PRX and DIAPH3 gene mutants and application thereof

Abstract

The invention relates to the technical field of gene diagnosis, and particularly discloses PRX and DIAPH3 gene mutants and application thereof. On one hand, the invention relates to a PRX gene mutant and application thereof in Dejerine-Sotta disease screening, and on the other hand, the invention relates to a DIAPH3 gene mutant and application thereof in autosomal dominant auditory neuropathy 1 type screening. According to the invention, the pathogenic gene spectrum of autosomal dominant auditory neuropathy type 1 and Dejerine-Sotta disease is broadened, the understanding of clinical doctors on the diseases is enhanced, experience is provided for clinical screening and diagnosis of the diseases, and particularly, pre-pregnancy screening is facilitated; a research direction and a new theoretical basis are provided for early diagnosis and effective treatment of the diseases, and a new molecular target is also provided for research and development of specific drugs for treating the diseases in practice.

Description

[0001] This application is a divisional application of the Chinese invention patent application whose parent case name is gene mutants and their applications, application number is 202410635750.X, and application date is May 22, 2024. Technical Field

[0002] The present invention relates to the technical field of gene diagnosis, in particular to PRX and DIAPH3 gene mutants and applications thereof. Background Art

[0003] Autosomal dominant auditory neuropathy type 1 (OMIM: 609129), AD; Disease introduction: Auditory neuropathy is a hearing loss characterized by preserved cochlear outer hair cell function and abnormal or absent auditory brainstem responses; In various dominant syndromes, auditory neuropathy can be accompanied by peripheral neuropathy, such as Charcot-Marie-Tooth disease, and is observed in Friedreich's ataxia; Its clinical phenotype: sensorineural deafness, abnormal speech discrimination, abnormal auditory evoked potentials, and absent acoustic reflexes. The diaphragm-associated formin3 (DIAPH3) gene, located on chromosome 13q21.2, encodes a member of the transparent subfamily of the formin family, which is involved in actin remodeling and regulating cell motility and adhesion. Cynthia J Schoen et al. (PMID: 20624953) also reported that DIAPH3 is the gene that causes autosomal dominant auditory neuropathy.

[0004] Dejerine-Sottas disease (OMIM: 145900), AD, AR; Disease introduction: Dejerine-Sottas neuropathy is a demyelinating peripheral neuropathy that develops in infancy. It was initially thought to be autosomal recessive, but some dominant genetic mutations in the peripheral myelin protein 22 gene and the absence of the peripheral myelin protein gene have been reported in patients with Dejerine-Sottas disease. Affected people have delayed motor development due to severe distal motor and sensory disorders, resulting in gait difficulties; Clinical phenotype: nystagmus, hand splitting, ulnar claw hand, hypotonia, decreased tendon reflexes, motor development delay, areflexia, generalized hypotonia, cavus foot, hammertoes, distal muscle weakness, kyphoscoliosis, elevated CSF protein, distal sensory impairment, straddled gait, decreased number of peripheral myelinated nerve fibers, hypertrophic nerve changes, onion bulb formation, decreased motor nerve conduction velocity, segmental nerve terminal demyelination / remyelination, onset in infancy, distal muscle atrophy, variable expression, dorsiflexion weakness, sensory ataxia, heterogeneous. PRX, located on chromosome 19, q13.2, encodes a protein involved in the maintenance of peripheral nerve myelin. The encoded protein contains two PDZ domains, named after PSD95 (postsynaptic density protein), DigA (Drosophila discoid large tumor suppressor protein) and Z01 (mammalian tight junction protein). Two alternative splicing transcript variants have been described that encode different protein isoforms of this gene and target different proteins in Schwann cells. It is now clear that when both PDZ domains are abnormal, Dejerine-Sottas disease will occur. CF Boerkoel et al. (PMID: 11133365) also reported that mutations in PRX can cause recessive Dejerine-Sottas neuropathy.

[0005] In addition, in the vast field of genetics, compound heterozygous mutation is a unique phenomenon. Compound heterozygous mutation is also called biallelic mutation. Each chromosome is mutated and neither is a wild chromosome, but the allele types produced by the mutations of the two chromosomes are different. Compound heterozygous mutation refers to two different mutations on the same gene, one from the mother and the other from the father, and both mutations affect the function of the protein encoded by the gene. This situation is often observed in genetics, because one mutation is usually not enough to cause an obvious genetic disease, but when two mutations exist at the same time, they may affect each other and cause the occurrence of the disease.

[0006] At present, the research on the relationship between the above diseases and specific genes needs to be further studied, and the screening methods for the above diseases need to be improved to achieve early screening of potential susceptible diseases and provide new ideas for subsequent treatment and early intervention. Summary of the invention

[0007] The present invention provides gene mutants and applications thereof, mainly to make up for the problems that the pathogenic gene library of idiopathic generalized epilepsy susceptibility type 12, familial infantile myoclonic epilepsy, autosomal dominant auditory neuropathy type 1, Dejerine-Sottas disease, etc. is still incomplete during the screening and diagnosis process, and risk screening cannot be performed for some potential risks of disease, and the treatment methods for the symptoms need to be improved.

[0008] In order to solve the above problems, the present invention adopts the following technical solutions:

[0009] The first part of the present invention relates to DIAPH3 gene mutants and their applications.

[0010] One of them is that the DIAPH3 gene mutant is any of the following

[0011] A nucleic acid having a target fragment, and the target fragment has a c.2426_2456delTTGAAGAGCAGGTGAACAACATCAAACCTGA mutation compared with the wild-type DIAPH3 gene with a sequence of SEQ ID NO: 1;

[0012] A polypeptide, compared with the protein encoded by the wild-type DIAPH3 gene with a sequence of SEQ ID NO: 2, the polypeptide has a p.F809Sfs*12 mutation.

[0013] The second one is the use of a reagent for detecting DIAPH3 gene mutants in the preparation of a product for screening autosomal dominant auditory neuropathy type 1; by detecting whether the aforementioned DIAPH3 gene mutant exists in the sample, it can be determined whether the sample comes from a patient with autosomal dominant auditory neuropathy type 1 (formed and unformed fetuses are temporarily included in the patient), because when the aforementioned DIAPH3 gene mutant is present, the population to be tested will inevitably suffer from autosomal dominant auditory neuropathy type 1, so early intervention can be made, which is particularly important in pre-pregnancy screening. Among them, the reagent for detecting the aforementioned DIAPH3 gene mutant is at least one of a probe or primer specific for the DIAPH3 gene mutant, and can also be other means; the primer is at least a primer pair: F-AGCAGGGCTTTTCTCTCTTCC, R-TGCAATCAGGGC TGACATTT.

[0014] The second part of the present invention relates to PRX gene mutants and their applications.

[0015] One of them is that the PRX gene mutant is any of the following

[0016] A nucleic acid PRX-1, wherein the nucleic acid has a target fragment, and the target fragment has a c.3149G>A mutation compared to the wild-type PRX gene with a sequence of SEQ ID NO: 3;

[0017] A nucleic acid PRX-2, wherein the nucleic acid has a target fragment, and the target fragment has a c.501dup mutation compared to a wild-type PRX gene having a sequence of SEQ ID NO: 3;

[0018] A polypeptide PRX-1, wherein the polypeptide has a p.Trp1050Ter mutation compared to the protein encoded by the wild-type PRX gene of SEQ ID NO: 4;

[0019] The polypeptide PRX-2 has a p.Arg168SerfsTer55 mutation compared to the protein encoded by the wild-type PRX gene with a sequence of SEQ ID NO:4.

[0020] Alternatively, one of the situations is that the PRX gene mutant is a PRX gene compound mutant, the PRX gene compound mutant includes a compound heterozygous mutation, and the compound heterozygous mutation includes a c.3149G>A mutation and a c.501dup mutation; or, the second situation is that the PRX gene mutant is a PRX compound mutant protein encoded by a PRX gene complex, and the PRX compound mutant protein has a p.Trp1050Te mutation and a p.Arg168SerfsTer55 mutation.

[0021] The second one is the use of a reagent for detecting a PRX gene mutant in the preparation of a product for screening Dejerine-Sottas disease; it has at least the following conditions:

[0022] 1) When the product for screening Dejerine-Sottas disease is a product for diagnosing Dejerine-Sottas disease:

[0023] The reagents for detecting the aforementioned PRX gene mutants are nucleic acid PRX-1 and nucleic acid PRX-2 detection reagents. When the two chromosomes in the sample have PRX c.3149G>A mutation and PRX c.501dup mutation respectively, it is dominant, and the source of the sample must have a Dejerine-Sottas disease phenotype, then the sample must come from a Dejerine-Sottas disease patient (formed and unformed fetuses are temporarily listed as patients);

[0024] 2) When the product for screening Dejerine-Sottas disease is a product for diagnosing autosomal recessive Dejerine-Sottas disease: the reagent for detecting the aforementioned PRX gene mutant is a detection reagent for nucleic acid PRX-1 or nucleic acid PRX-2, and when the sample has only one of the PRX c.3149G>A mutation and the PRX c.501dup mutation, the sample comes from a Dejerine-Sottas disease carrier, but the carrier himself does not have the Dejerine-Sottas disease phenotype. However, when giving birth to a carrier with another mutation, the gene carrying the pathogenic mutation will be inherited to the next generation, and the two chromosomes of the next generation will have both the PRX c.3149G>A mutation and the PRX c.501dup, which will show the Dejerine-Sottas disease phenotype. At this time, it is considered that there will be specific risks in the reproduction of both parties; the specific analysis can also be combined with the test results of the parents. For example, if the parents are carriers of two mutations, the next generation will have the Dejerine-Sottas disease phenotype.

[0025] Among them, the reagent for detecting the aforementioned PRX gene mutant is at least one of a probe and a primer specific for the PRX gene mutant, and can also be other means; the primer is at least a primer pair: F-CAGGTTTGCTCTCCCCAAGT, R-CACCTGAACCCTGTAGCCTG.

[0026] In the above two parts, it is necessary to explain that:

[0027] The wild-type sequences SEQ ID NO:1 to SEQ ID NO:4 listed above do not necessarily represent complete nucleotide or amino acid sequences, but may also be fragments thereof. Specific reference is made to the full sequence of a specific version. The sequence cited in this disclosure is mainly to clarify specific mutation sites. However, wild-type nucleic acid and amino acid sequences are not limited to the examples listed, and the mutation site and its variation are used as the basis for determining whether the schemes are the same or equivalent. The specific sequence of the part where the mutation site is located can also be confirmed in combination with each sequencing map. In some cases, the site number in different versions of the sequence can also be inferred from the sequence shown in the sequencing map.

[0028] Disease screening is mainly for disease risk investigation to facilitate early intervention; diagnosis is auxiliary diagnosis for people who are already sick. Of course, whether or not the patient is sick is based on the actual changes in the patient's body and the corresponding standards and specifications, not on people's subjective cognition.

[0029] When the above mutants are used to construct biological models to study the curability of drugs, they should be regarded as the use of the present invention. For example, when an animal model of a specific mutant is constructed and then a curable drug is screened and verified, the above gene mutant should be regarded as manufactured and used. The construct can also be used as a test model for the effect of the drug in the pharmaceutical process, such as introducing the construct into the receptor cell, so that the receptor cell expresses the protein with the above mutation. One application of the cell model is to conduct large-scale drug screening. The drug can be used to act on the cell model to verify whether the drug has the effect of inhibiting the corresponding mutation, and further verify whether the drug can treat the corresponding disease by inhibiting the mutation. For example, the cell model can be used to simulate the characteristics of the above-mentioned related diseases, and then the model can be used to further verify the effects of some drugs in vitro.

[0030] When the mutation involves a compound gene mutant, if both mutations are non-dominantly inherited, then when the two mutations are individually recessively inherited, when the two mutations are distributed on two chromosomes, the two constitute a compound heterozygous (in trans) genotype, at which time the phenotype will be manifested, leading to the disease.

[0031] The reagent includes at least one of an antibody, a probe, a primer and a mass spectrometry detection reagent that is specific for the nucleic acid with the mutation or the polypeptide with the mutation. Specifically, the reagent includes a product for specific detection of nucleic acids, and also includes a product for specific detection of polypeptides. The product can be at least any one of an antibody, a probe, a primer and a mass spectrometry detection reagent, and can also be other reagents with similar functions. In addition, the kit can be in the form of some kits similar to existing products, and the equipment can be some sequence detection equipment. Primers and probes can be selected from any one of them, and can also be used in combination as needed. The design of probes, primers, etc. when the mutation is known is a conventional technical means, and is not limited too much here, as long as it can play a detection role.

[0032] The types of "nucleic acid" include DNA, RNA or cDNA, and the type is not specifically limited. As long as it has a specific mutation compared to the wild-type gene, it should be identified as a nucleic acid within the scope of the present invention.

[0033] It should be noted that the mutation sites and sequences given above are all based on the content of sequencing platforms such as Burrows Wheeler as a reference. Those skilled in the art should understand that due to the update of the database or the difference in the database, the mutation sites and sequences shown may be slightly different or changed. These differences or changes can be found based on the content of the given database as a standard, and these differences or changes are also included in the protection scope of the present invention.

[0034] This publication broadens the spectrum of pathogenic genes for autosomal dominant auditory neuropathy type 1 and Dejerine-Sottas disease, enhances clinicians' understanding of the disease, provides experience for clinical screening and diagnosis of the above diseases, and also provides a basis for pre-pregnancy and prenatal evaluation of some diseases. Therefore, targeted genetic research on the above diseases and identification of pathogenic genes and their pathogenic mechanisms have potential clinical significance for genetic counseling and individualized prevention and treatment of patients with the above diseases, provide research directions and new theoretical basis for early diagnosis and effective treatment of the above diseases, and will also provide new molecular targets for the development of specific drugs for the treatment of the above diseases in practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is the pedigree chart of family 1;

[0036] Figure 2 This is the brain MRI of proband 1;

[0037] Figure 3 This is the next-generation sequencing map of proband 1;

[0038] Figure 4 This is the first generation sequencing map of family 1;

[0039] Figure 5 This is the pedigree chart of family 2;

[0040] Figure 6 This is the brain MRI of proband 2;

[0041] Figure 7A to Figure 7B This is the next-generation sequencing map of proband 2;

[0042] Figure 8A to Figure 8B This is the first generation sequencing map of family 2;

[0043] Fig. 9 This is the pedigree chart of family 3;

[0044] Fig.10 This is the next-generation sequencing map of proband 3;

[0045] Fig.11 This is the first generation sequencing map of family 3;

[0046] Fig.12 This is the pedigree chart of family 4;

[0047] Figures 13A to 13B This is the next-generation sequencing map of proband 4;

[0048] Figure 14A to Figure 14B This is the first generation sequencing map of family 4. DETAILED DESCRIPTION

[0049] The present invention is described in detail below in conjunction with specific research projects.

[0050] 1. Introduction and application cases of mutants

[0051] Here is a brief introduction to the clinical application examples of this type of product. It can generally be used to analyze the samples obtained for testing. By analyzing whether the samples contain specific mutations, it can be determined whether the source of the samples suffers from a certain disease or is a high-risk patient. This can provide a reference for clinical diagnosis and treatment, especially in pre-pregnancy screening. It can screen the fetus for potential serious diseases during pregnancy to provide accurate advice.

[0052] S1. Extracting nucleic acid samples from biological samples (the samples in this step can also be provided directly by the testing party): The type of the biological sample is not particularly limited, as long as a nucleic acid sample reflecting whether there is a mutation in the gene of the biological sample can be extracted from the biological sample; the biological sample can be at least one selected from human blood, skin, and subcutaneous tissue, preferably peripheral blood. It should be noted that the term "nucleic acid sample" used in this section should be understood in a broad sense, and it can be any sample that can reflect whether there is a mutation in the gene in the biological sample, for example, it can be the whole genome DNA directly extracted from the biological sample, or it can be a part of the whole genome containing the gene coding sequence, it can be the total RNA extracted from the biological sample, or it can be the mRNA extracted from the biological sample. S2. After obtaining the nucleic acid sample, the nucleic acid sample is analyzed to determine the nucleic acid sequence of the obtained nucleic acid sample (mainly the target region where the mutation is located): The method and equipment for determining the nucleic acid sequence of the obtained nucleic acid sample are not particularly limited, and the nucleic acid sequence of the nucleic acid sample can be determined by sequencing. The method and equipment for sequencing are not particularly limited. The second generation sequencing technology, the third generation and the fourth generation or more advanced sequencing technology can be used, and the nucleic acid sequence is sequenced using at least one selected from BGISEQ500, MGISEQ-200, MGISEQ-2000, MGISEQ-T7, HISEQ2000, SOLID, 454, ABI3730XL and a single molecule sequencing device; it should be noted that the term "nucleic acid sequence" used in this section should be understood in a broad sense, which can be the complete nucleic acid sequence information obtained after assembling the sequencing data obtained by sequencing the nucleic acid sample, or the sequencing data (reads) obtained by sequencing the nucleic acid sample can be directly used as the nucleic acid sequence, as long as these nucleic acid sequences contain the coding sequence of the corresponding gene. S3. After determining the nucleic acid sequence of the nucleic acid sample, the nucleic acid sequence of the obtained nucleic acid sample is compared with the sequence of the wild type: if the obtained nucleic acid sequence has a specific mutation involved in the present disclosure, it indicates that the source of the biological sample is susceptible to the corresponding disease.

[0053] The method and equipment for comparing the detected nucleic acid sequence with the wild type are not particularly limited, and any conventional software can be used for operation. Unless otherwise specified, the technical means used in the embodiments are conventional means familiar to those skilled in the art, and the reagents and products used are also commercially available. Various processes and methods not described in detail are conventional methods known in the art, and the sources, trade names, and components of the reagents used are indicated when they first appear, and the same reagents used thereafter are the same as those indicated for the first time unless otherwise specified.

[0054] 2. Determine the pathogenic gene and mutation site

[0055] 1. Sample collection subjects: The probands and their families in this study signed the informed consent.

[0056] Family 1: A family with idiopathic generalized epilepsy susceptible type 12 was collected. □ represents normal males, ○ represents normal females, ● represents diseased females, and ■ represents diseased males (such as Figure 1 ). Proband 1: 58 days after birth, convulsion occurred once, manifested as dazed, unresponsive, lasting for a few seconds to relieve, up to 7-8 times a day, brain MRI and dynamic EEG were normal at the time; brain MRI in July 2020 showed white matter lesions. Developmental delay, 2.5 years old can walk, can not walk independently, abnormal posture; convulsions occurred in April 2022, manifested as impaired consciousness, eyes slanting to one side, limbs stiff, not long lasting, 4-5 episodes in 2 months; 1-2 episodes per month since August 2022. The child's free development is backward, and he can only walk 2-3 steps alone. In terms of fine motor skills, he can continue to eat, but he spills, and his hands shake easily when he reaches out to grab things. He can recognize strangers and acquaintances, and can say titles such as dad and mom, as well as a few verbs, such as want and eat, but his pronunciation is vague, he can occasionally speak short sentences, occasionally answer, and does not recognize numbers. He feels that his walking and posture have regressed recently. Physical examination: high muscle tone, obvious lower limbs, knee reflex ++++, bilateral ankle clonus +. Abnormal posture: walking hand in hand, toes on both feet, hip and knee flexion, intention tremor in both hands. Genetic analysis report on August 24, 2022: SLC2A1 has a heterozygous mutation (c389G>T) suspected pathogenic mutation, related diseases: 1. Idiopathic generalized epilepsy susceptibility type 12, AD; August 2022 cranial brain MRI results: bilateral cerebral hemispheres are symmetrical, gray and white matter contrast is good, small patchy T2flair high signal shadows are seen in the posterior part of the bilateral semiovale center and the posterior part of the ventricular body, DWI signal is not high, abnormal signal, poor myelination; July 2023 cranial brain MRI results: abnormal signal in the anterior part of the right external capsule, the anterior limb of the left internal capsule-the left radiating crown area-the left frontal lobe cortex, considering encephalomalacia (mainly involving white matter, according to the signal characteristics, it is considered to be a high possibility of bleeding).

[0057] Family 2: A pedigree of infantile myoclonic epilepsy was collected. □ represents a normal male, ○ represents a normal female, ■ represents a diseased male, and ● represents a diseased female. Indicates male carriers, Indicates female carriers (such as Figure 5 ). Proband 2: Proband 2 developed suspected convulsions 57 days after birth, several times a day, mainly manifested as clonic tremors of the left hand, sometimes tremors of both upper limbs or limbs, once every few days, lasting from a few seconds to two hours; the seizures later turned into nodding, staring, and lifting of both upper limbs or limbs, accompanied by red face, unresponsiveness, and clusters of seizures, single or more than 20 times / time, 1-6 times a day, and crying after the seizures; diagnosed as "epilepsy (convulsive seizures, focal seizures with continuous status)" at the age of 2 months; completed genetic examination on November 26, 2021 showed compound heterozygous pathogenic variants of TBC1D24 gene (carried by parents); physical examination at nine months of age: epileptic encephalopathy, convulsive status, manifested as tremors of the limbs, hypotonia, positive bilateral Babinski sign, and developmental delay. MRI of the head: The examination showed that the left temporal pole extracerebral space was slightly widened, and the right lateral ventricle was fuller than the contralateral side; the bilateral basal ganglia, right thalamus and bilateral occipital lobes and multiple abnormal signals. Three EEGs: 2-hour video EEG: highly arrhythmic during waking and sleeping; 2-hour video EEG: multifocal spikes, sharp waves, and spike-slow waves during waking and sleeping; 24-hour dynamic EEG: abnormal dynamic EEG and brain topography of infants: mild asymmetry of the two hemispheres, lower amplitude on the right side, and multifocal discharges mainly in the left hemisphere during sleep. CT of the head: The examination showed that the bilateral cerebral hemispheres were symmetrical, the gray and white matter contrast was normal, no focal density abnormalities were found in the bilateral cerebral hemispheres, the bilateral frontal and temporal extracerebral spaces were widened, the widest part was about 6.3mm, the size and shape of the other ventricles and cisterns were normal, the midline structure was centered, no obvious abnormal density was found in the infratentorial cerebellum, and no abnormality in the brainstem, and brain atrophy was considered.

[0058] Family 3: Autosomal dominant auditory neuropathy type 1 was collected. □ represents normal males, ○ represents normal females, ■ represents diseased males, and ● represents diseased females. Indicates male carriers, Indicates female carriers (such as Fig. 9 ). Proband 3: Proband 3 had profound hearing loss in the left ear and severe hearing loss in the right ear, and clinical examination was consistent with the characteristics of autosomal dominant auditory neuropathy type 1.

[0059] Family 4: A Dejerine-Sottas disease family was collected. □ represents a normal male, ○ represents a normal female, ■ represents a diseased male, and ● represents a diseased female. Indicates male carriers, Indicates female carriers (such as Fig.12). Proband 4: Proband 4 had weak limbs at birth. He could lift his head and turn over at 6 months old. He lagged behind in development after 6 months. He could sit alone at 10 months old and could not walk at 1 year old. He was diagnosed with peripheral nerve injury in Jinan and has been recovering. He could just walk 5-6 steps barefoot at 6 and a half years old. He could stop on his own but could not turn. His left fingers could not be fully extended. His cognitive and language abilities were normal. He was conscious and had good mental reactions. He had a weak gait, low distal muscle tone, muscle strength level 3-4, small muscle volume, and it was difficult to elicit knee tendon reflexes. Babinski's sign was negative. The preliminary diagnosis was peripheral neuropathy.

[0060] 2. Sample collection: 5 ml of peripheral blood was collected from the subject, EDTA was added for anticoagulation, and 2 ml of the blood was used to extract genomic DNA using Qiagen BloodDNA mini kit (Qiagen). The concentration was determined by dsDNA HS Assay Kit (Invitrogen) and then stored at -20°C for future use.

[0061] 3. Whole exome sequencing and result analysis

[0062] 3.1 Whole exome sequencing: First, the genomic DNA was fragmented using a Covaris ultrasonic crusher, and the fragmented products were end-repaired, A-added, adapter-added, and amplified using a library construction kit to complete the pre-library construction; then, the human whole exome sequence capture kit was used to process the above pre-library, and the target area was targeted and enriched by the probe hybridization capture method to obtain the final library. The library was analyzed for concentration and fragment distribution using the Qubit and QIAGEN QIAxcel Advanced fully automatic nucleic acid analysis systems, and the qualified library was quantified using a quantitative kit; finally, the sequencing reaction was completed on the BGI MGISEQ-T7 gene sequencer.

[0063] Capture probe sequences used:

[0064] SLC2A1 c.389G>T: CGTCATGTGTGGCTACTACTT;

[0065] TBC1D2 c.677_680delCCCG:GGGGAGACGATGGAAGCGGAGCAAGTAAAGAA;

[0066] TBC1D2 c.731C>T:ATGGCGCACCACGACCGGTAG;

[0067] DIAPH3 c.2426_2456delTTGAAGAGCAGGTGAACAACATCAAACCTGA:TGACTGTCGGTACTACTGACCTAGATTCTC;

[0068] PRX c.3149G>A: TAGGGTCGGGGTCGGGAACGG;

[0069] PRX c.501dup:GCCGAAACTCCGGGGCTTGGGTCCCCCTTT.

[0070] 3.2 Data processing: After sequencing is completed, the sequences that have passed quality control are aligned to the human genome reference sequence using BWA software; GATK software is used to identify the mutation sites in the target sequence, and Annovar annotation software is used to annotate the mutation sites to the public mutation database. The impact of the mutation on protein function is predicted based on the frequency of the mutation site in the normal population, sequence conservation, amino acid changes caused by the mutation, and the position in the protein structure; then, combined with the clinical phenotype of the sample, the pathogenicity of the mutation is interpreted according to the ACMG (The American College of Medical Genetics and Genomics) variation classification standards and guidelines.

[0071] 3.3 Whole exome sequencing results:

[0072] Proband 1: The sample analysis revealed a heterozygous mutation in the SLC2A1 gene: c.389G>T (exon4, NM_006516.4), a heterozygous mutation in which nucleotide 389 changed from guanine G to thymine T, which ultimately led to a missense mutation in which amino acid 130 changed from glycine to valine (p.Gly130Val).

[0073] Proband 2: The sample analysis revealed two heterozygous mutations in the TBC1D2 gene: c.677_680delCCCG (exon2, NM_001199107), a heterozygous mutation of nucleotide deletion from 677 to 680, resulting in an amino acid frameshift mutation (p.A226Gfs*28); c.731C>T (exon2, NM_001199107), a heterozygous mutation of nucleotide 731 from cytosine C to thymine T, resulting in a change of amino acid 244 from alanine to valine (p.A244V).

[0074] Proband 3: The sample analysis revealed a heterozygous mutation in the DIAPH3 gene: c.2426_2456delTTGAAGAGCAGGTGAACAACATCAAACCTGA (exon21, NM_001042517), a heterozygous mutation in which nucleotides 2426 to 2456, TTGAAGAGCAGGTGAACAACATCAAACCTGA, were deleted, resulting in an amino acid frameshift mutation (p.F809Sfs*12).

[0075] Proband 4: The sample analysis revealed two heterozygous mutations in the PRX gene: c.3149G>A (exon7, NM_181882.3), a heterozygous mutation in which nucleotide 3149 changed from guanine G to adenine A, resulting in the change of amino acid 1050 from tryptophan to terminator (p.Trp1050Ter); c.501dup (exon7, NM_181882.3), a heterozygous mutation in which the original nucleotide 501 was directly copied and inserted downstream of the original nucleotide 501, resulting in a frameshift mutation in the amino acid (p.Arg168SerfsTer55).

[0076] 3.4 Bioinformatics prediction analysis:

[0077] (1) Harmfulness and pathogenicity analysis

[0078] Proband 1: SLC2A1 c.389G>T (p.Gly130Val), according to the ACMG variation classification guidelines, the variation was preliminarily judged as a suspected pathogenic variation (Likely pathogenic) PM1+PM5+PP3_Moderate+PM2_Supporting: PM1: The variation is located in the mutation hotspot area; PM5: Mutations at the same position have been reported in the literature database / Clinvar but with different amino acid changes; PP3_Moderate: The bioinformatics protein function comprehensive prediction software REVEL predicts that the result is harmful; PM2_Supporting; SIFT, PolyPhen_2, MutationTaster, and GERP+ predict results as harmful, harmful, harmful, and harmful, respectively; After family verification analysis, the father of the subject had no variation at this site, and the mother of the subject had a heterozygous variation at this site.

[0079] Proband 2: (i) TBC1D2 c.677_680delCCCG (p.A226Gfs*28). According to the ACMG guidelines, the variant was preliminarily determined to be a likely pathogenic variant (Likelypathogenic) PVS1+PM2: PVS1: The variant is a null-effect variant (frameshift mutation), which can lead to loss of gene function; PM2: The frequency in the normal population database is -, which is a low-frequency variant; there are no reports on the relevance of this site in the literature database, and there are no pathogenicity analysis results for this site in the ClinVar database; SIFT, PolyPhen_2, MutationTaster, and GERP+ prediction results are harmful, harmful, harmful, and harmful, respectively; after family verification analysis, the father of proband 2 has no variant at this site, and the mother of proband 2 has a heterozygous variant at this site. (ii) TBC1D2 c.731C>T (p.A244V). According to the ACMG guidelines, this variant was preliminarily determined to be a likely pathogenic variant (Likely pathogenic) PM2+PM3(Trans)+PM5: PM2: The frequency in the normal population database is 0.000079, which is a low-frequency variant; PM3(Trans): a recessive genetic disease, existing in trans with another likely pathogenic variant (forming a compound heterozygous with the aforementioned likely pathogenic mutation); PM5: mutations at the same position have been reported in the literature database / Clinvar, but with different amino acid changes; SIFT, PolyPhen_2, MutationTaster, and GERP+ prediction results were harmful, harmful, harmful, and harmful, respectively; after family verification analysis, the father of proband 2 had a heterozygous variant at this site, and the mother of proband 2 had no variant at this site. Combining the above information, it can be confirmed that the c.677_680delCCCG mutation and the c.731C>T on another chromosome constitute a compound heterozygous (in trans) genotype that causes the disease in proband 2 in this family with infantile myoclonic epilepsy.

[0080] Proband 3: DIAPH3 c.2426_2456delTTGAAGAGCAGGTGAACAACATCAAACCTGA (p.F809Sfs*12), according to the ACMG guidelines, this variant was initially determined to be a likely pathogenic variant (Likely pathogenic) PVS1+PM2: PVS1: This variant is a null effect variant (frameshift mutation), which may lead to loss of gene function; PM2: The frequency in the normal population database is -, which is a low-frequency variant; there is no correlation report of this site in the literature database, and there is no pathogenic analysis result of this site in the ClinVar database; SIFT, PolyPhen_2, MutationTaster, and GERP+ prediction results are harmful, harmful, harmful, and harmful, respectively. After family verification analysis, the proband's father had no variation in this site, and the proband's mother had a heterozygous variation in this site.

[0081] Proband 4: Detailed interpretation of ACMG genetic variation information is as follows: (i) PRX c.3149G>A (exon7, NM_181882.3), resulting in amino acid change p.Trp1050Ter, is a nonsense mutation. According to the ACMG guidelines, the variation was preliminarily determined to be a likely pathogenic variation (Likelypathogenic) PVS1+PM2_Supporting: PVS1: This variation is a null effect variation (nonsense mutation), which can lead to loss of gene function; PM2_Supporting: The frequency in the normal population database is -; there is no correlation report of this site in the literature database, and there is no pathogenicity analysis result of this site in the ClinVar database; SIFT, PolyPhen_2, MutationTaster, and GERP+ prediction results are harmful, harmful, harmful, and harmful, respectively; after family verification analysis, the father of proband 4 has no variation in this site, and the mother of proband 4 has a heterozygous variation in this site. (ii) PRX c.501dup (exon7, NM_181882.3), resulting in amino acid change p.Arg168SerfsTer55, is a frameshift mutation. According to the ACMG guidelines, this mutation is preliminarily determined to be a suspected pathogenic mutation (Likely pathogenic) PVS1+PM2_Supporting: PVS1: This mutation is a null effect mutation (frameshift mutation), which can lead to loss of gene function; PM2_Supporting: The frequency in the normal population database is -; there is no report on the relevance of this site in the literature database, and there is no pathogenic analysis result of this site in the ClinVar database; SIFT, PolyPhen_2, MutationTaster, and GERP+ prediction results are harmful, harmful, harmful, and harmful, respectively; after family verification analysis, the father of proband 4 has a heterozygous mutation at this site, and the mother of proband 4 has no mutation at this site. Since both parents of proband 4 are carriers, it shows that both mutations are not dominant inheritance. Combining the above information, it can be confirmed that the c.3149G>A mutation and the c.501dup on another chromosome constitute a compound heterozygous (in trans) genotype that causes the disease in proband 4 in this Dejerine-Sottas disease pedigree.

[0082] (2) Protein function and conservation analysis

[0083] SLC2A1 c.389G>T (p.Gly130Val): This mutation changes the nucleotide 389 from guanine G to thymine T, which causes the amino acid 130 to change from glycine to valine, affecting the normal translation of the protein, thereby making the GLUT1 protein encoded by SLC2A1 abnormal and leading to the occurrence of idiopathic generalized epilepsy susceptibility type 12; the GLUT1 encoded by SLC2A1 is highly conserved. If the GLUT1 encoded by SLC2A1 is abnormal, it will lead to GLUT1 protein deficiency, causing idiopathic generalized epilepsy susceptibility type 12.

[0084] TBC1D2 c.677_680delCCCG (p.A226Gfs*28): This mutation causes the amino acid 226 to change from alanine to glycine due to the deletion of nucleotides 677 to 680, resulting in a frameshift mutation in the subsequent amino acid sequence, and the 28 amino acids starting from this position are deleted, resulting in the termination of protein synthesis and affecting the normal translation of the protein; TBC1D2c.731C>T (p.A244V): This mutation causes the amino acid 244 to change from alanine to valine due to the nucleotide 731 changing from cytosine to thymine, affecting the normal translation of the protein. The TBC1D2 gene encodes a highly conserved TBC domain. The TBC domain protein is a GTPase activating protein of a group of specific GTPases. When the GTPase activating proteins encoded by a group of alleles TBC1D2 located on the homologous chromosome are all abnormal, it will cause familial infantile myoclonic epilepsy. That is, when two genes in this group of alleles have the above two mutations respectively, the individual will show the characteristics of familial infantile myoclonic epilepsy.

[0085] DIAPH3 c.2426_2456delTTGAAGAGCAGGTGAACAACATCAAACCTGA (p.F809Sfs*12): This mutation causes the phenylalanine at position 809 to become serine due to the deletion of nucleotides 2426 to 2456, resulting in a frameshift mutation in the subsequent amino acid sequence, and the 12 amino acids starting from this position are deleted, affecting the normal translation of the protein, leading to the termination of protein synthesis and the occurrence of autosomal dominant auditory neuropathy type 1. DIAPH3 encodes a conservative member of the transparent subfamily of the Formin family. When DIAPH3 encoding is abnormal, it causes abnormal function of the transparent subfamily members of the Formin family, leading to autosomal dominant auditory neuropathy type 1.

[0086] PRX c.3149G>A (p.Trp1050Ter): This mutation changes the 3149th nucleotide from guanine to adenine, causing the 1050th amino acid from tryptophan to glycine, resulting in the premature appearance of the stop codon, affecting the normal translation of the protein; PRX c.501dup (p.Arg168SerfsTer55): This mutation causes the 168th amino acid from arginine to serine due to the deletion of the 501st nucleotide, and causes the stop codon to appear after the 55th amino acid shift, resulting in the termination of translation, affecting the normal translation of the protein. The PRX gene encodes a protein involved in the maintenance of the myelin sheath of peripheral nerves. The encoded protein contains two conserved PDZ domains. When the two PDZ domains encoded by a group of alleles PRX located on the homologous chromosomes are abnormal, it will lead to abnormal function of the PDZ domain protein, thereby causing Dejerine-Sottas disease. That is, when the two genes in this group of alleles have the above two mutations, the individual will show the characteristics of Dejerine-Sottas disease.

[0087] 4. Sanger sequencing verification: Sanger sequencing is used to verify the site of the mutation found. Take 20ng DNA (such as peripheral blood genomic DNA), use primers, and follow the TaKaRa LA PCR TM PCR reaction was performed according to the operating procedure of Kit Ver.2.1 (TaKaRa);

[0088] Primer sequence 1: F-GTGGGAGGTAGGGGAGACTT, R-CACAGATCCGAGAGCCACTG.

[0089] Primer sequence 2: F-CATGACGTTTGGGGACCTGG, R-CCGGCGACCTACCTCTTCTG.

[0090] Primer sequence 3: F-AGCAGGGCTTTTCTCTCTTCC, R-TGCAATCAGGGCTGACATTT.

[0091] Primer sequence 4: F-CAGGTTTGCTCTCCCCAAGT, R-CACCTGAACCCTGTAGCCTG.

[0092] Sequencing analysis was performed on the ABI3730XL (Applied Biosystems) platform, and the presence of each mutation in the gene was finally confirmed. Sampling analysis of other people who did not suffer from the disease also found no heterozygous mutations or compound heterozygous mutations.

[0093] 5. Comprehensive conclusion: (I) Conclusion based on the analysis of the mutation study on proband 1: The heterozygous mutation c.389G>T in the SLC2A1 gene detected by whole exome sequencing technology is the cause of the disease in this family with idiopathic generalized epilepsy susceptibility type 12; the results of this study broadened the genetic spectrum of idiopathic generalized epilepsy susceptibility type 12, provided experience for the clinical screening and diagnosis of idiopathic generalized epilepsy susceptibility type 12, and also provided a basis for prenatal diagnosis; therefore, targeted genetic research on idiopathic generalized epilepsy susceptibility type 12 will provide research directions and new theoretical basis for the early diagnosis and effective treatment of idiopathic generalized epilepsy susceptibility type 12, and will also provide new molecular targets for the development of specific drugs for the treatment of idiopathic generalized epilepsy susceptibility type 12 in practice. (II) Conclusions based on the analysis of the proband 2 mutation study: Whole exome sequencing technology detected that the compound heterozygous mutations of c.677_680delCCCG and c.731C>T in the TBC1D2 gene were the cause of the family's infantile myoclonic epilepsy. The results of this study broadened the genetic spectrum of familial infantile myoclonic epilepsy, provided experience for the clinical screening and diagnosis of familial infantile myoclonic epilepsy, and also provided a basis for prenatal diagnosis. Therefore, targeted genetic research on familial infantile myoclonic epilepsy will provide research directions and new theoretical basis for the early diagnosis and effective treatment of familial infantile myoclonic epilepsy, and will also provide new molecular targets for the development of specific drugs for the treatment of familial infantile myoclonic epilepsy in practice. (III) Conclusions based on the analysis of the proband's 3 mutations: Whole exome sequencing technology detected that the heterozygous mutation c.2426_2456delTTGAAGAGCAGGTGA ACAACATCAAACCTGA in the DIAPH3 gene was the cause of the disease in this family with autosomal dominant auditory neuropathy type 1; the results of this study broadened the genetic spectrum of autosomal dominant auditory neuropathy type 1, provided experience for the clinical screening and diagnosis of autosomal dominant auditory neuropathy type 1, and also provided a basis for prenatal diagnosis; therefore, targeted genetic research on autosomal dominant auditory neuropathy type 1 will provide research directions and new theoretical basis for the early diagnosis and effective treatment of autosomal dominant auditory neuropathy type 1, and will also provide new molecular targets for the development of specific drugs for the treatment of autosomal dominant auditory neuropathy type 1 in practice.(IV) Conclusions based on the analysis of the proband's 4 mutations: Whole exome sequencing technology detected that the compound heterozygous mutations of c.3149G>A and c.501dup in the PRX gene were the cause of the disease in this family with Dejerine-Sottas disease; the results of this study broadened the genetic spectrum of Dejerine-Sottas disease, provided experience for clinical screening and diagnosis of Dejerine-Sottas disease, and also provided a basis for prenatal diagnosis; therefore, targeted genetic research on Dejerine-Sottas disease will provide research directions and new theoretical basis for early diagnosis and effective treatment of Dejerine-Sottas disease, and will also provide new molecular targets for the development of specific drugs for the treatment of Dejerine-Sottas disease in practice.

[0094] It is clear to those skilled in the art that various modifications can be made to the above embodiments without departing from the overall spirit and concept of the present invention. Any modifications that are not detailed can be referred to the prior art, and all of them fall within the protection scope of the present invention. The protection scheme of the present invention shall be subject to the claims attached to the present invention.

Claims

1. A DIAPH3 gene mutant, characterized in that: The DIAPH3 gene mutant is any of the following A nucleic acid having a target fragment, and the target fragment has a c.2426_2456delTTGAAGAGCAGGTGAACAACATCAAACCTGA mutation compared with the wild-type DIAPH3 gene with a sequence of SEQ ID NO: 1; A polypeptide, compared with the protein encoded by the wild-type DIAPH3 gene with a sequence of SEQ ID NO: 2, the polypeptide has a p.F809Sfs*12 mutation.

2. Use of a reagent for detecting the DIAPH3 gene mutant in claim 1 in preparing a product for screening autosomal dominant auditory neuropathy type 1.

3. Use of the reagent for detecting the DIAPH3 gene mutant in claim 1 according to claim 2 in the preparation of a product for screening autosomal dominant auditory neuropathy type 1; wherein, The reagent for detecting the DIAPH3 gene mutant in claim 1 is at least one of a probe and a primer specific to the DIAPH3 gene mutant.

4. Use of the reagent for detecting the DIAPH3 gene mutant in claim 1 according to claim 3 in preparing a product for screening autosomal dominant auditory neuropathy type 1; wherein, The primers are at least a primer pair: F-AGCAGGGCTTTTCTCTCTTCC, R-TGCAATCAGGGCTGACATTT.

5. A PRX gene mutant, characterized in that: The PRX gene mutant is any of the following A nucleic acid PRX-1, wherein the nucleic acid has a target fragment, and the target fragment has a c.3149G>A mutation compared to the wild-type PRX gene with a sequence of SEQ ID NO: 3; A nucleic acid PRX-2, wherein the nucleic acid has a target fragment, and the target fragment has a c.501dup mutation compared to a wild-type PRX gene having a sequence of SEQ ID NO: 3; A polypeptide PRX-1, wherein the polypeptide has a p.Trp1050Ter mutation compared to the protein encoded by the wild-type PRX gene of SEQ ID NO: 4; The polypeptide PRX-2 has a p.Arg168SerfsTer55 mutation compared to the protein encoded by the wild-type PRX gene with a sequence of SEQ ID NO:

4.

6. The PRX gene mutant according to claim 5, characterized in that: The PRX gene mutant is a PRX gene compound mutant, and the PRX gene compound mutant includes a compound heterozygous mutation, and the compound heterozygous mutation includes a c.3149G>A mutation and a c.501dup mutation.

7. The PRX gene mutant according to claim 5, characterized in that: The PRX gene mutant is a PRX composite mutant protein encoded by the PRX gene complex, and the PRX composite mutant protein has a p.Trp1050Te mutation and a p.Arg168SerfsTer55 mutation.

8. Use of a reagent for detecting the PRX gene mutant of claim 5 in preparing a product for screening Dejerine-Sottas disease.

9. Use of the reagent for detecting the PRX gene mutant in claim 5 according to claim 8 in preparing a product for screening Dejerine-Sottas disease; characterized in that: When the product used to screen for Dejerine-Sottas disease is a product used to diagnose Dejerine-Sottas disease: The reagent for detecting the PRX gene mutant in claim 8 is a detection reagent for nucleic acid PRX-1 and nucleic acid PRX-2; When the product for screening for Dejerine-Sottas disease is a product for diagnosing autosomal recessive Dejerine-Sottas disease: The reagent for detecting the PRX gene mutant in claim 8 is a detection reagent for nucleic acid PRX-1 or nucleic acid PRX-2.

10. Use of the reagent for detecting the PRX gene mutant in claim 5 according to claim 9 in preparing a product for screening Dejerine-Sottas disease; characterized in that: The reagent for detecting the PRX gene mutant in claim 8 is at least one of a probe and a primer specific for the PRX gene mutant, and the primer is at least a primer pair: F-CAGGTTTGCTCTCCCCAAGT, R-CACCTGAACCCTGTAGCCTG.

Images