Application of excellent natural variation of GmCCS gene in soybean yield and growth regulation
By discovering excellent natural variations in GmCCS genes related to yield traits in soybeans, and through gene cloning and overexpression technology, the problem of unknown CCS function in soybeans is solved, and the effect of improving soybean yield and growth regulation is achieved.
Patent Information
- Application Number
- CN202411886452.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-20
- Publication Date
- 2025-04-25
- Estimated Expiration
- 2044-12-20
AI Technical Summary
In the prior art, there are few studies on the copper/zinc superoxide dismutase chaperone protein CCS in soybean yield and growth regulation, and its function in soybeans is not yet clear.
By discovering that the GmCCS gene has excellent natural variants related to yield traits in soybeans, the SNP site C/T mutation was used to perform gene cloning and overexpression, and the overexpression of the GmCCS gene was further achieved in soybeans through transgenic technology.
The function of improving soybean yield and regulating growth and development has been achieved, showing that the GmCCS gene plays an important role in soybeans, laying a theoretical foundation for cultivating new germplasms of high-yield soybeans.
Smart Images
Figure CN119332022B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular genetic breeding technology, and in particular to GmCCS Application of genetically superior natural variation in soybean yield and growth regulation. Background Art
[0002] Soybean ( Glycine max ) is one of the important crops in my country, ranking fourth after rice, wheat and corn. Soybean is an important raw material for the food industry and feed industry. With the rapid development of my country's economy and the improvement of people's living standards, people's demand for high-quality agricultural products is growing. At the same time, the demand for soybeans in the breeding and feed industries has risen sharply, resulting in a continuous increase in soybean imports. Therefore, improving soybean yield and quality through scientific and technological innovation is of great significance to ensure the stability of my country's soybean supply chain in the future.
[0003] Molecular chaperone protein is a protein in the cytoplasm that consumes ATP to assist the folding and assembly of newly formed polypeptide chains into stable and biologically active structures, restore the activity of deteriorated proteins, and promote the assembly of protein polymers. 2+ The copper / zinc superoxide dismutase chaperone protein (CCS) delivers copper to the apoprotein Cu / Zn superoxide dismutase, allowing the protein to assemble normally and then perform the function of copper-zinc superoxide dismutase. In previous studies, there is a complementary mechanism between copper / zinc superoxide dismutase (CSDs) and other members of superoxide dismutase SODs under adverse stress, that is, when the activity of CSDs decreases, other members will supplement the inhibited enzyme activity, thereby increasing the total enzyme activity, and clearing the accumulation of H2O2, enhancing the stress resistance of plants. Conversely, when CSDs are overexpressed, other members are inhibited and the total enzyme activity is reduced. However, compared to CSDs, the member responsible for transporting Cu 2+ There are few studies on the involvement of the copper / zinc superoxide dismutase chaperone protein CCS in regulating plant growth and development. Previous studies have shown that in Arabidopsis thaliana, the superoxide dismutase chaperone protein CCS and its related copper ion metabolism play an important role in the growth, development and stress resistance of Arabidopsis. The homeostasis of copper ions is essential for the normal physiological metabolism of plants, and CCS plays a core role in maintaining this homeostasis. By regulating the expression and activity of CCS and its related proteins, the response of Arabidopsis to the environment can be affected. However, there are few reports on this gene in soybean, and it is not clear whether it is involved in regulating soybean yield and plant growth and development. Summary of the invention
[0004] In view of the above-mentioned defects of the prior art, the present invention proposes GmCCSThe application of genetically superior natural variation in soybean yield and growth regulation is to solve the problems raised by the above background technology.
[0005] In order to achieve the above object, the present invention provides the following technical solutions:
[0006] A SNP locus associated with soybean yield traits, the SNP locus is located at GmCCS The 626th position of the gene has a C / T variation. GmCCS The nucleotide sequence of the gene is shown in SEQ ID NO:1.
[0007] Preferably, the number of grains per plant and the grain weight per plant of individuals with CC genotype at the SNP site are significantly higher than those with TT genotype.
[0008] An overexpression GmCCS The invention relates to the application of genes in improving plant yield and regulating growth, wherein the plant is soybean.
[0009] Preferably, the GmCCS The gene cloning method includes the following steps:
[0010] (1) Extracting RNA from soybean plants and reverse transcribing to obtain cDNA;
[0011] (2) Using cDNA as a template, PCR amplification was performed using a primer pair to obtain the gene sequence shown in SEQ ID NO: 1.
[0012] Preferably, the nucleotide sequence of the primer pair in step (2) is as follows:
[0013] GmCCS -F: ATGGCATTTCTGAGGTCAATA (SEQ ID NO: 2);
[0014] GmCCS -R: TCAGACCTTGCTAGTAACAAA (SEQ ID NO: 3).
[0015] Preferably, the conditions for the PCR amplification in step (2) are pre-denaturation at 95°C for 5 min, denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles, and post-extension at 72°C for 8 min.
[0016] A method for increasing soybean yield and regulating growth, the method comprising the following steps:
[0017] S1. Connect the gene sequence shown in SEQ ID NO: 1 to the starting vector to obtain an overexpression vector;
[0018] S2, transferring the overexpression vector obtained in step S1 into the starting strain to obtain a recombinant engineered bacterium;
[0019] S3, infect soybean with the recombinant engineering bacteria obtained in step S2 to obtain overexpression GmCCS of genetically modified soybeans.
[0020] Preferably, the starting vector in step S1 is a pCAMBIA3301-Flag vector.
[0021] Preferably, the starting strain in step S2 is a prokaryotic microorganism or a eukaryotic microorganism.
[0022] Preferably, the starting strain is EHA105 Agrobacterium.
[0023] Compared with the prior art, the present invention has the following beneficial effects:
[0024] (1) The present invention is based on GmCCS Gene analysis of 1025 soybean germplasm resources revealed that GmCCS The gene has excellent allele variation related to soybean yield traits, and further experiments such as transgenic material phenotypic identification have proved that the excellent natural variation of the gene has the function of increasing soybean yield and affecting its growth and development. GmCCS There is a C / T variation in the SNP loci of the genetically excellent natural variation. The number of grains per plant and the grain weight per plant of the CC genotype individuals are significantly higher than those of the TT genotype. (2) The present invention discloses a protein responsible for transporting Cu in soybean 2+ The copper / zinc superoxide dismutase chaperone protein GmCCS plays an important role in regulating soybean yield and plant growth and development. This invention has laid a theoretical foundation for breeding new high-yield soybean germplasm. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 For soybean GmCCS Population analysis and gene cloning of significant SNP sites of genes; a is the box plot of the distribution of single-plant grain number of C / T soybean germplasm; b is the box plot of the distribution of single-plant grain weight of C / T soybean germplasm; c is GmCCS Electrophoresis band diagram of PCR amplification of full-length cDNA fragment of the gene;
[0026] Figure 2 For transfer GmCCS Plant overexpression vector map of genes;
[0027] Figure 3 Knockout GmCCS Plant editing vector (Crisper cas9) map of genes;
[0028] Figure 4 For overexpression and knockoutGmCCS Acquisition and identification of transgenic soybean; a is overexpression GmCCS Identification of transgenic soybean genome; b is knockout GmCCS Schematic diagram of transgenic soybean editing; c is overexpression and knockout GmCCS Identification of transgenic soybean expression;
[0029] Figure 5 For overexpression and knockout GmCCS Phenotypic identification (a) and trait analysis (b) of transgenic soybeans with the gene;
[0030] Figure 6 For overexpression and knockout GmCCS Field phenotype and yield analysis of transgenic soybeans with the same gene; a is the field phenotype analysis of transgenic plants; b is the yield analysis of transgenic plants after field maturity. DETAILED DESCRIPTION
[0031] In order to enable those skilled in the art to better understand the technical content of the present invention, the technical solution of the present invention is further described in detail below in conjunction with specific implementation methods.
[0032] Example 1 Soybean GmCCS Haplotype analysis of genes to find SNP sites
[0033] 1.1 This project first used the GATK tool to identify SNPs in the sequencing data of 1025 soybean germplasm resource populations, and then used the annovar tool to annotate the identified SNP sites to determine whether they were located in GmCCS In order to further screen out SNP sites with potential biological significance, this study further filtered sites with a second allele frequency (MAF) less than 0.05 using Tassel 5 software, and finally analyzed the filtered SNP sites and found that GmCCS The exonic region of the gene, especially at chr05:4998163 (i.e. GmCCS The 626th base of the gene has a significant SNP variation (C / T), which leads to a non-synonymous amino acid mutation (Pro / Leu). This discovery is of great significance to understanding GmCCS Genes play a crucial role in soybean growth, development and yield.
[0034] 1.2 To further evaluate the association between different haplotypes and yield traits, the project combined key yield trait data such as the number of grains per plant and grain weight per plant, and used the generalized linear model (GLM) in Tassel 5 software to GmCCSThe results showed that soybean germplasm carrying haplotype C had significantly higher grain number per plant and grain weight per plant than germplasm carrying haplotype T (see Figure 1 a. Figure 1 b). The results indicate that the chr05:4998163 locus may have excellent allele variation related to soybean yield traits. GmCCS The potential impact of a key SNP site in the gene on soybean yield traits, and through haplotype analysis, provide a scientific basis for discovering and utilizing excellent allele variations in soybean.
[0035] Example 2 Extraction of RNA from "Dongnong 50" soybean plants and its reverse transcription
[0036] 2.1 will have GmCCS The soybean variety "Dongnong 50" with excellent natural variation sites was sown in culture pots. When it grew to the R3-R4 period, the root, stem, leaf and flower tissues of the growing soybeans were taken to extract RNA from different soybean tissues.
[0037] The extraction steps are as follows:
[0038] A: Pre-cool the mortar with liquid nitrogen, add the sample into the mortar, wear multiple layers of gloves, and grind continuously until the liquid nitrogen evaporates completely. Repeat this process three times.
[0039] B: After adding 1 ml of RNAiso plus homogenate, let stand at room temperature for 5 min, and centrifuge at 12000g for 5 min at 4℃;
[0040] C: Transfer the supernatant to a new 1.5 ml centrifuge tube, add 200 ml of chloroform, let stand at room temperature for 5 min, and centrifuge at 12000 g at 4 °C for 15 min;
[0041] D: Transfer the supernatant to a new centrifuge tube, add an equal volume of isopropanol, invert and mix, let stand at room temperature for 10 min, and centrifuge at 12000g for 10 min at 4°C;
[0042] E: Add 1 ml of 75% ethanol to the precipitate to wash it, centrifuge at 12000g for 5 min at 4°C, and discard the supernatant;
[0043] F: After opening and drying, dissolve in an appropriate amount of DEPC water and measure the concentration;
[0044] G: Dilute the RNA concentration to 300-600 ng / ul and run electrophoresis, then store the RNA in a -80℃ refrigerator.
[0045] 2.2 Reverse transcription of RNA from different tissues of soybean plants
[0046] The reverse transcription system is shown in Table 1:
[0047] Table 1 Reverse transcription system
[0048]
[0049] The total volume of the first step reaction system is 10 μl, and the conditions are: incubate at 42°C for 2 min or at room temperature for 5 min; the total volume of the second step reaction system is 20 μl, and the conditions are: 37°C for 15 min, 85°C for 5 s, and 4°C. Storage: The cDNA obtained by reverse transcription is stored in a -20°C refrigerator.
[0050] Example 3 Soybean GmCCS Gene cloning
[0051] Using cDNA of "Dongnong 50" root as template, GmCCS The gene was cloned. The PCR system is shown in Table 2. The PCR program was 95°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 1 min, a total of 35 cycles, and 72°C post-extension for 8 min. The PCR amplification primers were: GmCCS -F:ATGGCATTTCTGAGGTCAATA (SEQ ID NO: 2), GmCCS -R:TCAGACCTTGCTAGTAACAAA (SEQ ID NO: 3). The PCR product was detected by agarose gel electrophoresis and connected to the cloning vector pEASY-T1 to generate pEASY-GmCCS, which was then sequenced. The sequencing sequence is shown in SEQ ID No. 1, and the electrophoresis bands are shown in Figure 1 c.
[0052] Table 2 GmCCS Gene PCR system
[0053]
[0054] Example 4 Copper / Zinc Superoxide Dismutase Chaperone Protein GmCCS Construction of expression vector and stable genetic transformation of soybean
[0055] 4.1 Construction of plant overexpression vector
[0056] PCR was performed using pMD18T-GmCCS plasmid and homology arm primers, and the pCAMBIA3301-Flag vector plasmid was double-digested with NcoⅠ and BstEⅡ, and connected using the ClonExpress II One Step CloningKit (C112-01) to obtain the overexpression vector pCAMBIA3301-GmCCS-Flag. The empty vector and pCAMBIA3301-GmCCS-Flag were transformed into EHA105 Agrobacterium for stable genetic transformation of soybean to obtain the overexpression vector. GmCCS Genetically modified soybeans, GmCCS The plant overexpression vector map of the gene is shown in Figure 2 .
[0057] 4.2 Soybean GmCCS Construction of gene editing knockout vector
[0058] right GmCCS The gene was designed through the website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) for sgRNA target site design, and the knockout vector pCRISPR was constructed through StuⅠ and XbaⅠ sites to obtain the knockout pCRISPR-GmCCS plant expression vector, which was transformed into EHA105 Agrobacterium for stable genetic transformation of soybean to obtain the knockout GmCCS of genetically modified soybeans, knockout GmCCS The map of the plant gene editing vector (Crisper cas9) is shown in Figure 3 .
[0059] Example 5 Overexpression and knockout GmCCS Genomic and phenotypic characterization of transgenic plants
[0060] (1) Use GmCCS After the gene was infected with soybean, the overexpression GmCCS Identification of transgenic soybean genome Figure 4 As shown in a, knockout GmCCS Schematic diagram of the editing of genetically modified soybeans Figure 4 As shown in b, overexpression and knockdown were measured GmCCS The expression level of transgenic soybean Figure 4 As shown in c.
[0061] (2) Phenotypic identification in artificial climate chamber: First, sodium hypochlorite and concentrated hydrochloric acid were mixed in a ratio of 1:1, and the transgenic lines and WT (Dongnong 50, without any treatment) seeds were sterilized with chlorine gas overnight; the soybeans were washed with sterile water and planted in sterilized nutrient soil, and kept moist with 1 / 2 Hoagland solution. Soybean plants were cultured in an artificial climate chamber (25°C, 16h of light), and watered normally during the period to ensure that all plants were in a normal growth state. The growth status was recorded on the 20th, 25th, and 36th days (see Figure 5 a), and after the transgenic plants showed significant phenotypes compared with WT plants on day 36, the dry weight, fresh weight and plant height of each transgenic line and WT plants were measured (see Figure 5 b);
[0062] The results showed that overexpression GmCCS The growth of the transgenic line (OE-GmCCS) was significantly better than that of the WT, and the growth of the WT plants was significantly better than that of the knockout GmCCS The results showed that the transgenic line (del-GmCCS) GmCCS Genes play an important role in regulating the growth and development of soybean plants.
[0063] (3) Field phenotypic identification: The transgenic lines obtained in the previous experiment and WT (Dongnong 50) seeds were sown at the Changchun Experimental Base, and watered properly during the growth period to ensure that the plants were in a normal growth state at each growth and development stage. After the plants matured, the yield of each soybean plant was determined by combining manual and digital seed testing;
[0064] The results showed that overexpression GmCCS The grain weight per plant of the transgenic lines was significantly higher than that of the WT. GmCCS The yield of transgenic soybean lines was significantly reduced (see Figure 6 a. Figure 6 b). The above results show that GmCCS The gene has the function of increasing soybean yield and regulating plant growth and development.
[0065] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims
1. Use of a reagent for detecting SNP sites associated with soybean yield traits in soybean yield identification, characterized in that: The SNP site is located at GmCCS The 626th position of the gene has a C / T variation. GmCCS The nucleotide sequence of the gene is shown in SEQ ID NO: 1; the number of grains per plant and the weight of grains per plant of CC genotype individuals at the SNP site are significantly higher than those of TT genotype individuals.
2. Overexpression GmCCS The application of genes in increasing plant yield and regulating growth is characterized in that: The plant is soybean, and the overexpression GmCCS Gene; soybean plants were cultured in an artificial climate chamber at 25°C and 16h of light, during which time they were watered normally to ensure that all plants were in a normal growth state; the growth of the transgenic lines overexpressing GmCCS was significantly better than that of WT, and the grain weight per plant of the transgenic lines overexpressing GmCCS was significantly better than that of WT; Said GmCCS The gene cloning method includes the following steps: (1) Extracting RNA from soybean plants and reverse transcribing to obtain cDNA; (2) Using cDNA as a template and primer pairs for PCR amplification, obtaining the gene sequence shown in SEQ ID NO: 1; The nucleotide sequence of the primer pair in step (2) is as follows: GmCCS -F: ATGGCATTTCTGAGGTCAATA; GmCCS -R:TCAGACCTTGCTAGTAACAAA; The conditions for the PCR amplification in step (2) are pre-denaturation at 95°C for 5 min, denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles, and post-extension at 72°C for 8 min.
3. A method for increasing soybean yield and regulating growth, characterized in that: The soybean plants are cultured in an artificial climate chamber at 25°C and with a light intensity of 16 hours, during which time they are watered normally to ensure that all the plants are in a normal growth state; the growth of the transgenic strains overexpressing GmCCS is significantly better than that of WT, and the grain weight per plant of the transgenic strains overexpressing GmCCS is significantly better than that of WT; the method comprises the following steps: S1. Connect the gene sequence shown in SEQ ID NO: 1 to the starting vector to obtain an overexpression vector; S2, transferring the overexpression vector obtained in step S1 into the starting strain to obtain a recombinant engineered bacterium; S3, infect soybean with the recombinant engineering bacteria obtained in step S2 to obtain overexpression GmCCS of genetically modified soybeans.
4. The method for increasing soybean yield and regulating growth as claimed in claim 3, characterized in that: The starting vector in step S1 is pCAMBIA3301-Flag vector.
5. The method for increasing soybean yield and regulating growth as claimed in claim 3, characterized in that: The starting strain in step S2 is a prokaryotic microorganism.
6. The method for increasing soybean yield and regulating growth as claimed in claim 3, characterized in that: The starting strain is EHA105 Agrobacterium.