Plant T-to-G base editor

Abstract

The invention belongs to the field of variation or genetic engineering, and discloses a T-to-G base editor for plants. The technical problem to be solved by the invention is how to realize T-to-G base editing in plants. The base editor for the plant from T to G disclosed by the invention contains a Cas protein and uracil DNA glycosylase, wherein the amino acid sequence of the uracil DNA glycosylase is 20th to 244th sites of SEQ ID No.2. The invention also discloses a preparation method of the base editor for the plant from T to G. Experiments prove that the base editor provided by the invention realizes targeted T-to-G editing with base editing efficiency as high as 78.05%, not only can solve the limitation that T direct editing cannot be realized in a rice genome, but also can induce exon jumping to obtain a required mature transcript. The base editor provided by the invention widens the targeting range of the base editor, and can also be applied to expression regulation of genes.

Description

Technical Field

[0001] The present invention belongs to the field of mutation or genetic engineering, and specifically relates to a base editor for plant T to G. Background Art

[0002] Base editors achieve high-precision and high-efficiency single-base editing, providing powerful tools for fields such as life sciences and medicine, and greatly promoting the research of plant functional genomics and crop improvement. So far, two major types of base editors have been developed: deaminase-based base editors (dBE) and glycosylase-based base editors (gBE). All dBE base conversions require deamination of adenine (A) or cytosine (C) as the first key step. In recent years, some researchers have also developed base editors that can directly edit guanine (G) based on the evolved human N-methylpurine DNA glycosylase (MPG). In plants, the evolving DNA base editors have achieved direct editing of adenine (A), cytosine (C) and guanine (G), but there are no base editors directly used for thymine (T). Because thymine (T) lacks an amino group and cannot be deaminated to achieve base conversion, the development of its base editors still faces challenges. Summary of the invention

[0003] The technical problem to be solved by the present invention is how to achieve base editing from T to G in plants, especially rice.

[0004] To solve the above technical problems, the present invention first provides a protein, which is a base editor for plant T to G (its name is TGBE or TGBE-VP64), which contains Cas protein and uracil DNA glycosylase, and the uracil DNA glycosylase is shown in positions 20-244 of SEQ ID No.2.

[0005] The Cas protein refers to an RNA-guided nuclease comprising a Cas9 protein or a fragment thereof (e.g., a protein comprising an active, inactive or partially active DNA cleavage domain of Cas9, and / or a gRNA binding domain of Cas9), which may be an nCas9 protein, such as nCas9 (D10A). The nCas9 protein may be as shown in positions 277-1643 of SEQ ID No. 2.

[0006] The above-mentioned base editor can be a protein formed by connecting the uracil DNA glycosylase, the Cas protein and the nuclear localization signal.

[0007] The nuclear localization signal may be a bipartite nuclear localization sequence (bpNLS), such as the bipartite nuclear localization sequence shown at positions 1-19 and 1648-1664 of SEQ ID No.2.

[0008] The uracil DNA glycosylase, the Cas protein and the nuclear localization signal can be directly connected or connected through a common connecting peptide, as long as it does not affect the function of the base editor. In an embodiment of the present invention, the connecting peptide is 245-276 and 1644-1647 of SEQ ID No.2.

[0009] Specifically, the base editor can be A1) the protein shown in SEQ ID No.2, or A2) a protein having the same function by replacing and / or deleting and / or adding one or several amino acid residues in the amino acid sequence shown in SEQ ID No.2 in the sequence list, or A3) a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of A1) or A2).

[0010] The protein in A2) above is a protein having 75% or more identity with the amino acid sequence of the protein shown in SEQ ID No.2 and having the same function. Identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default value) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be calculated, and then the identity value (%) can be obtained. The 75% or greater identity may be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% greater identity.

[0011] The protein in A2) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0012] The coding gene of the protein in A2) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID No.1, and / or performing missense mutation of one or several base pairs, and / or attaching a coding sequence of a tag at its 5′ end and / or 3′ end. The DNA molecule shown in SEQ ID No.1 encodes the TGBE protein shown in SEQ ID No.2.

[0013] The above-mentioned base editor may also contain VP64 protein, and the VP64 protein is shown at positions 20-69 of SEQ ID No.4.

[0014] The above-mentioned base editor can be a protein formed by connecting the VP64 protein, the uracil DNA glycosylase, the Cas protein and the nuclear localization signal.

[0015] The VP64 protein, the uracil DNA glycosylase, the Cas protein and the nuclear localization signal can be connected directly or through a common connecting peptide, as long as the function of the base editor is not affected.

[0016] Specifically, the base editor can be C1) a protein shown in SEQ ID No.4, or C2) a protein having the same function by replacing and / or deleting and / or adding one or several amino acid residues in the amino acid sequence shown in SEQ ID No.4 in the sequence list, or C3) a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of C1) or C2).

[0017] The protein in C2) is a protein having 75% or more identity with the amino acid sequence of the protein shown in SEQ ID No. 4 and having the same function. The 75% or more identity may be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more identity.

[0018] The protein in C2) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0019] The coding gene of the protein in C2) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID No.3, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of the tag at its 5′ end and / or 3′ end. The DNA molecule shown in SEQ ID No.3 encodes the TGBE-VP64 protein shown in SEQ ID No.4.

[0020] The tag in A3) and C3) can be a polypeptide or protein fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag and / or SUMO tag, etc.

[0021] In the above, the connection refers to the connection between proteins or polypeptides through a peptide bond formed by an amino acid residue at the C-terminus of one protein or polypeptide and an amino acid residue at the N-terminus of another protein or polypeptide.

[0022] The present invention also provides a biological material related to the base editor, wherein the biological material is at least one of the following B1) to B7): B1) a nucleic acid molecule encoding the base editor; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) a transgenic plant cell line containing the nucleic acid molecule described in B1), a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6) transgenic plant tissue containing the nucleic acid molecule described in B1), transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7) A transgenic plant organ containing the nucleic acid molecule described in B1), a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3).

[0023] In the above biological material, the nucleic acid molecule described in B1) may be the following: b11) or b12) or b13): b11) Coding sequence (CDS) is a DNA molecule whose nucleotide sequence is SEQ ID No. 1 in the sequence list; b12) The coding sequence is a DNA molecule whose nucleotide sequence is SEQ ID No. 3 in the sequence list; b13) A DNA molecule that has 75% or more identity with the nucleotide sequence defined in b11) or b12) and encodes the base editor.

[0024] b11) The DNA molecule may be a DNA molecule whose nucleotide sequence of the coding strand is SEQ ID No. 1 in the sequence list. b12) The DNA molecule may be a DNA molecule whose nucleotide sequence of the coding strand is SEQ ID No. 3 in the sequence list.

[0025] Those skilled in the art can easily mutate the nucleotide sequence encoding TGBE or TGBE-VP64 of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of TGBE or TGBE-VP64 of the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode TGBE or TGBE-VP64 and have the function of TGBE or TGBE-VP64.

[0026] The term "identity" as used herein refers to sequence similarity with a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of the present invention encoding the protein consisting of the amino acid sequence shown in SEQ ID No.2 or SEQ ID No.4. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0027] Specifically, the above-mentioned 75% or more identity may be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more identity.

[0028] In the above-mentioned biological material, the expression cassette refers to a DNA capable of expressing TGBE or TGBE-VP64 in a host cell (such as a plant cell), and the DNA may include not only a promoter for initiating transcription of the TGBE or TGBE-VP64 gene, but also a terminator for terminating transcription of the TGBE or TGBE-VP64 gene. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the Ubiquitin promoter of corn, the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP"); the chemically inducible promoter from tobacco, pathogenesis-related protein 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); the tomato proteinase inhibitor II promoter (PIN2) or the LAP promoter (both inducible by methyl jasmonate); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 2007 1 0099169.7)), seed storage protein-specific promoters (e.g., phaseolusin, napin, oleosin and soybean beta conglycin) promoters. They can be used alone or in combination with other plant promoters. All references cited herein are cited in their entirety. Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators.

[0029] In one embodiment of the present invention, the expression of TGBE or TGBE-VP64 gene is driven by the ZmUBI promoter.

[0030] In the above biological materials, the vector may be a plasmid, a cosmid, a phage or a virus vector.

[0031] B3) The recombinant vector may specifically be pTGBE or pTGBE-VP64. pTGBE is a recombinant vector obtained by replacing the DNA fragment between the KpnI and SpeI recognition sequences of the rABE8e vector (containing bpNLS, TadA8e V106W, 32aa linker and the coding gene of nCas9) with the TGBE gene shown in SEQ ID No. 1. pTGBE contains the DNA molecule of sgRNA and the TGBE gene, the transcription of sgRNA is driven by the OsU6 promoter, and the expression of the TGBE gene is driven by the ZmUBI promoter.

[0032] pTGBE-VP64 is a recombinant vector obtained by replacing the DNA fragment between the KpnI and SpeI recognition sequences of the rABE8e vector (containing bpNLS, TadA8e V106W, 32aa linker, and the coding gene of nCas9) with the TGBE-VP64 gene shown in SEQ ID No. 3. pTGBE-VP64 contains the DNA molecule of sgRNA and the TGBE-VP64 gene. The transcription of sgRNA is driven by the OsU6 promoter, and the expression of the TGBE-VP64 gene is driven by the ZmUBI promoter.

[0033] In the above biological materials, the microorganism can be yeast, bacteria, algae or fungi. Among them, the bacteria can be Agrobacterium, such as Agrobacterium EHA105.

[0034] Among the above-mentioned biological materials, the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs may or may not include propagation materials.

[0035] The present invention also provides a method for base editing from T to G in plants, the method comprising: introducing the coding gene of the base editor (or its expression box) and the DNA molecule of sgRNA (or its expression box) into the target plant, and expressing / transcribing the base editor and sgRNA, screening T to G editing plants or tissues in the target sequence, and realizing T to G base editing in plants.

[0036] The base editor encoding gene (or its expression box) and the DNA molecule (or its expression box) of the sgRNA targeting the target sequence can be introduced into the target plant through the same vector or through different vectors.

[0037] In an embodiment of the present invention, the expression cassette of the base editor and the expression cassette of the sgRNA targeting the target sequence are introduced into the target plant through pTGBE or pTGBE-VP64.

[0038] The target sequence of the sgRNA is 5′-N19-20 PAM-3′, the N 19-20 The N is 19-20 Ns, the PAM (protospacer adjacent motif) is NGG, and the N is A, G, C or T.

[0039] The present invention also provides the use of the base editor or the biological material in base editing or in the preparation of a base editing product (reagent or kit), wherein the base editing is editing from T to G or T to C (or insertion or deletion) in plants.

[0040] The present invention also provides any of the following applications: X1) Application of the base editor in regulating gene expression by alternative splicing in plants; X2) Use of the base editor in preparing a product (reagent or kit) for regulating gene expression by selective splicing in plants; X3) Application of the biological material in regulating gene expression by alternative splicing in plants; X4) Use of the biological material in the preparation of products (reagents or kits) for regulating gene expression by selective splicing in plants.

[0041] In the present invention, the T to G or T to C base editing can be the editing of T at any of positions 2-12, 14 and 18 in the target sequence, specifically, it can be the editing of T at position 3, 4 or 5 in the target sequence.

[0042] The position in the target sequence is determined based on the PAM sequence. The first position of the target sequence farthest from the PAM sequence is recorded as position 1, and positions 2, 3, etc. gradually move closer to the PAM sequence.

[0043] In the present invention, the T to G or T to C base editing is base editing in the target sequence whose PAM sequence is NGG.

[0044] In the present invention, the plant may be M1) or M2) or M3): M1) monocots or dicots; M2) Gramineae; M3) Rice.

[0045] Experiments have shown that the base editor of the present invention achieves targeted T to G editing with a base editing efficiency of up to 78.05%, which solves the limitation that direct T editing cannot be achieved in the rice genome and broadens the targeting range of the base editor. At the same time, by using the base editor of the present invention to accurately target the T bases in the splice donor site (SD) and the splice acceptor site (SA) of the pre-mRNA, exon skipping is successfully induced to obtain the desired mature transcript. This not only highlights the ability of TGBE in regulating gene expression diversity, but also significantly broadens the scope of application of base editors.

[0046] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0047] The term "base editor (BE)" refers to a reagent comprising a polypeptide that is capable of modifying a base (e.g., A, T, C, G, or U) within a nucleic acid (e.g., DNA or RNA).

[0048] The term "nuclear localization sequence" or "NLS" refers to an amino acid sequence that facilitates the import of a protein into the cell nucleus (eg, by nuclear transport).

[0049] The term "promoter" refers to a control region of a nucleic acid sequence that controls the initiation and transcription rate of the remainder of the nucleic acid sequence. A promoter may also contain subregions to which regulatory proteins and molecules (such as RNA polymerase and other transcription factors) may bind.

[0050] The terms "nucleic acid" and "nucleic acid molecule" refer to a compound comprising a nucleobase and an acidic moiety (e.g., a nucleoside, a nucleotide, or a polymer of nucleotides). Typically, a polymeric nucleic acid, such as a nucleic acid molecule comprising three or more nucleotides, is a linear molecule in which adjacent nucleotides are linked to each other via phosphodiester linkages.

[0051] The terms "protein", "peptide" and "polypeptide" are used interchangeably herein and refer to a polymer of amino acid residues linked together by peptide (amide) bonds. The term refers to proteins, peptides or polypeptides of any size, structure or function. Typically, a protein, peptide or polypeptide will be at least three amino acids long. A protein, peptide or polypeptide may refer to an individual protein or a collection of proteins. One or more amino acids in a protein, peptide or polypeptide may be modified, for example by adding chemical entities such as carbohydrate groups, hydroxyl groups, phosphate groups, farnesyl groups, isofarnesyl groups, fatty acid groups, joints for conjugation, functionalization or other modifications, etc. A protein, peptide or polypeptide may also be a single molecule or may be a multimolecular complex. A protein, peptide or polypeptide may be only a fragment of a naturally occurring protein or peptide. A protein, peptide or polypeptide may be naturally occurring, recombinant or synthetic, or any combination thereof. The term "fusion protein" as used herein refers to a hybrid polypeptide comprising protein domains from at least two different proteins. A protein may be located at the amino terminal (N-terminal) portion of a fusion protein or a carboxyl terminal (C-terminal) protein, thereby forming an "amino terminal fusion protein" or a "carboxyl terminal fusion protein", respectively. The protein can comprise different domains, such as a nucleic acid binding domain (e.g., the gRNA binding domain of Cas9 that guides the protein to bind to the target site) and a nucleic acid cleavage domain or a catalytic domain of a nucleic acid editing protein.

[0052] The term "RNA-guided nuclease" refers to a nuclease that forms a complex (e.g., binds or associates) with one or more RNAs that are not cleavage targets. Typically, the bound RNA is referred to as a guide RNA (gRNA). The gRNA can exist as a complex of two or more RNAs or as a single RNA molecule. A gRNA that exists as a single RNA molecule can be referred to as a single guide RNA (sgRNA).

[0053] RNA-guided nucleases such as Cas9 use RNA:DNA hybridization to target DNA cleavage sites, so these proteins can in principle be targeted to any sequence specified by the guide RNA.

[0054] The term "target site" refers to the binding location of the base editor in the plant genome under the guidance of sgRNA.

[0055] The term "recombinant" refers to a protein or nucleic acid that does not occur in nature but is the product of human engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 Schematic diagram of key fragments of pTGBE and pTGBE-VP64 in Example 1. ∨: 1-88 amino acids of human UNG2 truncation.

[0057] Figure 2 . Experimental results of Example 1. (a) Summary of the editing efficiency of endogenous genes in about 250 positive calli per transformation by TGBE. (b) Summary of the editing efficiency of endogenous genes in about 250 positive calli per transformation by TGBE-VP64. (c) Summary of the editing efficiency of endogenous genes in stable T0 transgenic plants by TGBE. In the "Target sequence (PAM)" column, red fonts indicate the T that has been detected to have undergone base editing; "Stable editing in T0 plants" is the editing efficiency. The numbers in brackets in each column indicate the number of T0 plants with at least one T edited in the target sequence on the left side of " / ", and the number of T0 plants detected on the right side. (d) Average frequency of T conversion by TGBE at editing sites 1-20 (where PAM is located at positions 21-23). ​​(e, f, g) The frequency of C (e), G (f), and A (g) conversion by TGBE at editing sites 1-20 (where PAM is located at positions 21-23) in Figure (c). In the figure, pTGBE represents the base editor TGBE.

[0058] Figure 3 . Experimental results of Example 1. (a) TGBE in Figure 2 (c) The percentage of editing purity for T to G conversion at different targeted sites. (b) The principle of using TGBE base editor to achieve alternative splicing leading to exon skipping. (c) TGBE-induced SA site disruption leads to OsARF24 Schematic diagram of exon 8 skipping. (d) Targeted editing using TGBE OsARF24 First-generation sequencing chromatogram of T0 plant at the SA site of exon 8. (d) #44 is the number of one of the T0 plants. (e) Targeted editing using TGBE OsPDS T0 plants produced albino phenotype. (f) Targeted editing using TGBE OsPDS The first generation sequencing chromatogram of the T0 plant and the schematic diagram of the amino acid change caused by the conversion from T to G. #6 in (e)-(f) is the number of one of the T0 plants. (g) Schematic diagram of using the currently available base editors in rice (indicated by the arrows between each base) to achieve the required base conversion. In the figure, pTGBE represents the base editor TGBE. DETAILED DESCRIPTION

[0059] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. The quantitative tests in the following examples were all repeated at least three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0060] The rABE8e vector in the following embodiments is the binary plant expression vectors rABE8e-NGG in the literature (Wei, C., Wang, C., Jia, M., Guo, HX, Luo, PY, Wang, MG, Zhu, JK, and Zhang, H. (2021). Efficient generation of homozygous substitutions in rice in one generation utilizing an rABE8e base editor. J. Integr. Plant Biol. 63: 1595–1599.) (see the attachment of the literature). The public can obtain the biological material from the applicant. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0061] Example 1: Base editor TGBE can be used for editing T to G in rice In this example, a thymine (T) base editor was established in rice, named TGBE. The human uracil DNA glycosylase variant UNG2Δ88-Y156A / A214T / Q259A / Y284D (mhUNGv3) was fused with Cas9 nickase (nCas9) and connected using a 32-amino acid linker (LINKER). In order to improve the efficiency of entering the cell nucleus, the fusion bipartite nuclear localization sequence (bpNLS) was fused with mhUNGv3 to form TGBE ( Figure 1 ), TGBE can achieve T to G base editing in rice.

[0062] 1. Construction of recombinant vector The DNA fragment between the KpnI and SpeI recognition sequences of the rABE8e vector (containing bpNLS, TadA8e V106W, 32aa linker, and the coding gene of nCas9) was replaced with the TGBE gene to obtain the recombinant vector pTGBE, which contains the DNA sequence of sgRNA and the TGBE gene. The transcription of sgRNA is driven by the OsU6 promoter, and the expression of the TGBE gene is driven by the ZmUBI promoter ( Figure 1 ).

[0063] The TGBE gene is shown in SEQ ID No.1, and encodes the TGBE fusion protein shown in SEQ ID No.2.

[0064] In SEQ ID No.1, positions 1-57 and positions 4942-4992 represent the bipartite nuclear localization DNA sequence, positions 58-732 represent the rice codon-optimized mhUNGv3 gene, positions 733-828 represent the coding DNA of the connecting peptide, positions 829-4929 represent the nCas9 gene, and positions 4930-4941 represent the coding DNA of the connecting peptide.

[0065] In SEQ ID No. 2, positions 1-19 and positions 1648-1664 represent the bipartite nuclear localization sequence, positions 20-244 represent the mhUNGv3 protein, positions 245-276 represent the linker peptide (LINKER), positions 277-1643 represent the nCas9 protein, and positions 1644-1647 represent the linker peptide.

[0066] The DNA fragment between the KpnI and SpeI recognition sequences of the rABE8e vector (containing bpNLS, TadA8e V106W, 32aa linker, and the coding gene of nCas9) was replaced with the TGBE-VP64 gene to obtain the recombinant vector pTGBE-VP64, which contains the DNA sequence of sgRNA and the TGBE-VP64 gene. The transcription of sgRNA is driven by the OsU6 promoter, and the expression of the TGBE-VP64 gene is driven by the ZmUBI promoter ( Figure 1 ).

[0067] The TGBE-VP64 gene is shown in SEQ ID No.3, and encodes the TGBE-VP64 fusion protein shown in SEQ ID No.4.

[0068] In SEQ ID No.3, positions 1-57 and positions 5188-5238 represent the bipartite nuclear localization DNA sequence, positions 58-207 represent the VP64 gene, positions 208-303 represent the coding DNA of the connecting peptide, positions 304-978 represent the mhUNGv3 gene optimized by rice codons, positions 979-1074 represent the coding DNA of the connecting peptide, positions 1075-5175 represent the nCas9 gene, and positions 5176-5187 represent the coding DNA of the connecting peptide.

[0069] In SEQ ID No.4, positions 1-19 and positions 1730-1746 represent the bipartite nuclear localization sequence, positions 20-69 represent the VP64 protein, positions 70-101 represent the linker peptide (LINKER), positions 102-326 represent the mhUNGv3 protein, positions 327-358 represent the linker peptide (LINKER), positions 359-1725 represent the nCas9 protein, and positions 1726-1729 represent the linker peptide.

[0070] Constructing a target gene targeting rice ( OsNRT1.1B , OsARF24 , OsPDS , oeLh and OsSLR1) sgRNA expression vector: A 23-nucleotide targeting sequence (including the PAM sequence) was selected and analyzed using CRISPR-P. The 20-nucleotide Spacer sequence (target sequence) was cloned and inserted into the pTGBE vector or the pTGBE-VP64 vector using the Golden Gate method. The resulting recombinant vector is the sgRNA expression vector. The resulting vector can transcribe sgRNA targeting each target point in the rice gene and express TGBE fusion protein or TGBE-VP64 fusion protein.

[0071] The target sequences used in pTGBE are as follows: OsNRT1.1B The three targets and targeting sequences of the gene are: target SG1, targeting sequence ACTAGATATCTAAACCATTAAGG (SEQ ID No.5); target SG2, targeting sequence AGACTTGGATCTTGCAGTGGCGG (SEQ ID No.6); target SG3, targeting sequence TGCTAGTTTCCACTGGAGAAAGG (SEQ ID No.7); OsARF24The three targets and targeting sequences of the gene are: target SG1, targeting sequence GTGGTGGTGAGTGCTCGTGTGGG (SEQ ID No. 8); target SG2, targeting sequence ACCTCTATTCATGTAATAAAAGG (SEQ ID No. 9); target SG3, targeting sequence AATTCACTACATAGACAGATGGG (SEQ ID No. 10); OsPDS The two targets and targeting sequences of the gene are: target SG1, targeting sequence ACATTGCCTGCACCCTTAAATGG (SEQ ID No. 11); target SG2, targeting sequence AGGATTAGCTGGTTTATCAACGG (SEQ ID No. 12); OsSLR1 One target site and targeting sequence of the gene are: target site SG1, targeting sequence CGAGTAGCACCTACGCCCTCAGG (SEQ ID No. 13); oeLh A target site and a targeting sequence of the gene are: target site SG1, targeting sequence GCGTCACGTTCCACAAGGCCAGG (SEQ ID No. 14).

[0072] 2. Agrobacterium-mediated genetic transformation of rice and genotype identification Xiushui 134 rice variety was used as the target plant. After inducing callus tissue from its seeds, the sgRNA expression vectors obtained in step 1 were introduced into EHA105 Agrobacterium (Weidi Biotechnology) respectively, and the rice was genetically transformed using the Agrobacterium-mediated rice genetic transformation method to obtain hygromycin B-resistant callus tissue, which was further cultured to obtain T0 generation transgenic plants.

[0073] For each vector, approximately 250 hygromycin B-resistant calli were selected and mixed to extract genomic DNA. Primers were designed upstream and downstream of the target sequence to amplify the target sequence and perform Hi-TOM sequencing to evaluate the mutation frequency. In order to genotype the T0 generation transgenic plants, genomic DNA was extracted from the leaves. The target site was amplified using two rounds of PCR and analyzed by next-generation sequencing (NGS). In the Hi-TOM test, the editing efficiency was determined with a threshold of 10%.

[0074] 3. Results To study the editing properties of TSBE at endogenous loci in rice, the inventors selected five genes ( OsNRT1.1B , OsARF24 , OsPDS , oeLh and OsSLR1)A total of 10 targets were used to test editing activity and editing window ( Figure 2 (c)). Genomic DNA was extracted from approximately 250 positive calli for each transformation and analyzed by Hi-TOM. Sequencing of the target site showed that the T to S base conversion efficiency (i.e., base editing efficiency, which is defined as the proportion of T to S detected in Hi-TOM sequencing of the target gene site) in the positive calli was as high as 36.98% (ranging from 2.34% to 36.98%) ( Figure 2 The results also showed that TSBE induced insertion or deletion mutations (InDel) at 10 editing sites, with frequencies ranging from 1.20% to 61.98%.

[0075] To further evaluate the performance of TSBE in stable transgenic rice, the inventors selected 5 genes in 10 targeted rice ( OsNRT1.1B , OsARF24 , OsPDS , oeLh and OsSLR1 ) endogenous sites to test editing activity and editing window. A total of 401 T0 plants were obtained and analyzed by Hi-TOM. Sequencing of the targets (13 to 78 T0 plants per target site) showed that the T to S base conversion efficiency (i.e., base editing efficiency, which is defined as the percentage of T0 plants with at least one T edited to S in the target sequence to the total number of T0 plants tested) in transgenic rice plants was as high as 78.05% (range 8.57% to 78.05%). Figure 2 (c)), but there is almost no editing of C or G, and the editing efficiency of A is only 1.85% ( Figure 2 (e) -(g)). It was further found that TSBE induced insertion or deletion mutations (InDel) at 10 editing sites, with frequencies ranging from 20% to 74.36% ( Figure 2 (c)). It is noteworthy that the proportion of T to G editing in the product (average 39.31%, maximum 78.05%) is 13.46 times higher than the proportion of T to C editing (average 2.92%, maximum 3.7%). T to G is the main type of editing produced by TSBE in rice, and its purity (the percentage of T to G editing plants to the total number of T base editing plants) exceeds 80% ( Figure 3 (a) shows a different editing pattern from that in mammalian cells. Therefore, the inventors named the base editor plant T to G base editor, abbreviated as TGBE, to better reflect its editing characteristics. Further analysis found that the editable range of TGBE is positions 2-12, 14 and 18, among which the best editing window for T conversion covers positions 3-5, and the editing efficiency of position 3 is the highest ( Figure 2In contrast, gTBE in mammalian cells typically produces T to S base transitions at positions T2-T11, with an optimal editing window at T5.

[0076] PDS is a key enzyme in the carotenoid biosynthesis pathway. Using this as a target, disrupting this gene will cause the plant to exhibit an albino phenotype, making it easier to identify gene-edited plants. OsPDS -SG1 and OsPDS -SG2 is designed for use in OsPDS As expected, the edited T0 plants showed an albino phenotype ( Figure 3 (e)-(f)).

[0077] The inventors further explored the potential application of TGBE in gene expression regulation and studied its ability to regulate gene expression through alternative splicing. Pre-mRNA undergoes alternative splicing during processing, resulting in exon skipping, thereby achieving temporal and tissue-specific regulation of gene expression. It is worth noting that there is a T base on the complementary strand of the splice donor site (SD) and the splice acceptor site (SA). By disrupting these splicing signals, exon skipping can be achieved ( Figure 3 (b) This provides a new strategy for regulating gene expression. To verify this application, the experimental design editor OsARF24 The inventors designed the splice site of the gene (encoding rice auxin response factor, LOC_Os12g29520) OsARF24 -SG2 targets the SA (splicing acceptor) site of exon 8 of the gene, such as Figure 3 As shown in (c), the 8th exon can be spliced ​​out from the mature transcript. TGBE was used to achieve precise editing of the SA site and exon skipping ( Figure 3 (c)-(d)). In summary, TGBE achieves selectable exon skipping by mutating T in the SD or SA sites to obtain the desired mature transcript. This not only highlights the ability of TGBE in regulating gene expression diversity, but also significantly broadens the application scope of base editors.

[0078] In eukaryotes, genomic DNA is bound to histones and compacted into higher-order chromatin structures, which may hinder the binding of CRISPR complexes to their target DNA. VP64 is a module composed of four copies of the VP16 transactivation domain that promotes the remodeling and unfolding of condensed chromatin, increasing the accessibility of base editors (BEs) to target sites. The inventors used a 32-amino acid linker to fuse VP64 to the N-terminus of mhUNGv3 and constructed the pTGBE-VP64 plasmid ( Figure 1To verify whether TGBE-VP64 can improve the performance of TGBE base editor, the inventors selected 5 genes in rice from the same 10 targets as TGBE ( OsNRT1.1B , OsARF24 , OsPDS , oeLh and OsSLR1 ) were tested at the endogenous sites of the positive callus. Target sequencing of positive callus showed that for the same target site, the T to S editing efficiency of TGBE was relatively higher than that of TGBE-VP64, but the insertion or deletion mutation (InDel) frequency induced by TGBE-VP64 was reduced ( Figure 2 (b)).

[0079] In general, base editors, as a revolutionary class of genome editing tools, are not only of great significance in biomedical research and therapeutic advances, but also have great potential in agriculture. They can precisely modify DNA in cells without inducing double-strand breaks, thereby reducing off-target effects. By precisely addressing single nucleotide variations that affect plant traits, base editors have paved the way for optimizing crop traits such as disease resistance, drought resistance, and yield. However, direct T base editors are still lacking in plants. In this paper, a new deaminase-free base editor TGBE was constructed, which can directly excise T using an engineered glycosylase (UNG), producing up to 78.05% T to G editing in stable rice lines. At the same time, exon skipping was successfully achieved by using TGBE, providing a new strategy for regulating gene expression. The engineered TGBE will enable multiple base conversions in plants, thereby expanding the plant base editing toolbox and potentially using it for research and genetic improvement of different crops. By combining TGBE with other previously reported base editors, all 12 base conversions can be achieved in rice, especially direct T base editing, which will play an important role in functional genomics research and genetic improvement of plants ( Figure 3 (g)).

[0080] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A base editor for plant T to G, characterized by: The base editor is a protein containing Cas protein and uracil DNA glycosylase, and the amino acid sequence of the base editor is SEQ ID No.

2.

2. The base editor according to claim 1, characterized in that: The base editor also contains VP64 protein, and the amino acid sequence of the VP64 protein is positions 20-69 of SEQ ID No.

4.

3. The base editor according to claim 2, characterized in that: The base editor is a protein formed by connecting the VP64 protein, the uracil DNA glycosylase, the Cas protein and the nuclear localization signal.

4. A protein-related biomaterial, characterized in that: The protein is the base editor according to any one of claims 1 to 3, and the biological material is at least one of the following B1) to B4): B1) a nucleic acid molecule encoding the base editor; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4) A recombinant microorganism containing the nucleic acid molecule described in B1), a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).

5. The biomaterial according to claim 4, characterized in that: B1) The nucleic acid molecule is as follows (b11) or (b12): b11) The coding sequence is a DNA molecule whose nucleotide sequence is SEQ ID No. 1 in the sequence list; b12) The coding sequence is a DNA molecule whose nucleotide sequence is SEQ ID No. 3 in the sequence listing.

6. A plant T to G base editing method, characterized in that: The base editing method comprises: introducing the encoding gene of the base editor described in any one of claims 1 to 3 and the DNA molecule of sgRNA into the target plant to achieve base editing from T to G in the target plant.

7. Use of a base editor or a biomaterial in base editing or in the preparation of a base editing product, characterized in that: The base editor is any one of claims 1 to 3, the biological material is the biological material of claim 4 or 5, and the base editing is T to G or T to C editing in plants.

8. The use according to claim 7, characterized in that: The plant is M1) or M2) or M3): M1) monocots or dicots; M2) Gramineae; M3) Rice.

Images