SNP (Single Nucleotide Polymorphism) molecular marker related to porcine nipple number character and application of SNP molecular marker

Abstract

The invention discloses three SNP molecular markers yzrs329085302, rs320468838 and yzrs325631013 on a chromosome 14, the left nipple number, the right nipple number and the total nipple number of boars with different genotypes are remarkably different, the three new SNP molecular markers can be used for evaluating the nipple number of the boars for non-diagnosis and treatment purposes, and compared with the existing PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) and other methods, the three SNP molecular markers have the advantages that the number of the left nipples, the number of the right nipples and the number of the total nipples of the boars with different genotypes can be evaluated; the method has the outstanding advantages of being simple, rapid, high in sensitivity, good in specificity and the like.

Description

Technical Field

[0001] The invention relates to the field of molecular markers and animal breeding, and in particular to a SNP molecular marker associated with the trait of pig nipple number and an application thereof. Background Art

[0002] The number of nipples in pigs is a complex trait with moderate heritability. Its heritability evaluation values ​​are mostly between 0.1 and 0.5. It is one of the important reproductive traits of pigs. The establishment of high-reproductive strains (species) is inseparable from the high number of nipples as its physiological basis. Sows with more nipples can suckle more piglets, and their number affects the survival rate of piglets. Studies have shown that there is a certain positive correlation between the number of nipples and the number of piglets. The effective combination of more nipples and high litter size is the physiological basis for achieving high reproductive capacity of sows. With the application of breeding technology, the litter size trait of the core sow group has been effectively improved, but the number of nipples has not been systematically selected and improved, resulting in more piglets than nipples. Some piglets need to be fostered or artificially suckled, which increases production costs and management difficulties. Therefore, the selection and breeding of the nipple number trait has also become one of the focuses of current breeding research.

[0003] In recent years, multi-gene marker screening methods have developed rapidly, and genome-wide association study (GWAS) has become one of the mainstream methods. GWAS analysis refers to the association study of genes and phenotypes at the whole genome level, with multicenters, large samples, and repeated verification. It can efficiently associate phenotypes with genotypes and search for candidate genes for related traits. With the widespread application of genome-wide association analysis in pig breeding, loci related to nipple number and related candidate genes have been reported one after another. A total of 983 QTLs associated with nipple number are included in the pig QTLdb database. Although most studies on nipple number have been reported, their research results usually have population heterogeneity, and their genetic basis and the main effect genes controlling the pig nipple number trait are still unclear.

[0004] Meta-analysis, also known as meta-analysis, meta-analysis, heterogeneity analysis and comprehensive analysis, is a method of statistically synthesizing information from multiple independent studies, thereby increasing the probability of discovering new associations and reducing false negative results. It can increase the test power and improve the accuracy and reliability of the results. The application of Meta-analysis in the field of pig breeding has increased the number and accuracy of GWAS results and facilitated the genetic analysis of important economic traits of excellent pig breeds.

[0005] The present invention utilizes the methods of whole genome association analysis and Meta-analysis to mine genetic markers associated with nipple number in 7338 sows of different strains and lines, and utilizes the genetic molecular markers to further carry out the selection and breeding of sows with a high number of nipples. Summary of the invention

[0006] The purpose of the present invention is to provide a new SNP molecular marker related to the pig nipple number trait, so as to facilitate the selection and breeding of sows with a large number of nipples.

[0007] According to the first aspect of the present invention, a SNP molecular marker related to the pig nipple number trait is provided, and the SNP molecular marker is a C>T mutation located at the 54971936bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version; or a T>C mutation located at the 54972009bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version; or a C>G mutation located at the 48300187bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version. Therefore, the three new SNP molecular markers can be used for non-diagnostic and therapeutic purposes to evaluate the number of pig nipples. Compared with the current PCR-RFLP and other methods, the present application has the outstanding advantages of being simple, fast, highly sensitive and specific.

[0008] According to the second aspect of the present invention, there is provided an application of a SNP molecular marker in improving the nipple number trait of sows, wherein the SNP molecular marker is a C>T mutation located at the 54971936bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version; or a T>C mutation located at the 54972009bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version; or a C>G mutation located at the 48300187bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version. Thus, by using the above-mentioned SNP molecular markers for breeding, the nipple number of sows can be effectively increased, and the reproductive performance and economic value of sows can be further improved.

[0009] According to the third aspect of the present invention, there is provided an application of a SNP molecular marker in breeding a sow strain with a high nipple number, wherein the SNP molecular marker is a C>T mutation located at the 54971936bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version; or a T>C mutation located at the 54972009bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version; or a C>G mutation located at the 48300187bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version. Thus, by using the above-mentioned SNP molecular markers for breeding, a sow strain with a high nipple number can be efficiently bred, further improving the reproductive performance and economic value of sows.

[0010] In certain embodiments, the method of application comprises the following steps:

[0011] 1) Detecting the SNP molecular markers in gilts;

[0012] 2) selecting an individual with the TT genotype at the 54971936bp position detected in step 1) as a sow for breeding, and breeding the sow for breeding;

[0013] Or selecting an individual with the TT genotype at the 54972009bp position detected in step 1) as a breeding sow, and breeding the breeding sow;

[0014] or selecting an individual with the CC genotype at the 48300187bp position detected in step 1) as a breeding sow, and breeding the breeding sow;

[0015] 3) The SNP molecular markers are detected in the piglets born from the mating in step 2), and the piglets are kept according to the genotypes described in step 2), and then bred to cultivate a sow strain with a large number of nipples.

[0016] According to the fourth aspect of the present invention, there is provided an application of a SNP molecular marker for improving the nipple number trait of sows, wherein the SNP molecular marker is a C>T mutation located at the 54971936bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version; or a T>C mutation located at the 54972009bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version; or a C>G mutation located at the 48300187bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version. Thus, the nipple number trait of sows can be improved by the above-mentioned SNP molecular marker, and the nipple number of sow groups can be further increased, thereby improving the reproductive performance and market competitiveness of sow groups.

[0017] In some embodiments, the application comprises the following steps:

[0018] 1) Detecting the SNP molecular markers in gilts;

[0019] 2) selecting an individual with the TT genotype at the 54971936bp position detected in step 1) as a sow for breeding, and breeding the sow for breeding;

[0020] Or selecting an individual with the TT genotype at the 54972009bp position detected in step 1) as a breeding sow, and breeding the breeding sow;

[0021] or selecting an individual with the CC genotype at the 48300187bp position detected in step 1) as a breeding sow, and breeding the breeding sow;

[0022] 3) The SNP molecular markers are detected in the piglets born from the mating in step 2), and the piglets are kept according to the genotypes described in step 2), and then bred to retain the dominant genotype individuals in the offspring pigs and eliminate other genotypes to increase the frequency of the dominant allele from generation to generation, thereby improving the nipple number trait of the sow group and improving the nipple number of the offspring sows.

[0023] According to the fifth aspect of the present invention, there is provided an application of a SNP molecular marker for detecting / screening / identifying the trait of nipple number in sows, wherein the SNP molecular marker is a C>T mutation located at the 54971936bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version; or a T>C mutation located at the 54972009bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version; or a C>G mutation located at the 48300187bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version. Thus, the above molecular marker can be used to conveniently, efficiently, safely and specifically detect / screen / identify the trait of nipple number in sows.

[0024] In certain embodiments, the sow is a Large White or Landrace sow.

[0025] According to the sixth aspect of the present invention, a nucleotide sequence containing a SNP molecular marker related to the pig nipple number trait is provided, the sequence containing a nucleotide sequence as shown in SEQ ID No: 1, and M in the sequence represents a C>T base mutation; or containing a nucleotide sequence as shown in SEQ ID No: 2, and M in the sequence represents a T>C base mutation; or containing a nucleotide sequence as shown in SEQ ID No: 3, and M in the sequence represents a C>G base mutation. Thus, through the sequence, corresponding primers or probes can be designed to detect / screen / identify the SNP molecular marker, and then used for the selection of sow nipple number traits, which can improve the nipple number and reproductive performance of sow groups and effectively shorten the breeding period, thereby improving the economic value and market competitiveness of sows.

[0026] According to the seventh aspect of the present invention, there is provided an application of the nucleotide sequence in preparing a SNP molecular marker product for detecting / screening / identifying a SNP molecular marker product related to the number of teats in pigs, wherein the nucleotide sequence contains a nucleotide sequence as shown in SEQ ID No: 1, and M in the sequence represents a C>T base mutation; or contains a nucleotide sequence as shown in SEQ ID No: 2, and M in the sequence represents a T>C base mutation; or contains a nucleotide sequence as shown in SEQ ID No: 3, and M in the sequence represents a C>G base mutation. Thus, a product or kit for detecting the number of teats in pigs can be prepared by using the sequence, making the detection or use more convenient and efficient.

[0027] Beneficial effects of the present invention:

[0028] 1. The present invention patent identified three SNP molecular markers yz_rs329085302, rs320468838, and yz_rs325631013 on chromosome 14 that affect the number of nipples of sows. Each marker has extremely significant differences in the number of left nipples, right nipples, and total nipples of sows with different genotypes (Table 1-3). The three new SNP molecular markers can be used to evaluate the number of nipples of pigs for non-diagnostic and therapeutic purposes. Compared with the current methods such as PCR-RFLP, the present invention has the outstanding advantages of being simple, fast, highly sensitive, and having good specificity.

[0029] 2. Through the application of these three new SNP molecular markers, the number of nipples of sows can be effectively increased, and can be used to breed sows with more nipples and improve the number of nipples of sows. It can also be used to detect / screen / identify the number of nipples of sows, etc., so that the number of nipples of sows can be selected and bred simply and efficiently, thus improving breeding efficiency, and improving the reproductive performance of sows, and further delivering economic benefits.

[0030] 3. Also disclosed is a nucleotide sequence containing a SNP molecular marker associated with the sow nipple number trait. Through the sequence, corresponding primers or probes can be designed to detect / screen / identify the SNP molecular marker, which can then be used for the breeding of the sow nipple number trait, thereby increasing the nipple number and reproductive performance of the sow group and effectively shortening the breeding period, thereby improving the economic value and market competitiveness of the sow. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The Manhattan plot of the yz_rs329085302 and rs320468838 molecular markers, where yz_rs329085302 and rs320468838 are marked as the corresponding SNP sites;

[0032] Figure 2This is the Manhattan plot of the yz_rs325631013 molecular marker, and the area marked with yz_rs325631013 in the plot is the SNP site. DETAILED DESCRIPTION

[0033] The invention will be further described in detail below in conjunction with the accompanying drawings.

[0034] Example 1. Screening of molecular markers

[0035] (1) Phenotype-pedigree data collection

[0036] The research population of this application is Danish Large White, Chinese Large White, Topek Large White, Danish Landrace, Chinese Landrace, and Topek Landrace, all from the core breeding farm of Guangxi Yangxiang Group Co., Ltd. The phenotypic data such as the number of left nipples, the number of right nipples, and the number of preumbilical nipples were recorded between 2015 and 2022. The total number of nipples is calculated as: total number of nipples = number of left nipples + number of right nipples. After filtering the abnormal phenotypic data, a total of 15,214 pigs were obtained for the nipple number trait observations for phenotype-genotype association analysis.

[0037] (2) Genotyping and quality control

[0038] Ear tissue samples or blood samples were collected from sows, total DNA was extracted, and genotyping of qualified DNA samples was performed using the pig 80K functional locus gene chip [Shadow Gene, CHN, DNBSEQ-T7 (MGI)]. PLINKv2.0 software was used for quality control, and the conditions were: SNP sites at unknown positions and on sex chromosomes were eliminated, and the individual detection rate was retained ≥ 90%; SNP detection rate ≥ 90%; minimum allele frequency ≥ 0.01; Hardy-Weinberg equilibrium P value ≥ 10 -6 The missing loci were filled with beagle software (version 4.1). After filling, quality control was performed again, and the quality control conditions were the same as before. 7506 pigs were obtained with both phenotypic and genotypic data for subsequent analysis.

[0039] (3) Principal component analysis and quality control

[0040] This application uses PLINKv2.0 software to evaluate the population structure. Principal component analysis (PCA) was performed on the SNP chip data after quality control, the first five principal component characteristics were calculated, and the first three principal components were taken to draw the principal component result diagram. Since Danish Landrace and Chinese Landrace could not be distinguished on the first three principal components, they were analyzed as a group in the subsequent analysis. According to the results, the discrete groups outside the 95% confidence interval were eliminated, and finally divided into five groups of Danish Chinese Landrace, Topek Landrace, Danish Large White, Chinese Large White, and Topek Large White, with a total of 7,338 pigs, for subsequent analysis. The original chip data of 5 groups were extracted from the original chip data respectively, and quality control-filling-quality control was performed using PLINKv2.0 software and beagle software (version4.1). The operation steps and quality control conditions were the same as before, and 3729 Danish Large Whites and 74147 SNPs, 250 Chinese Large Whites and 100066 SNPs, 263 Topek Large Whites and 94946 SNPs, 2914 Danish and Chinese Landraces and 88625 SNPs, and 182 Topek Landraces and 69752 SNPs were obtained as the final data analysis.

[0041] (4) Statistical Model

[0042] 4.1 Genome-wide association analysis model

[0043] This application uses the univariate mixed linear model of GEMMA software to perform genome-wide association analysis on the nipple number traits of the five populations. The univariate mixed linear model is as follows:

[0044] y=Wα+Xβ+μ+ε

[0045] Where y is the phenotype vector, W is the indicator matrix of fixed effects and covariates, which include sex, field, season and the first three principal component characteristics of PCA, α is the corresponding correlation coefficient in each fixed effect; X is the indicator matrix of SNP, β represents the effect vector of SNP; μ is the n×1 random effect matrix, and ε represents the residual.

[0046] 4.2 Meta-analysis model

[0047] This application uses METAL software to combine the weights of the GWAS results of the five groups for meta-analysis. Based on the METAL software, the effect direction and result P value of the target group are converted into Z-scores. The calculation formula of the Z-test statistic (Z-scores) is as follows:

[0048]

[0049] Where Pi is the P value of the i-th group, Δi represents the effect direction of the i-th group, and Ni is the sample size of the i-th group.

[0050] (5) Marker screening

[0051] The results of the meta-analysis were processed and the false discovery rate (FDR) method was used to correct the results. The FDR was set to 0.01 and the threshold formula was:

[0052] P=FDR×n / m

[0053] Among them, FDR is set to 0.01, n is the number of sites with a P value less than 0.01 in the GWAS results, and m is the total number of SNP sites after quality control.

[0054] Draw a Manhattan plot for the effect values ​​of all the above markers to display and filter SNP markers below the threshold line. The results are as follows Figure 1 and 2 shown.

[0055] Example 2: Effect of different genotypes on the number of nipples in sows

[0056] Draw a Manhattan plot for the effect values ​​of all markers, and display and filter SNP markers below the threshold line ( Figure 1-2 ):like Figure 1 As shown in , two SNP molecular markers related to the nipple number trait were screened on chromosome 14, denoted as yz_rs329085302 and rs320468838; Figure 2 As shown in , a SNP molecular marker related to the nipple number trait was screened on chromosome 14, recorded as yz_rs325631013. ANOVA and multiple comparisons (R statistical analysis platform) were used to analyze the differences in the number of left nipples, right nipples, and total nipples of pigs in different genotype groups (Tables 1 to 3). The specific results are as follows:

[0057] 1. Analysis of the nucleotide sequence of the yz_rs329085302 molecular marker locus and papillary traits of different genotypes

[0058] The yz_rs329085302 molecular marker was found in Ensembl (Sscrofa11.1) and is located at 54971936bp of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version, which is a C>T mutation. The nucleotide sequence of the 100bp upstream and downstream of the SNP marker is shown in SEQ ID No: 1, where the 101st position M(C / T) Indicates a C>T base mutation:

[0059] GCTGGYGTGTGTCACCAGGCACCRTGCCAGACTCATTTCTTGKATTTT

[0060] CACAATGCCCTGGGAGGCAGATGGGACATGAAACCCTGACACKGTCT YRCTG M(C / T) RCTTGAGTCTCTSCTATTTGCCCCACTGGCCAGCATCCC ATATTCTGGAAGCTTCTTAAGCAGGCTTTCATCYGGAGGTCTGTGACC CAACCACTCGGGT (SEQ ID No: 1).

[0061] Through the nucleotide sequence, primers or probes can be designed to detect the genotype of the SNP molecular marker at the yz_rs329085302 site, and then the sow nipple number trait can be further selected based on the test results; or primers can be designed through the nucleotide sequence to make corresponding detection kits that are directly used for the detection of the SNP molecular marker at the pig yz_rs329085302 site, and then the sow nipple number trait can be selected based on the detected genotype.

[0062] This molecular marker can be used as a molecular marker for detecting the trait related to the number of teats in sows, and when the 101st nucleotide in the above sequence is T, the sows may have more teats. The results are shown in Table 1:

[0063] Table 1. The number of nipples in different genotypes of sows marked by yz_rs329085302

[0064]

[0065] Note: P<0.05 indicates significant difference; P<0.01 indicates extremely significant difference.

[0066] As shown in the results in Table 1, the number of left nipples, right nipples, and total nipples of the TT genotype of the yz_rs329085302 marker is 0.12, 0.17, and 0.29 more than that of the CC genotype. Moreover, the number of left nipples, right nipples, and total nipples in the TT genotype are significantly higher (P<0.01) than those in the CC and CT genotypes, but the difference between the CC and CT genotypes is not significant. Therefore, TT is the dominant genotype, T is the dominant allele, and the T allele can significantly increase the number of nipples. Therefore, when the allele of the yz_rs329085302 molecular marker is T, the breeding pig may have more nipples and should be retained, while the C allele should be eliminated.

[0067] 2. Analysis of the nucleotide sequence of the rs320468838 molecular marker site and papillary traits of different genotypes

[0068] The rs320468838 marker was found in Ensembl (Sscrofa11.1) and was located at 54972009 bp of chromosome 14 of the pig genome EnsemblSscrofa11.1 version. The position was a T>C mutation, which was less than 100 bp away from the yz_rs329085302 marker. The nucleotide sequence of the 100 bp upstream and downstream was shown in SEQ ID No: 2, wherein the 101st position was M(T / C) Indicates T>C mutation: ACATGAACCCTGACACKGTCTYRCTGYRCTTGAGTCTCTSCTATTTG CCCCACTGGCCAGCATCCCATATTCTGGAAGCTTCTTAAGCAGGCTTT CATC M(T / C) GGAGGTCTGTGACCCAACCACTCGGGTATGTACTAAAAC ATRGGYTTATGGACCTGACCCTAGACTCACTACATCCTAATTTCAGAGTAGCAGCGCCCAG (SEQ ID No: 2).

[0069] Through the nucleotide sequence, primers or probes can be designed to detect the genotype of the SNP molecular marker at the rs320468838 site, and then the sow nipple number trait can be further selected based on the test results; or primers can be designed through the nucleotide sequence to make corresponding detection kits that are directly used for the detection of the SNP molecular marker at the rs320468838 site of pigs, and then the sow nipple number trait can be selected based on the detected genotype.

[0070] This molecular marker can be used as a molecular marker for detecting the trait related to the number of teats in sows, and when the 101st nucleotide in the above sequence is T, the sows may have more teats. The results are shown in Table 2:

[0071] Table 2 Traits of nipple number in different genotypes of sows with rs320468838 marker

[0072]

[0073] As shown in the results in Table 2, the rs320468838 marker TT genotype has 0.12, 0.17, and 0.29 more left nipples, right nipples, and total nipples than the CC genotype. Moreover, the number of left nipples, right nipples, and total nipples in the TT genotype are significantly higher (P<0.01) than those in the CC and CT genotypes, but there is no significant difference between the CC and CT genotypes. Therefore, TT is the dominant genotype, T is the dominant allele, and the T allele significantly increases the number of nipples. Therefore, when the allele of the rs320468838 molecular marker is T, the breeding pig may have more nipples and should be retained, while the C allele should be eliminated.

[0074] 3. Analysis of the nucleotide sequence of the yz_rs325631013 molecular marker locus and papillary traits of different genotypes

[0075] The yz_rs325631013 marker is located at 48300187bp position of chromosome 14 of the pig genome EnsemblSscrofa11.1 version, and the position is a C>G mutation. The nucleotide sequence of 100bp upstream and downstream of the SNP marker is shown in SEQ ID No:3, where the 101st position M(C / G) Indicates a C>G mutation:

[0076] GGGCCCTAACCTAAGGGACCACAGCTTCTGTCCCTTCAGGTGCAGG

[0077] CAAAGACATTCATCTTGTTAGCAAAGGAATAGGTTGTTGGGCAGCCTC CTCCT M(C / G) CCCCAGACCTGTTGGTTCTCCCCACTTGTCCTGTTACC AGAACAGGTACCCTCTTGGAAACTCATTTTTTTGTGACCTGGCCCCT GCCCCATCCCTGC (SEQ ID No: 3).

[0078] Through the nucleotide sequence, primers or probes can be designed to detect the genotype of the SNP molecular marker at the yz_rs325631013 site, and then the sow nipple number trait can be further selected based on the test results; or primers can be designed through the nucleotide sequence to make corresponding detection kits that are directly used for the detection of the SNP molecular marker at the pig yz_rs325631013 site, and then the sow nipple number trait can be selected based on the detected genotype.

[0079] This molecular marker can be used as a molecular marker for detecting the trait related to the number of teats in sows, and when the 101st nucleotide in the above sequence is C, the sows may have more teats. The results are shown in Table 3:

[0080] Table 3. The number of nipples in different genotypes of sows with marker yz_rs325631013

[0081]

[0082]

[0083] As shown in the results in Table 3, the CC genotype of the yz_rs325631013 marker has 0.18, 0.12, and 0.30 more left nipples, right nipples, and total nipples than the GG genotype. Moreover, the number of left nipples, right nipples, and total nipples in the CC genotype are significantly higher (P<0.01) than those in the CG and GG genotypes, but the difference in the number of right nipples and total nipples between the CG and GG genotypes is not significant. Therefore, CC is the dominant genotype, C is the dominant allele, and the C allele significantly increases the number of nipples. Therefore, when the allele of the yz_rs325631013 molecular marker is C, the breeding pig may have more nipples and should be retained, while the allele G should be eliminated.

[0084] Example 3: Application of SNP molecular markers in breeding sow strains with multiple nipples

[0085] 1) Detect one or more of the three SNP molecular markers yz_rs329085302, rs320468838, and yz_rs325631013 in gilts;

[0086] 2) selecting individuals with TT genotype at the yz_rs329085302 and rs320468838 loci alleles detected in step 1), or selecting individuals with CC genotype at the yz_rs325631013 locus alleles, as sows for breeding, and breeding the sows for breeding;

[0087] 3) The above-mentioned SNP molecular markers are detected in the piglets born from the mating in step 2), and the piglets are kept according to the genotype described in step 2), and then bred to cultivate a sow strain with a high nipple number trait.

[0088] Example 4: Application of SNP molecular markers in improving the number of teats in sows

[0089] 1) Detect one or more of the three SNP molecular markers yz_rs329085302, rs320468838, and yz_rs325631013 in gilts;

[0090] 2) selecting individuals with TT genotype at the yz_rs329085302 and rs320468838 loci alleles detected in step 1), or selecting individuals with CC genotype at the yz_rs325631013 locus alleles, as sows for breeding, and breeding the sows for breeding;

[0091] 3) The above-mentioned SNP molecular markers are detected in the piglets born from the mating in step 2), and the seeds are kept according to the genotypes as described in step 2), and then bred to retain the individuals with the dominant genotype in the offspring pigs, and eliminate other genotypes to increase the frequency of the dominant allele from generation to generation, thereby improving the nipple number trait of the sow group and improving the nipple number of the offspring sows.

Claims

1. A SNP molecular marker associated with the number of pig nipples, wherein: The SNP molecular marker is a C>T mutation located at the 54971936bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version; or a T>C mutation located at the 54972009bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version; or a C>G mutation located at the 48300187bp position of chromosome 14 of the pig genome Ensembl Sscrofa11.1 version.

2. Use of the SNP molecular marker described in claim 1 in improving the nipple number trait of sows.

3. Use of the SNP molecular marker described in claim 1 in breeding sow strains with a high number of nipples.

4. The use according to claim 3, wherein: The application method comprises the following steps: 1) Detecting the SNP molecular markers as described in claim 1 in gilts; 2) selecting an individual with the TT genotype at the 54971936bp position detected in step 1) as a sow for breeding, and breeding the sow for breeding; Or selecting an individual with the TT genotype at the 54972009bp position detected in step 1) as a breeding sow, and breeding the breeding sow; or selecting an individual with the CC genotype at the 48300187bp position detected in step 1) as a breeding sow, and breeding the breeding sow; 3) The piglets born from mating in step 2) are tested for the SNP molecular markers as described in claim 1, and the piglets are kept according to the genotypes as described in step 2), and then bred to cultivate a sow strain with a large number of nipples.

5. Use of the SNP molecular marker described in claim 1 in improving the nipple number trait of sows.

6. The use according to claim 5, wherein: The application comprises the following steps: 1) Detecting the SNP molecular markers as described in claim 1 in gilts; 2) selecting an individual with the TT genotype at the 54971936bp position detected in step 1) as a sow for breeding, and breeding the sow for breeding; Or selecting an individual with the TT genotype at the 54972009bp position detected in step 1) as a breeding sow, and breeding the breeding sow; or selecting an individual with the CC genotype at the 48300187bp position detected in step 1) as a breeding sow, and breeding the breeding sow; 3) The SNP molecular markers as described in claim 1 are detected in the piglets born from the mating in step 2), and the piglets are kept according to the genotypes as described in step 2), and then bred to retain the individuals with the dominant genotype in the offspring pigs and eliminate other genotypes to increase the frequency of the dominant allele from generation to generation, thereby improving the nipple number trait of the sow group and improving the nipple number of the offspring sows.

7. The use according to any one of claims 2 to 6, wherein: The sow is a Large White or Landrace sow.

8. Use of the SNP molecular marker described in claim 1 in detecting / screening / identifying the nipple number trait of sows.

9. A nucleotide sequence containing a SNP molecular marker associated with the pig nipple number trait, wherein: The sequence contains the nucleotide sequence shown in SEQ ID No: 1, and M in the sequence represents a C>T base mutation; or the sequence contains the nucleotide sequence shown in SEQ ID No: 2, and M in the sequence represents a T>C base mutation; or the sequence contains the nucleotide sequence shown in SEQ ID No: 3, and M in the sequence represents a C>G base mutation.

10. Use of the nucleotide sequence described in claim 9 in the preparation of a SNP molecular marker product for detecting / screening / identifying SNPs associated with the trait of pig teat number.

Images