism, blood pressure, life span, cognitive function, coronary artery disease and cerebrovascular disease, and microsatellite polymorphisms and single nucleotide polymorphisms of Klotho gene are associated with bone density. It has been reported that single nucleotide polymorphisms of Klotho gene are also associated with risk factors for cardiovascular disease and bone density in healthy adult women. Recently, the association between the Klotho gene and Alzheimer's disease has been reported by multiple papers. It is reported that in Alzheimer's disease and dementia mouse models, if klotho is overexpressed, the life span of the mice is extended by 30% and cognitive decline is suppressed. It was also observed that the production of beta-amyloid protein in the brain was reduced by 50% by the expression of klotho. In humans, the expression of klotho is inversely proportional to the progression of Alzheimer's disease, and a report that klotho protein reduces the amount of inflammatory cytokines in the blood of Alzheimer's patients has been submitted. According to reports of multiple research results, Klotho has the effect of enhancing the function of the retinal pigment epithelium (RPE) and protecting RPE cells from oxidative stress.It is known that in the retina of (KL- / -) mice with Klotho gene removed, the degeneration of photoreceptors and the reduction of pigment production in RPE cells are shown. Klotho expression is also confirmed in cultured RPE cells, and experiments confirm that the expressed klotho protein increases the synthesis of L-3,4-dihydroxyphenylalanine (L-3,4-dihydorxyphenylalanine, L-DOPA) and inhibits the generation of vascular endothelial growth factor (VEGF) in the basement membrane. In addition, it is confirmed through research results that klotho has the function of protecting RPE cells from oxidative stress by reducing the generation of reactive oxygen species (ROS) in RPE cells. As a result of experiments on patients with age-related macular degeneration (AMD), the expression of klotho in aqueous humor of the eyeball is reduced, and it is confirmed that this reduction effect is related to oxidative stress and inflammation.

[0006] As a result of continuing to study compounds that induce klotho expression, the present inventors have experimentally confirmed that the novel compound developed by the present inventors has excellent stability and excellent protective effect against oxidative stress (oxidative toxicity) in retinal pigment epithelial cells (RPE), thereby completing the present invention. Summary of the invention

[0007] Technical issues

[0008] The object of the present invention is to provide a novel compound represented by Chemical Formula 1 and a pharmaceutically acceptable salt thereof.

[0009] However, the technical problems to be solved by the present invention are not limited to the problems mentioned above, and ordinary technicians in the technical field to which the present invention belongs can clearly understand the unmentioned or other problems through the following description.

[0010] Technical Solution

[0011] In order to achieve the above object, the present invention provides a compound represented by the following Chemical Formula 1 or a pharmaceutically acceptable salt thereof.

[0012] Chemical formula 1

[0013]

[0014] In the above chemical formula 1, R1 and R2 can be -H, halogen or C 1-6 R3 and R4 may be -H or halogen, respectively.

[0015] In a preferred embodiment of the present invention, the compound represented by the above Chemical Formula 1 may be a compound represented by the following Chemical Formula 1-1.

[0016] Chemical formula 1-1

[0017]

[0018] In the above chemical formula 1-1, R1 and R2 can be -H, halogen or C 1-6 A straight chain or branched chain alkyl group.

[0019] In another preferred embodiment of the present invention, the compound represented by the chemical formula 1-1 may be one or more selected from the group consisting of a compound represented by the following chemical formula 1-1A, a compound represented by the following chemical formula 1-1B, a compound represented by the following chemical formula 1-1C, and a compound represented by the following chemical formula 1-1D.

[0020] Chemical formula 1-1A

[0021]

[0022] Chemical formula 1-1B

[0023]

[0024] Chemical formula 1-1C

[0025]

[0026] Chemical formula 1-1D

[0027]

[0028] In another preferred embodiment of the present invention, the above compound can increase the expression of Klotho gene.

[0029] In another preferred embodiment of the present invention, the above compounds can protect retinal pigment epithelial cells from oxidative stress.

[0030] Effects of the Invention

[0031] The compound of the present invention not only has an excellent effect of increasing the expression level of the Klotho gene, which is a gene associated with aging, but also has a protective effect against oxidative stress in retinal pigment epithelial cells. Therefore, it can be effectively used as a pharmaceutical composition or a health functional food composition for preventing or treating macular degeneration. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1Results of confirming the stability of the KS compounds of Example 1 of the present invention by MS / MS analysis: KS101 (compound of Chemical Formula 1-1A), KS102 (compound of Chemical Formula 1-1B), KS103 (compound of Chemical Formula 1-1C), KS104 (compound of Chemical Formula 1-1D).

[0033] FIG. 2 is a result of confirming the expression level of the klotho gene of the KS compound according to Example 1 of the present invention by polymerase chain reaction (PCR).

[0034] Figure 3 This is the result of confirming the cytotoxicity of the KS compound of Example 1 of the present invention.

[0035] Figure 4 These are the results of confirming changes in the amount of intracellular reactive oxygen species (ROS) after treating renal proximal tubular epithelial cells (RPTEC) with the KS compound of Example 1 of the present invention.

[0036] Figure 5 and Figure 6 This is to confirm the results of the expression changes of oxidative stress-related genes according to the KS compound of Example 1 of the present invention.

[0037] Figure 7 This is a result of confirming the cell protective effect of the KS compound of Example 1 of the present invention against oxidative stress. DETAILED DESCRIPTION

[0038] Hereinafter, the present invention will be described in detail.

[0039] Compounds that induce the expression of the anti-aging gene klotho

[0040] The present invention relates to a compound represented by the following Chemical Formula 1 or a pharmaceutically acceptable salt thereof.

[0041] Chemical formula 1

[0042]

[0043] (In the above chemical formula 1, R1 and R2 can be -H, halogen or C 1-6 R3 and R4 may be -H or halogen, respectively).

[0044] In a preferred embodiment of the present invention, the compound represented by the above Chemical Formula 1 may be a compound represented by the following Chemical Formula 1-1.

[0045] Chemical formula 1-1

[0046]

[0047] In the above chemical formula 1-1, R1 and R2 can be -H, halogen or C 1-6 A straight chain or branched chain alkyl group.

[0048] In another preferred embodiment of the present invention, the compound represented by the chemical formula 1-1 may be one or more selected from the group consisting of a compound represented by the following chemical formula 1-1A, a compound represented by the following chemical formula 1-1B, a compound represented by the following chemical formula 1-1C, and a compound represented by the following chemical formula 1-1D.

[0049] Chemical formula 1-1A

[0050]

[0051] Chemical formula 1-1B

[0052]

[0053] Chemical formula 1-1C

[0054]

[0055] Chemical formula 1-1D

[0056]

[0057] The above-mentioned compounds of the present invention can be used in the form of pharmaceutically acceptable salts, and as salts, acid addition salts formed by pharmaceutically acceptable free acids (free acid) are useful. The expression "pharmaceutically acceptable salt" refers to any organic or inorganic addition salt of the basic compound of Chemical Formula 1 with a concentration that is relatively non-toxic and harmless to the patient, and the side effects caused by the salt will not reduce the beneficial effects of the basic compound of Chemical Formula 1. For these salts, inorganic acids and organic acids can be used as free acids, and hydrochloric acid, bromic acid, nitric acid, sulfuric acid, perchloric acid, phosphoric acid, etc. can be used as inorganic acids, and citric acid, acetic acid, lactic acid, maleic acid, fumaric acid, gluconic acid, methanesulfonic acid, glycolic acid, succinic acid, tartaric acid, galacturonic acid, pamoic acid, glutamic acid, aspartic acid, oxalic acid, (D) or (L) malic acid, maleic acid, methanesulfonic acid, ethanesulfonic acid, 4-toluenesulfonic acid, salicylic acid, citric acid, benzoic acid or malonic acid, etc. can be used as organic acids. In addition, these salts include alkali metal salts (sodium salt, potassium salt, etc.) and alkaline earth metal salts (calcium salt, magnesium salt, etc.). For example, the acid addition salts include acetate, aspartate, benzoate, benzenesulfonate, bicarbonate / carbonate, bisulfate / sulfate, borate, right-rotating camphorsulfonic acid, citric acid, edisylate, ethanesulfonate, formate, fumarate, glucoheptonate, gluconate, glucuronate, hexafluorophosphate, high benzoate, hydrochloride / chloride, hydrobromide / bromide, hydroiodide / iodide, isethionate, lactic acid, malate, maleate, malonic acid, chloranide ... Hydrochloride, methanesulfonate, methylsulfate, naphthoate, 2-naphthalenesulfonate, nicotinate, nitrate, orotate, oxalate, palmitate, pamoate, phosphate / hydrogenphosphate / dihydrogenphosphate, sucrose salt, stearate, succinate, tartrate, toluenesulfonate, trifluoroacetate, aluminum, arginine, benzathine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, olamine, potassium, sodium, tromethamine, zinc salt, etc., among which hydrochloride or trifluoroacetate is preferred.

[0058] Furthermore, the above-mentioned compounds of the present invention include not only pharmaceutically acceptable salts but also all salts, isomers, hydrates and solvates which can be prepared by conventional methods.

[0059] The addition salt of the present invention can be prepared by a common method. For example, the compound of Chemical Formula 1 can be prepared by dissolving a water-soluble organic solvent in acetone, methanol, ethanol or acetonitrile and adding an excess of an organic acid or an aqueous solution of an inorganic acid, followed by precipitation or crystallization. Then, in the mixture, after evaporating the solvent or excess acid, drying is performed to obtain an addition salt, or the precipitated salt can be prepared by suction filtration.

[0060] The above compounds of the present invention can increase the expression of Klotho gene.

[0061] Furthermore, it was confirmed by an oxidative stress experiment using retinal pigment epithelium that the above-mentioned compound exhibits an effect of protecting cells from oxidative stress. Therefore, the compound of the present invention can be effectively used as a preventive or therapeutic agent for macular degeneration.

[0062] Pharmaceutical composition for preventing or treating macular degeneration

[0063] Another embodiment of the present invention relates to a pharmaceutical composition for preventing or treating macular degeneration, comprising a compound represented by the following Chemical Formula 1 or a pharmaceutically acceptable salt thereof as an effective ingredient.

[0064] Chemical formula 1

[0065]

[0066] (In the above chemical formula 1, R1 and R2 can be -H, halogen or C 1-6 R3 and R4 may be -H or halogen, respectively).

[0067] In a preferred embodiment of the present invention, the compound represented by the above Chemical Formula 1 may be a compound represented by the following Chemical Formula 1-1.

[0068] Chemical formula 1-1

[0069]

[0070] In the above chemical formula 1-1, R1 and R2 can be -H, halogen or C 1-6 A straight chain or branched chain alkyl group.

[0071] In another preferred embodiment of the present invention, the compound represented by the chemical formula 1-1 may be one or more selected from the group consisting of a compound represented by the following chemical formula 1-1A, a compound represented by the following chemical formula 1-1B, a compound represented by the following chemical formula 1-1C, and a compound represented by the following chemical formula 1-1D.

[0072] Chemical formula 1-1A

[0073]

[0074] Chemical formula 1-1B

[0075]

[0076] Chemical formula 1-1C

[0077]

[0078] Chemical formula 1-1D

[0079]

[0080] The above-mentioned macular degeneration may be age-related macular degeneration.

[0081] The composition of the present invention can increase the expression level of the Klotho gene.

[0082] Furthermore, the composition of the present invention can protect retinal pigment epithelial cells from oxidative stress.

[0083] The compounds of the present invention can be administered clinically in various dosage forms for oral and parenteral administration. In the case of formulation, they can be prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

[0084] Solid preparations for oral administration include tablets, pills, powders, granules, capsules, lozenges, etc., which are configured by mixing at least one excipient such as starch, calcium carbonate, sucrose, lactose or gelatin with more than one compound of the present invention. In addition, lubricants such as magnesium stearate talc are also used, except for simple excipients. As liquid preparations for oral administration, including suspensions, oral solutions, emulsions or syrups, in addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, aromatics, preservatives, etc. may also be included.

[0085] Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, etc. As non-aqueous solutions and suspensions, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, etc. can be used. As the base of the suppository, semi-synthetic fatty acid esters (witepsol), polyethylene glycol, Tween 61, cocoa butter, lauric acid glyceride, glycerin, gelatin, etc. can be used.

[0086] Furthermore, the effective dose of the compound of the present invention for human body may vary according to the patient's age, weight, sex, administration form, health status and disease severity, usually, about 0.001mg / kg / day to 100mg / kg / day, preferably 0.01mg / kg / day to 35mg / kg / day. When an adult patient weighing 70kg is used as a benchmark, it is usually 0.07mg / day to 7000mg / day, preferably 0.7mg / day to 2500mg / day, and may also be administered once a day or several times a day at a prescribed time interval according to the judgment of a doctor or pharmacist.

[0087] Food composition for preventing or improving macular degeneration

[0088] Another embodiment of the present invention relates to a food composition for preventing or improving macular degeneration or a health functional food composition comprising the compound represented by the above Chemical Formula 1 or a pharmaceutically acceptable salt thereof as an effective ingredient.

[0089] The composition of the present invention can increase the expression level of the Klotho gene.

[0090] Furthermore, the composition of the present invention can protect retinal pigment epithelial cells from oxidative stress.

[0091] There is no particular restriction on the type of food. Examples of foods to which the effective substance of the present invention can be added include beverages, meats, sausages, bread, crackers, cakes, chocolates, candies, snacks, biscuits, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, alcoholic beverages and microbial complexes, dairy products and processed dairy products, etc., which may include health foods and health functional foods in the usual sense.

[0092] The health food and health functional food compositions comprising the active substance of the present invention can be directly added to food or used together with other foods or food ingredients, and can be appropriately used according to the usual method. The mixing amount of the active substance can be appropriately determined according to its purpose of use (for prevention or improvement). Usually, relative to the total amount of the whole food, the above-mentioned composition in the health food and health functional food of 0.1 to 90 weight portions can be added. However, in the case of long-term intake for the purpose of maintaining health or controlling health, the above-mentioned amount can be below the above-mentioned range, and since there is no problem in terms of safety, the active substance can also be used in an amount above the above-mentioned range.

[0093] The health food and health functional food composition of the present invention include the active substance of the present invention as an essential component in the indicated ratio. In addition, other components are not particularly limited, such as common beverages, and various flavoring agents or natural carbohydrates, etc., may also be included as additional components. As the example of the above-mentioned natural carbohydrate, there are conventional sugars such as monosaccharides, disaccharides and polysaccharides and sugar alcohols such as xylitol, sorbitol, erythritol, the above-mentioned monosaccharides such as glucose, fructose, etc., the above-mentioned disaccharides such as maltose, sucrose, etc., the above-mentioned polysaccharides such as dextrin, cyclodextrin, etc. As the flavoring agent in addition to the above-mentioned, natural flavoring agent (thaumatin), stevia extract (for example, sabaudioside A, glycyrrhizin, etc.) and synthetic flavoring agent (saccharin, aspartame, etc.) may be advantageously used. The ratio of the above-mentioned natural carbohydrate is as follows, and the health functional food composition of the present invention of every 100g is usually about 1g to 20g, preferably about 5g to 12g.

[0094] In addition to the above ingredients, the health food and health functional food composition containing the effective substance of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and extenders (cheese, chocolate, etc.), pectin acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerol, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the health food and health functional food composition of the present invention may contain pulp used to prepare natural fruit juices, fruit juice drinks and vegetable drinks.

[0095] Such ingredients may be used alone or in combination. The proportion of such additives is not important, but is usually selected in the range of 0.1 to about 20 parts by weight relative to 100 parts by weight of the health food or health functional food composition comprising the active substance of the present invention.

[0096] Embodiments of the present invention

[0097] Hereinafter, the present invention will be described in more detail by the following examples. However, the following examples are only for illustrative purposes and the content of the present invention is not limited to the following examples.

[0098] Example 1. Synthesis of compounds

[0099] 1-1: Synthesis of KS101 compound

[0100] Step 1: Preparation of 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-19025-2-1)

[0101] In an argon (Ar) atmosphere, 2-aminophenol (2-Aminophenol) (150mg, 1.37mmol) was dissolved in methanol (methanol) (8mL), and 3,4-difluorophenylisothiocyanate (3,4-difluorophenylisothiocyanate) (224μl, 1.65mmol) was slowly added and stirred at room temperature for 13 hours. After confirming the completion of the reaction by thin layer chromatography (TLC, thinlayer chromatography), methanol was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (20% acetone (Acetone) / n-hexane (n-hexane)) to obtain 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl) thiourea (354mg, 92%) as a light yellow solid.

[0102] 1 H-NMR(400MHz,MeOH-d4)δ7.62(d,J=8.0Hz,1H),7.55(ddd,J=2.4Hz,1H),7.25-7.13(m,2H),7.11-7.05(m,1H),6.92-6.82(m,2H); ESI-(+)281.3[M+H] + .

[0103] Step 2: Preparation of N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (FCCS-19025)

[0104] In an argon atmosphere, FCCS-19025-2-1 (224 mg, 0.80 mmol) obtained in step 1 above and potassium superoxide (KO2) (284 mg, 4.00 mmol) were dissolved in acetonitrile (MeCN) (25 mL) and stirred at room temperature for 14 hours. After confirming the completion of the reaction by thin layer chromatography, acetonitrile was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (10-20% ethyl acetate / n-hexane) to obtain the target compound N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (160 mg, 82%) as a white solid.

[0105] Chemical formula 1-1A

[0106]

[0107] 1 H-NMR (400MHz, MeOH-d4) δ7.82 (ddd, J = 2.8Hz, 1H), 7.42 (d, J = 7.6Hz, 1H), 7.36 (d, J = 8. 0Hz,1H),7.34-7.29(m,1H),7.28-7.18(m,2H),7.16-7.10(m,1H); ESI-(+)247.2[M+H] + .

[0108] 1-2: Synthesis of KS102 compound

[0109] 2-Aminophenol (1.0 equiv.) and 3,4-difluorophenylisothiocyanate (1.2 equiv.) were mixed in tetrahydrofuran (THF) (2 mL / mmol) and stirred at room temperature. After stirring for 3 hours, ferric chloride (FeCl3·6H2O) was added to the above solution and the reaction mixture was stirred at 90°C for 12 hours. After the reaction mixture was cooled to room temperature, it was extracted with ethyl acetate (EtOAc). After the mixed organic layer was dried over magnesium sulfate (MgSO4), it was concentrated in vacuo. The residue was crushed with dichloromethane (CH2Cl2) to obtain the desired product (3,4-difluorophenylisothiocyanate) as a solid.

[0110] Then, the above-mentioned 3,4-difluorophenyl isothiocyanate (210 mg, 1.23 mmol) was reacted with 2-amino-4-fluorophenol (2-amino-4-fluorophenol, 130 mg, 1.02 mmol) to obtain the KS102 compound (N-(3,4-difluorophenyl)-5-fluorobenzo[d]oxazol-2-amine) (195 mg, 72%) as a light brown solid represented by the following chemical formula 1-1B.

[0111] Chemical formula 1-1B

[0112]

[0113] mp222.9-223.9℃; R f 0.40 (EtOAc / n-hexane = 1:3); HPLC R T 5.15min

[0114] (Purity: 99.7%); 1 H-NMR(DMSO-d6,800MHz)δ6.97(ddd,J=9.8,8.7,2.6Hz,1H),7.36(dd,J=9.0,2.6Hz,1H),7.4 3-7.48(m,2H),7.52(dd,J=8.7,4.4Hz,1H),7.91(ddd,J=12.8,7.1,2.3Hz,1H),11.0(s,1H); 13 C-NMR (DMSO-d6, 200 MHz) 159.4 (J CF =234.9Hz),159.1,149.2(JCF =241.9,13.0Hz),144.7(J CF =239.0,12.4Hz),143.4,143.2(J CF =13.7Hz),135.5(J CF =9.2,2.2Hz),117.8(J CF =17.9Hz),114.1(J CF =5.8,3.1Hz),109.5(J CF =10.3Hz),108.5(J CF =25.6Hz),106.7(J CF =22.1Hz),103.9(J CF =26.3Hz)ppm, LR-MS(FAB)m / z 265(M+H) + ; HR-MS (FAB) for C 13 H8F3N2O(M+H) + Calculated value 265.0589, measured value 265.0588.

[0115] 1-3: Synthesis of KS103 compound

[0116] The KS103 compound (N-(3,4-difluorophenyl)-6-fluorobenzo[d]oxazol-2-amine) (203 mg, 75%) as a milky white solid represented by the following chemical formula 1-1C was obtained by reacting 3,4-difluorophenyl isothiocyanate (210 mg, 1.23 mmol) obtained in the above Example 3-1 with 2-amino-5-fluorophenol (130 mg, 1.02 mmol).

[0117] Chemical formula 1-1C

[0118]

[0119] mp231.7-232.6℃; R f 0.40 (EtOAc / n-hexane = 1:3); HPLC R T 5.12min

[0120] (Purity: 98.4%); 1H-NMR(DMSO-d6,800MHz)δ7.10(ddd,J=10.1,8.6,2.5Hz,1H),7.42-7.45(m,2H),7.47(dd,J=8.6,4.9Hz,1H),7.54 (dd, J=8.4, 2.5Hz, 1H), 7.91 (ddd, J=12.6, 7.0, 2.1Hz, 1H), 10.9 (s, 1H); 13C-NMR (DMSO-d6, 200MHz) 158.1, 158.0 (J CF =235.9Hz),149.2(J CF =241.8,13.2Hz),146.8(J CF =15.0Hz),144.6(J CF =238.8,12.6Hz),138.4.135.7(J CF =7.3Hz),117.8(J CF =17.9Hz),116.8(J CF =9.6Hz),113.8(J CF =5.5,3.3Hz),111.0(J CF =23.7Hz),106.4(J CF =22.1Hz),98.0(J CF =28.9Hz)ppm,LR-MS(FAB)m / z265(M+H) + ; HR-MS (FAB) for C 13 H8F3N2O(M+H) + Calculated value 265.0589, measured value 265.0586.

[0121] 1-4: Synthesis of KS104 compound

[0122] The KS104 compound (N-(3,4-difluorophenyl)-5,6-difluorobenzo[d]oxazol-2-amine) (187 mg, 64%) as a bright purple solid represented by the following chemical formula 1-1D was obtained by reacting 3,4-difluorophenyl isothiocyanate (212 mg, 1.24 mmol) obtained in the above Example 3-1 with 2-amino-4,5-fluorophenol (150 mg, 1.03 mmol).

[0123] Chemical formula 1-1D

[0124]

[0125] mp242.1-243.2℃; R f 0.40 (EtOAc / n-hexane = 1:3); HPLC R T 5.44min

[0126] (Purity: 99.1%); 1 H-NMR (DMSO-d6, 800MHz) δ7.41-7.42 (m, 1H), 7.46 (dd, J = 19.3, 9.0 Hz, 1H), 7.62 (dd, J = 10. 5,7.5Hz,1H),7.83(dd,J=9.8,6.9Hz,1H),7.89(ddd,J=13.0,7.2,2.5Hz,1H),11.0(s,1H); 13 C-NMR(DMSO-d6,200MHz)158.9,149.2(J CF =242.0,13.1Hz),147.3(J CF =237.0,13.7Hz),145.5(J CF =238.0,14.7Hz),144.8(J CF =239.0.13.5Hz),142.1(J CF =12.6Hz),138.0(J CF =11.5,1.5Hz),135.4(J CF =13.2,1.8Hz),117.8(J CF =17.8Hz),114.0((J CF =5.7,3.1Hz),106.6(J CF =22.1Hz),104.9(J CF =21.7Hz),99.5(J CF =24.1Hz)ppm, LR-MS(FAB)m / z 283(M+H) + ; HR-MS (FAB) for C 13 H7F4N2O(M+H) + Calculated value 283.0495, measured value 283.0505.

[0127] Experimental Example 1. Evaluation of the stability of compounds

[0128] Each KS compound of Example 1 was dissolved in 10 mM dimethyl sulfoxide (DMSO) and used, and tolbutamide used as a standard substance was dissolved in methanol at a concentration of 10 mM and used.

[0129] In a glass test tube (13×100 mm), 0.1 M potassium dihydrogen phosphate (KH2PO4) (147.5 μl), 0.1 M magnesium chloride (MgCl2) (25 μl), and 50 μl of 0.5 mg / ml human liver microsomes (mixed-gender pool) purchased from Corning (Corning Life Science) were mixed with each KS compound solution to a final concentration of 1 μM, and pre-incubated in a shaking water bath (37°C, 40 rpm) for 3 minutes, and then incubated for 30 minutes with or without the addition of 25 μl of 10 mM reduced nicotinamide adenine dinucleotide phosphate (NADPH).

[0130] After taking 50μl of the sample before and after the reaction, add 2ml of acetonitrile to stop the reaction and vortex for 1 minute. After centrifuging (4000rpm, 4°C) the mixed solution for 20 minutes, transfer each supernatant to a new glass test tube and dry it for 2 hours using a centrifugal concentrator. After confirming that it is completely dry and adding 200μl of 40% acetonitrile to each glass test tube, vortex for 1 minute to resuspend. After centrifuging (4000rpm, 4°C) the resuspended solution for 10 minutes, take 150μl of the supernatant for use in HPLC-UV analysis. Agilient 1200series was used for HPLC-UV analysis, and Agilent 6410 was used for MS / MS analysis. The conditions used in the analysis are as follows.

[0131] Table 1

[0132] Conditions used for HPLC analysis

[0133]

[0134] Table 2 Conditions used for LC-MS / MS analysis

[0135]

[0136] Figure 1 The results of the KS compounds incubated with human liver microsomes were quantitatively confirmed by MS / MS analysis. Microsome enzymes work in a coenzyme NADPH(+)-dependent manner, and the compounds are metabolized only in reactions with the addition of NADPH(+). The KS compounds showed higher stability than tolbutamide used as a control, and KS104 was found to have the best microsomal stability.

[0137] Experimental Example 2. Comparison of the Effects of Klotho Gene Expression

[0138] The KS compounds of Example 1 were treated with human renal proximal tubular epithelial cells (RPTEC) at different concentrations, and messenger RNA (mRNA) was collected from the cells after 6 hours and the expression of the messenger RNA of the klotho gene was confirmed by polymerase chain reaction. Renal proximal tubular epithelial cells (RPTEC) were purchased from Lonza and cultured at 37°C and 5% CO2 for use in the experiment. After each KS compound was placed in the cell culture medium and exposed for 6 hours, ribonucleic acid (RNA) was isolated from the cells and converted into complementary deoxyribonucleic acid (cDNA) using reverse transcriptase and klotho was amplified by polymerase chain reaction to confirm the expression level. Dimethyl sulfoxide was added instead of the compound to be used as a control group.

[0139] The information of primers used in the experiments is as follows.

[0140] KL-F: GATAGAGAAAAATGGCTTCCCTCC (sequence 1)

[0141] KL-R: GGTCGGTAAACTGAGACAGAGTGG (sequence 2)

[0142] GAPDH-F: TGACAACTTTGGTATCGTGGAAGG (sequence 3)

[0143] GAPDH-R: AGGGATGATGTTCTGGAGAGCC (sequence 4)

[0144] Figure 2 shows the results of confirming the expression of the klotho gene by polymerase chain reaction. A gel photograph and a graph showing the expression level of the bands shown in the gel photograph by quantifying them using Image J. The upper band in the gel photograph shows the secreted form of klotho, and the lower band shows the membrane form of klotho. The quantitative graph shows the two bands together. The expression effect of KS104 showed the best effect, and it was confirmed that the ability to express the klotho gene was more than twice as high as not only KS101, but also other fluorine-binding compounds.

[0145] Experimental Example 3. Evaluation of cytotoxicity

[0146] The KS compound of Example 1 was treated with different concentrations in cultured human retinal epithelial cells (ARPE) and cultured for 24 hours. Then, the cells were placed in EX-cytox of GOGEN Company to react for 1 hour and the change in absorbance was measured. The lower the absorbance, the more damaged the cells were due to toxicity. Figure 3 As shown, it was confirmed that KS104 had the lowest cytotoxicity.

[0147] Experimental Example 4. Analysis of intracellular reactive oxygen species

[0148] Renal proximal tubular epithelial cells (RPTEC) were treated with the KS compounds of Example 1 to examine how the amount of intracellular reactive oxygen species changes.

[0149] 2.5 μM of each KS compound was added to the cultured RPTEC cells and cultured for 6 hours. Then, Invitrogen's Reactive Oxygen Detection Reagents were added and cultured for 1 hour. The fluorescence change was measured using a spectrophotometer to confirm the amount of reactive oxygen species (ROS) present in the cells.

[0150] Figure 4 This is a graph showing the amount of active oxygen remaining in RPTEC cells. It was confirmed that the amount of active oxygen in cells treated with KS103 compound and KS104 compound was reduced by about 30% compared with cells treated with only a solvent (dimethyl sulfoxide).

[0151] Experimental Example 5: Confirmation of changes in oxidative stress-related gene expression

[0152] After adding 2.5 μM of each compound to relatively aged 7th passage (#7) renal proximal tubule epithelial cells (RPTEC) and culturing for 6 hours, messenger RNA was collected and total gene expression was confirmed using a next-generation sequencer. In order to confirm the changes in gene expression caused by aging, the genes (TXN, AKT1, NR4A3, NLRP3, FOXP3 genes) whose expression increased in young cells were confirmed by comparing the gene expression with that in relatively young 4th passage (#4) RPTEC cells. The expression levels of the relevant genes in young cells were compared with the expression change values ​​caused by treating the compounds of Example 1 (treating the compounds of Example 1 to aged cells). As a result, it was confirmed that when the KS104 compound was treated to aged cells, the expression of the relevant genes was induced more significantly than that in young cells ( Figure 5 , Figure 6 ).

[0153] Experimental Example 6. Protective effect on retinal pigment epithelial cells

[0154] In order to confirm the preventive or therapeutic effect of the KS compound of Example 1 on macular degeneration, the effect of protecting retinal pigment epithelial cells from oxidative stress was confirmed.

[0155] First, human retinal pigment epithelial cells (ARPE) purchased from ATCC in the U.S. were used. 10,000 ARPE cells were placed in each well and cultured for 18 hours, and then the medium was replaced with DMEM F-12 medium containing no serum (fetal bovine serum (FBS)).

[0156] In this case, each KS compound was added at a concentration of 2.5 μM, and buthionine sulfoximine (BSO) was treated at a concentration of 50 mM for 6 hours to induce oxidative stress. In order to measure the viability of these cells, Cyto X (Cell Viability Assay Kit) was added and the absorbance over time was measured at a wavelength of 450 nm.

[0157] As a result, it was confirmed that both KS103 and KS104 compounds inhibited cell apoptosis caused by oxidative stress ( Figure 7 ).

Claims

1. A compound or a pharmaceutically acceptable salt thereof, characterized in that: The above compound is represented by the following chemical formula 1-1D: Chemical formula 1-1D:

2. A compound or a pharmaceutically acceptable salt thereof, characterized in that: The above compound is represented by the following chemical formula 1-1C: Chemical formula 1-1C:

3. The compound according to claim 1 or 2 or a pharmaceutically acceptable salt thereof, characterized in that: The above compounds increase the expression of the Klotho gene.

4. The compound according to claim 1 or 2 or a pharmaceutically acceptable salt thereof, characterized in that: The above compounds protect retinal pigment epithelial cells from oxidative stress.

5. The compound according to claim 1 or 2 or a pharmaceutically acceptable salt thereof, characterized in that: The above-mentioned compound is used as a pharmaceutical composition for preventing or treating macular degeneration.

6. The compound according to claim 1 or 2 or a pharmaceutically acceptable salt thereof, characterized in that: The above compound is used as a food composition for preventing or improving macular degeneration.

Images