Fluorescent quantitation reference gene suitable for drought stress of Malus hupehensis and primer and application of fluorescent quantitation reference gene

Abstract

The invention provides a fluorescent quantitation reference gene suitable for drought stress of Malus hupehensis and a primer and application thereof. The reference gene provided by the invention is polynucleotide as shown in SEQ ID NO: 1. The method fills up the current situation that the malus spectabilis does not have the reference gene, provides powerful support for accurate quantification of the malus spectabilis drought resistance related functional gene, can improve the stability and accuracy of research, and has important significance.

Description

Technical Field

[0001] The invention relates to the technical field of plant molecular biology, and in particular to an internal reference gene suitable for drought stress fluorescence quantification of Malus variegatedefolia and primers thereof and applications thereof. Background Art

[0002] Malus transitoria is a shrub of the genus Malus in the Rosaceae family. It is tolerant to salinity, drought and desertification, and is often used as a soil and water conservation tree species in afforestation. It has high ecological value in Northwest my country and other places. It is also a plant endemic to China. It is used as a raw material for making Tibetan tea in Tibet, Qinghai and Sichuan. It has high research value and application prospects.

[0003] When studying the expression of target genes, internal reference genes are required. Commonly used internal reference genes will show unstable characteristics in different tissues of different plants, different developmental stages, and different stress treatments, such as salinity stress, drought stress, and heavy metal stress, thus affecting the accuracy of target gene detection.

[0004] There is currently no internal reference gene specifically used in Malus research. Summary of the invention

[0005] In order to solve the above technical problems, the inventors of the present application studied Malus variegatedus, screened out candidate genes with stable expression, evaluated the stability of the candidate genes, and obtained internal reference genes suitable for Malus variegatedus. Moreover, these internal reference genes are stable even under different degrees of drought stress and are still suitable as internal reference genes. Further, based on these genes, primers suitable for real-time fluorescence quantitative PCR were screened and developed. The present invention fills the gap that Malus variegatedus has no internal reference genes, provides strong support for the study of gene expression levels of Malus variegatedus and even Malus plants, and improves the stability and accuracy of the research.

[0006] Based on the above, the present invention provides the following technical solutions and requests protection:

[0007] The present invention provides the following internal reference genes as described in any of (1) to (7):

[0008] (1) The reference gene as shown in (a) or (b) or (c) below:

[0009] (a): an internal reference gene as set forth in SEQ ID NO: 1; or a polynucleotide having a sequence with 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as set forth in SEQ ID NO: 1, or a polynucleotide derived from the genus Malus and being a natural allele of the internal reference gene as set forth in SEQ ID NO: 1, or a polynucleotide having a sequence with 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as set forth in SEQ ID NO: 1 and derived from the genus Malus and being a natural allele of the internal reference gene as set forth in SEQ ID NO: 1;

[0010] (b): a fragment of the reference gene described in (a) and the fragment can be specifically amplified;

[0011] (c) an internal reference gene as shown in nucleotides 845 to 1103 of SEQ ID NO:1; or a polynucleotide having a sequence having 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in nucleotides 845 to 1103 of SEQ ID NO:1, or a polynucleotide derived from the genus Malus and being a natural allele of the internal reference gene as shown in nucleotides 845 to 1103 of SEQ ID NO:1, or a polynucleotide having a sequence having 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in nucleotides 845 to 1103 of SEQ ID NO:1 and being derived from the genus Malus and being a natural allele of the internal reference gene as shown in nucleotides 845 to 1103 of SEQ ID NO:1;

[0012] (2) An internal reference gene as shown in (d), (e), or (f) below:

[0013] (d) an internal reference gene as shown in SEQ ID NO: 2; or a polynucleotide having a sequence with 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in SEQ ID NO: 2, or a polynucleotide derived from the genus Malus and being a natural allele of the internal reference gene as shown in SEQ ID NO: 2, or a polynucleotide having a sequence with 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in SEQ ID NO: 2 and derived from the genus Malus and being a natural allele of the internal reference gene as shown in SEQ ID NO: 2;

[0014] (e): A fragment of the polynucleotide described in (d) that can be specifically amplified;

[0015] (f) an internal reference gene as shown in nucleotides 1128 to 1401 of SEQ ID NO:2; or a polynucleotide having a sequence having 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in nucleotides 1128 to 1401 of SEQ ID NO:2, or a polynucleotide derived from the genus Malus and being a natural allele of the internal reference gene as shown in nucleotides 1128 to 1401 of SEQ ID NO:2, or a polynucleotide having a sequence having 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in nucleotides 1128 to 1401 of SEQ ID NO:2 and being derived from the genus Malus and being a natural allele of the internal reference gene as shown in nucleotides 1128 to 1401 of SEQ ID NO:2;

[0016] (3) The reference gene as shown in (g), (h), or (i) below:

[0017] (g): an internal reference gene as shown in SEQ ID NO: 3; or a polynucleotide having a sequence with 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in SEQ ID NO: 3, or a polynucleotide derived from the genus Malus and being a natural allele of the internal reference gene as shown in SEQ ID NO: 3, or a polynucleotide having a sequence with 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in SEQ ID NO: 3 and derived from the genus Malus and being a natural allele of the internal reference gene as shown in SEQ ID NO: 3;

[0018] (h): A fragment of the polynucleotide described in (g) that can be specifically amplified;

[0019] (i) an internal reference gene as shown in nucleotides 1874 to 2179 of SEQ ID NO:3; or a polynucleotide having a sequence with 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in nucleotides 1874 to 2179 of SEQ ID NO:3, or a polynucleotide derived from the genus Malus and being a natural allele of the internal reference gene as shown in nucleotides 1874 to 2179 of SEQ ID NO:3, or a polynucleotide having a sequence with 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in nucleotides 1874 to 2179 of SEQ ID NO:3 and being derived from the genus Malus and being a natural allele of the internal reference gene as shown in nucleotides 1874 to 2179 of SEQ ID NO:3;

[0020] (4) Reference gene composition: consisting of the reference gene shown in (1) and the reference gene shown in (2) above;

[0021] (5) Reference gene composition: consisting of the reference gene shown in (1) and the reference gene shown in (3) above;

[0022] (6) Reference gene composition: consisting of the reference gene shown in (2) and the reference gene shown in (3) above;

[0023] (7) Reference gene composition: composed of the reference gene shown in (1), the reference gene shown in (2) above, and the reference gene shown in (3) above.

[0024] Among the above-mentioned internal reference genes, the Malus genus is preferably Malus variegated.

[0025] The present invention isolates and obtains the internal reference gene of cDNA sequence as shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 from Malus floridula, and further selects one of the fragments as the internal reference gene for experiment. However, the internal reference gene involved in the technical solution claimed for protection of the present invention does not only refer to the gene or its fragment shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3, but also includes the natural allele or its fragment that is an allele of the gene or its fragment shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3. According to the common knowledge of the skill, due to the existence of natural variation, there are often some sequence differences between natural alleles, resulting in the sequence similarity between natural alleles being 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more. Of course, the functions of these natural alleles are the same, that is, their expression levels are stable under normal conditions and under drought stress conditions, and they can be used as internal reference genes.

[0026] The above-mentioned natural allele is an allele that exists in plants and has not been artificially modified. The above-mentioned natural allele can be derived from Malus transitoria, specifically, from natural individuals of Malus transitoria, i.e., wild resources, or from different varieties of Malus transitoria, i.e., artificially modified resources. The above-mentioned natural allele can be derived from plants of other species in the genus Malus, or from natural individuals thereof, i.e., wild resources, or from different varieties thereof, i.e., artificially modified resources.

[0027] In the above-mentioned internal reference genes, the description involving sequence similarity includes the sequence similarity of genomic DNA sequences and the sequence similarity of cDNA sequences.

[0028] In the above technical solutions, specific amplification refers to using DNA or RNA of apple plants or Malustransitoria as a template, using primers to perform PCR amplification, and the amplified product is a target specific fragment (such as the intercepted fragment), which theoretically does not contain other fragments. Of course, in practical operations, due to various uncontrollable reasons, some other fragments may also be contained, but in the cognition of those skilled in the art, it is acceptable and does not affect the identification and use of specific fragments.

[0029] Any of the above-mentioned internal reference genes is applicable to the detection of gene expression levels of any species in the genus Malus. The detection can be performed within the range of one or several species, or within the range of the entire genus Malus. As a specific example, it is used for the detection of gene expression levels of Malus transitoria.

[0030] The above-mentioned internal reference genes can be used for detecting gene expression levels in plants under normal conditions (ie, without any stress conditions), and can also be used for detecting gene expression levels in plants under different degrees of drought stress conditions.

[0031] Preferably, the method for detecting the expression level of plant genes is real-time fluorescence quantitative PCR.

[0032] The present invention provides any of the following primer pairs or primer pair combinations:

[0033] (1) a primer pair for amplifying the internal reference gene described in (1) above;

[0034] (2) a primer pair for amplifying the internal reference gene described in (2) above;

[0035] (3) a primer pair for amplifying the internal reference gene described in (3) above;

[0036] (4) a combination of the primer pair described in (1) above and the primer pair described in (2) above;

[0037] (5) a combination of the primer pair described in (1) above and the primer pair described in (3) above;

[0038] (6) a combination of the primer pair described in (2) above and the primer pair described in (3) above;

[0039] (7) A combination of the primer pair described in (1) above, the primer pair described in (2) above, and the primer pair described in (3) above.

[0040] The primer pair for amplifying the internal reference gene described in (1) above is: the primer pair shown as SEQ ID NO:4 and SEQ ID NO:5, or, a primer pair for amplifying the internal reference gene described in (c) above, wherein the upstream primer sequence has a similarity of 98% or more, 99% or more, or 99.5% or more to SEQ ID NO:4, and the downstream primer sequence has a similarity of 98% or more, 99% or more, or 99.5% or more to SEQ ID NO:5;

[0041] The primer pair for amplifying the internal reference gene described in (2) above is: the primer pair shown as SEQ ID NO: 6 and SEQ ID NO: 7, or, for amplifying the internal reference gene described in (f) above, the upstream primer sequence has a similarity of 98% or more, 99% or more, or 99.5% or more to SEQ ID NO: 6, and the downstream primer sequence has a similarity of 98% or more, 99% or more, or 99.5% or more to SEQ ID NO: 7;

[0042] The primer pair for amplifying the internal reference gene described in (3) above is: a primer pair as shown in SEQ ID NO: 8 and SEQ ID NO: 9; or, a primer pair for amplifying the internal reference gene described in (i) above, wherein the upstream primer sequence has a similarity of 98% or more, 99% or more, or 99.5% or more to SEQ ID NO: 8, and the downstream primer sequence has a similarity of 98% or more, 99% or more, or 99.5% or more to SEQ ID NO: 9.

[0043] Wherein, any of the above-mentioned primer pairs or primer pair combinations are primer pairs used to amplify corresponding internal reference genes when detecting the expression level of plant genes.

[0044] Any of the above primer pairs or primer pair combinations are applicable to the detection of gene expression levels of any species in the genus Malus. The detection can be performed within the range of one or several species, or within the range of the entire genus Malus. As a specific example, it is used for the detection of gene expression levels of Malus transitoria.

[0045] The internal reference gene amplified by the above primer pair or primer pair combination is an internal reference gene suitable for detecting the gene expression level of plants under drought stress conditions or under no stress conditions.

[0046] Preferably, the method for detecting gene expression level is real-time fluorescence quantitative PCR.

[0047] The use of any of the above-mentioned internal reference genes in detecting the expression level of plant genes is also a technical solution provided by the present invention.

[0048] The use of any of the above-mentioned primer pairs or primer pair combinations in detecting plant gene expression levels is also a technical solution provided by the present invention.

[0049] In the application technology solution, the plant is any plant in the genus Malus; further preferably, the plant is Malus transitoria.

[0050] In this application technology solution, detection can be carried out within the range of one or several species, or within the range of the entire genus Malus.

[0051] In this application technology solution, the gene expression level in plants under normal conditions (ie, without any stress conditions) can be detected, or the gene expression level in plants under different degrees of drought stress conditions can be detected.

[0052] Preferably, the method for detecting the expression level of plant genes is real-time fluorescence quantitative PCR.

[0053] The present invention also provides a method for detecting the expression level of a plant gene, comprising the following steps (a) or (b):

[0054] (a) using any of the above-mentioned internal reference genes as an internal reference gene;

[0055] (b) using any of the primer pairs or primer pair combinations described above as primers for amplifying an internal reference gene.

[0056] In the technical solution of the method, the plant is any plant in the genus Malus; further preferably, the plant is Malus transitoria.

[0057] In the technical solution of the method, detection can be carried out within the range of one or several species of the genus Malus, or within the range of the entire genus Malus.

[0058] In the technical scheme of the method, the gene expression level in the plant under normal conditions (ie without any stress conditions) can be detected, or the gene expression level in the plant under different degrees of drought stress conditions can be detected.

[0059] Preferably, the method for detecting the expression level of plant genes is real-time fluorescence quantitative PCR.

[0060] The "drought stress conditions" described in any part of the present invention may refer to natural drought conditions or any artificial drought conditions, without limitation, and all fall within the scope of protection claimed by the present invention. In addition, there is no limitation on the degree of drought, and any drought condition considered by those skilled in the art to be a drought condition falls within the "drought stress conditions" described in the present invention.

[0061] Detection of gene expression level: Genes include genes encoding proteins or functional RNA molecules, genes acting as regulatory elements, and any other genes. It can refer to detection at the DNA level or detection at the RNA level. Expression level generally refers to expression amount, relative expression amount or absolute expression amount, which can be determined by technicians in this field according to actual needs without limitation.

[0062] Herein, SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 all refer to the cDNA sequence of a gene. It is well known in the art that a gene can be described by a genomic DNA sequence or a cDNA sequence, and the two are essentially the same, and the genes defined by the two are the same gene. Although the present invention uses cDNA sequences such as SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 to describe the internal reference gene, the internal reference gene defined by it is not limited to these specific sequences. If it is described by a genomic DNA sequence, as long as the gene described by it is the same internal reference gene as the internal reference gene of the present invention, it is also within the protection scope of the present invention.

[0063] The present invention uses Malus multiflorus as a sample, studies its genes that are stably expressed under drought stress and non-stress conditions as candidate internal reference genes, sequentially analyzes transcriptome data analysis, common PCR analysis, fluorescence quantitative PCR analysis, amplification curve and melting curve analysis, and uses four methods, GeNorm, Normfinder, BestKeeper and delta Ct value, to analyze and rank the stability of these internal reference genes, and screens out the genes with the best expression stability under drought stress as internal reference genes. Based on these genes, real-time fluorescence quantitative PCR primers are designed to fill the current situation that Malus multiflorus has no internal reference genes, provide strong support for the accurate quantification of functional genes related to drought resistance in Malus multiflorus, and improve the stability and accuracy of the research, which is of great significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 The phenotypes under five treatments are shown.

[0065] Figure 2 Electrophoresis test chart for primer specificity screening.

[0066] Figure 3 This is the melting curve derivative spectrum of qRT-PCR. The horizontal axis is the reaction temperature, and the vertical axis is the negative first derivative of the fluorescence signal change (dR / dT).

[0067] Figure 4 It is the qRT-PCR amplification curve. The horizontal axis is the amplification cycle number, and the vertical axis is the real-time fluorescence signal intensity during the reaction process.

[0068] Figure 5 The Ct value changes of 18 candidate reference genes.

[0069] Figure 6 The Venn diagram of candidate genes. DETAILED DESCRIPTION

[0070] The following are some specific embodiments of the present invention, wherein the technical means or reagents used are conventional methods and reagents known in the art unless otherwise specified.

[0071] Example

[0072] The source of variegated begonia: The variegated begonia seeds were collected from the Huzhu Beishan Forest Farm in Haidong City, Qinghai Province, China in September 2021 and artificially planted in 2022.

[0073] Two-year-old Malus variegated seedlings with good and consistent growth were selected as experimental materials. Five groups of experimental samples were set up, and three biological replicates were set up for each treatment. One group was set up as the CK control group, and the other four groups were watered three times in a cycle of 3 days, 6 days, 9 days, and 12 days, with 200 ml of water each time. Samples were taken the next day after the third watering. Five tubes were taken for each treatment and quickly frozen in liquid nitrogen, and placed in a -80℃ refrigerator for RNA extraction and gene expression analysis. The control group was watered every day to keep the soil surface moist.

[0074] RNA was extracted using the TaKaRa MiniBEST Plant RNA Extraction Kit, and the total RNA obtained was detected using an Agilent 2100 bioanalyzer.

[0075] The starting RNA for library construction is total RNA. Oligo(dT) magnetic beads are used to enrich mRNA with polyA tails, and then divalent cations are used to randomly interrupt the obtained mRNA in Fragmentation Buffer. The fragmented mRNA is used as a template and random oligonucleotides are used as primers to synthesize the first chain of cDNA in the M-MuLV reverse transcriptase system. The RNA chain is then degraded with RNaseH, and the second chain of cDNA is synthesized with dNTPs as raw materials in the DNApolymerase I system. The purified double-stranded cDNA is end-repaired, A-tailed, and connected to sequencing adapters. AMPure XP beads are used to screen cDNA of about 370 to 420 bp, PCR amplification is performed, and AMPure XP beads are used to purify the PCR product again to finally obtain the library.

[0076] After the library construction is completed, Qubit2.0 Fluorometer is used for preliminary quantification, and the library is diluted to 1.5 ng / ul. Then, the insert size of the library is detected using Agilent 2100 bioanalyzer. After the insert size meets expectations, qRT-PCR is used to accurately quantify the effective concentration of the library (the effective concentration of the library is higher than 1.5 nM) to ensure the quality of the library.

[0077] After library construction, sequencing was performed on the illimina sequencing platform.

[0078] Table 1 Sequencing results of samples

[0079] Sample Raw reads Raw bases Clean reads Clean bases Error rate Q20 Q30 GC pct CK1 21594149 6.5 21163235 6.3 0.03 97.43 93.00 46.48 CK2 21573327 6.5 21161855 6.3 0.03 97.43 93.01 46.88 CK3 21827706 6.5 21359543 6.4 0.03 97.70 93.64 46.76 T1_1 21587576 6.5 21194088 6.4 0.03 97.52 93.22 46.77 T1_2 21533191 6.5 21028288 6.3 0.03 97.65 93.52 46.92 T1_3 20230836 6.1 19273314 5.8 0.03 97.31 92.82 46.53 T2_1 20773243 6.2 20315062 6.1 0.03 97.30 92.82 45.82 T2_2 21101759 6.3 20632463 6.2 0.03 97.41 92.99 46.32 T2_3 21842535 6.6 21320751 6.4 0.03 97.27 92.65 46.63 T3_1 21434510 6.4 21053999 6.3 0.03 97.20 92.53 46.75 T3_2 22668854 6.8 22267204 6.7 0.03 97.74 93.77 47.01 T3_3 20813870 6.2 20433872 6.1 0.03 97.27 92.66 46.74 T4_1 21048730 6.3 20529791 6.2 0.03 97.67 93.59 46.64 T4_2 21211853 6.4 20810699 6.2 0.03 97.19 92.49 46.80 T4_3 21010239 6.3 20592805 6.2 0.03 97.69 93.60 46.49

[0080] Analysis of transcriptome gene expression and gene screening: FeatureCounts (1.5.0-p3) was used to calculate the number of reads mapped to each gene, and to calculate the FPKM of each gene to estimate the gene expression level. The standard deviation and coefficient of variation of the gene expression levels in the five different treatment groups were calculated based on the FPKM value of the gene. Genes were selected based on the criteria that the gene sequencing fragment was greater than 500 bp, the expression levels in the five different treatment groups were less than 4.0, and the coefficient of variation was less than 0.06. The results are shown in Table 2, and 31 candidate genes were obtained.

[0081] Primer design: Primers were designed from the original fasta files obtained from transcriptome sequencing using Primer5.0 software. The length of the primers was 20-25 bp, the CG content was 45%-55%, and they were synthesized by Shanghai Jierui Bioengineering Co., Ltd. The upstream and downstream primers were diluted to a working concentration of 10uM before the experiment.

[0082] Table 2 Candidate reference genes

[0083]

[0084]

[0085] Synthesis of the first strand of cDNA: cDNA was synthesized using the FastKing gDNA Dispelling RT SuperMix Kit with less than 50 ng of total RNA in a total volume of 20 μL. The recommended thermal cycling conditions were as follows: 42°C for 15 minutes, followed by 95°C for 3 minutes.

[0086] First, the specificity of the primers was verified by ordinary PCR. The reaction system was 20 μL, including: 1 μL template (first-chain cDNA), 10 μL 2×Premix Taq (Takara, Japan), 0.5 μL upstream primer (20 μM), 0.5 μL downstream primer (20 μM), and 8 μL sterilized water. The reaction procedure was: 95°C pre-denaturation for 5 min; 95°C denaturation for 15 s, 56°C annealing for 35 s, 72°C extension for 32 s, a total of 48 cycles, and 72°C post-extension for 2 min. The specificity of the amplified product was then verified by 1.5% agarose gel electrophoresis. The results are as follows: Figure 2 , the double bands (18s, 28s) are clear without dragging and have good integrity, which can be used for the next step of research.

[0087] TB GreenTM Premix Ex TaqTMⅡ(Tli RNaseH Plus) kit was used for qRT-PCR test, and the reaction was carried out on BIO-RAD CFX Connect Real-Time Systern (Bio-Rad Biomedical Products Co., Ltd., Shanghai). The reaction used 0.4μL Malus floridiana first-strand cDNA as template, and TB GreenTM Premix ExTaqTMⅡ(Tli RNaseH Plus)(2×)10μL, PCR Forward Primer(10μM)0.3μL, PCR Reverse Primer(10μM)0.3μL were added, totaling 20μL system. The reaction program was: 95℃30min; 95℃5s, 60℃30s.

[0088] Microsoft Excel 2010 was used to perform statistical analysis on the cycle threshold (Ct) in the qRT-PCR results, and Origin was used to draw a bar graph of the Ct value changes to analyze the stability of the candidate internal reference genes and evaluate whether they are suitable for use as internal reference genes in fluorescent quantitative PCR reactions. Venn diagrams were also drawn for the top ten candidate genes.

[0089] The experimental results of 18 candidate genes were computationally verified using the RefFinder platform based on the GeNorm, Normfinder and BestKeeper software algorithms, and the most accurate and appropriate internal reference genes were obtained by combining various methods.

[0090] Using cDNA from five different drought stress treatment groups of Malus variegatedefolia as template, fluorescence quantitative PCR analysis was performed according to the designed primers. The melting curves of 18 candidate internal reference genes in the five treatment groups showed only a single main peak, with no other peaks before and after ( Figure 3 ) indicates high specificity; the amplification curve is S-shaped, with no other abnormal fluctuations ( Figure 4 ).

[0091] Analysis of the CT values ​​of 18 candidate reference genes in Malus variegata under different drought stresses by quantitative PCR Figure 5 The cycle threshold (Ct) is an important criterion for selecting internal reference genes. The stability of gene expression can be judged by the changing trend of the Ct value.

[0092] Table 3. cT value analysis of fluorescence quantitative PCR results

[0093]

[0094] Analysis of the expression stability of reference genes based on software: When analyzing with GeNorm software, the default stability value below 1.5 is the numerical range of stable expression of reference genes. In the data obtained by NormFinder software, the expression stability value is negatively correlated with gene stability, that is, the smaller the value, the more stable the gene expression. BestKeeper software uses the Ct value obtained by qRT-PCR reaction to judge the stability of reference gene expression. The lower the standard deviation (SD) and coefficient of variation (CV), the better the stability of gene expression. The results are as follows Figure 6 .

[0095] Table 4. Expression stability of candidate reference genes analyzed by three software

[0096]

[0097] The nucleotide sequences of Cluster-23533.34641, Cluster-23533.37693, and Cluster-23533.39576 and the primers for quantitative PCR are as follows:

[0098] The nucleotide sequence of Cluster-23533.34641 is shown in SEQ ID NO:1.

[0099] ATAATTTTGAGTTCGATCATCGTCCTCATCGTCCTCGCTTCAAAATCAAGCAAAGCATCGCCGAATTTAGTTCCTCACCATCAATCAGAAACCACAACTTTTCAAATTCGAAAATTATAATAGTAA

[0100] TAAAAATATGGAGAGGGTGATGAACGTAATAAAGCCAAAGCCAAATCCACAGCAGCAATTGAGAGATTGGCAGCGCAAGCTTCGCCAAGAGTGCCGCAACATCGAACGACAAATTCGAGATATACA

[0101] AAGAGAAGAGAAAAGTGTGCAGAAAGCAATCAGAGAGGCTGCCAAGAGGAATGACATGGGTTCTGCAAAGGTATTATTTTTTCCCCTTTTAAATTTGGTTCTGAGCCAAGGCTTTGAACTCCAAATTC

[0102] TCCAAATTTGTGCATTTTATTTTGGTTCTGTTAATTTTGATGAGTTTGTTGTCTCTGAATTTCCTTTGATTTACACCAAATCATAGTATTAGTAGGATCCACAGAGTACATGTTTCGGTTAATTTGAACGA

[0103] AATCGAAATGGGATAGAAATGTCCAGTCCAGCCATTATAATATTGCTCTGTTTTTTCTACTCGGACTGTGAACTTATACAACTGAACTTTTCATTCTGTACTTATAGCTACTAAATGTTAATGAAGGGA

[0104] GATGAGTGACTGTCAATTTAATTATGATCCCTGCGATCGGTTTCTGTGTTGTATGATAGTTTATAAATTGACAGAACTTATCTTAGATTAGTTTGTTAGTTTAATTACCCGCTGTTGTTTGACATTCCATG

[0105] CGGTCATCCATCTTCCCTTCTGTATATCCAGTTATCTACTTTGTGTTAATTATTTCAGTCACTTGCTAAAGAAATTGTGAGATCTAGAAGGACAGTGAACCGTCTTCATGAAAATAGGGCACAGCTGAA

[0106] TTCAATATCAATGCACCTTGGGGAGAGTGTTGCTATTGCCCGTACAGTGGGACATTTATCCAAGAGTTCTGAGGTTATGAAGCTTGTCAATAACCTCATGAAGGCTCCTGAAGTGGCTGTTACGATGCA

[0107] AGAATTTAGCAAGGAGATGACCAAGGCAGGAGTAATTGAAGAGGTGGTGAATGATAGTCTTGACACAGCACTAGACTCCGAGGACATAGAAGAAGAAATAGAAGAAGAAGTCGACAAAGTTTTGAC

[0108] TTCTATAGCTGGTGAGACTGCTGCCCAGCTTCCAGAAGCGGTCAGGAAGGAGAGGCTGAAGCAACCTGCTACTGCACAAGCTAGACAGGAGGTATGTGTGACGTGACTGTCATGAAGTCCCACTTCA

[0109] AGTCATAAGTTTCTACGTTTCAAAGAAGCCGAACAATATGATACATCATTTTGCTTCTGCAGGAAGAGGCAATAGCTGAGGGTGTCGATGATGAGGCAGAGTTGGAAGAAATAAGGGCCCGGCTTGC

[0110] AAACGTTAGGTCATAAGATAAGTTGAAGCCCTTCAGCCATTCTCCTTTATCTGACCGGATTCTGCAGTAAAGCCCGTGTTTACCACCGACCGAGGACACCGGAGATGTATTGTCTACTGTATATTAAAT

[0111] TGAAGCAGCTTCCGAAAGAGTTTACAAGTAAGCTGTTATTGTGCAATATTCAAATGCAAAACTGATTTCGTGAAACTTGCAACCAAACTAGTATCACTGTGTATTGCGTTGCGTATGTTATTCTATCGT

[0112] TGGTAACTGCGGCTGGAGCTTCGATCTACTTTCTCCGTGTATTTACGCTCAATATGTGTACTCAAAACGGATTGCAATTTACGCATGAAAAGTATTGCACTCATGCATCATCCGTTCTTTTTACATGTTA

[0113] TCCGTTCTTTAGCAATAAGGTGTTGATAACGCATGAATTTTGAACATAACATACGGACATGTTACCGTTTCAATGACCACATTTAGCTTTAGGAACTTGTGGTTGCATCAGATTTCACCTATCATTATCC

[0114] AATTCTCCTTTTTAGACT

[0115] The nucleotide sequence of Cluster-23533.37693 is shown in SEQ ID NO:2.

[0116] AAAAGCACAAGCCAATAAATCAGTCCTTGAGCTAGAAGAACAAGAAATCTCTGAAGCCTGGATCGCCCTTGACCAGTTACTAGTAATTCCCTCTCTCTCACGTTAGATTTGTTTGCTCTGTCAAAT

[0117] GGAGAAGGATCAGAAGGTTGCATCGGAAGAAGACCCCAAGATCGATTTGTTCGAAGACGACGACGAGTTCGAGGAATTCAACATCAATGAAGGTAAGTTTTGGAACCCTAATTTTGTTTATTATCTAT

[0118] AGTTATATATATTTTTTAGTAGTTAGTAGGTATGCAGCTATTTGTTCTGTAATTGTTTCCAATTACTTCATAGAATTGATAAATTGAAGTGGGTTTTGTTTCGATTTACTTCTTGCTATTATTTTTAAACTA

[0119] ATAAGATCGTCCCGCTACTTTTACTTGCGAAACTGATTCGTTGCGAGGAGCGTGTAATTCGTATATTCTAGCATTATCTTAGCATACAGTCCATCTAGTCTGGTCTTTGAAGATAATGATGATTGCGAA

[0120] ATAATTGCTAGAGGAACCTCCTGATTTCGTGTTGTTATCTTCGATTGTTGTATGAAATATCCAAGCTTGTAAATTGATTTTGGCATCAGAGCACCAATGCCCCGCGATGATGCGAAGGAGGTTACTTGT

[0121] TGAGGCAGATAGCATTATGGCATTGATTCTTTGTGCTAAACAGGATATTTGGTTTCGTTTTAGGATGCTGCGGCGGCATCTATGTTTTGTATTTTGTAATTGAGGCAGCCTTCGGTGGATATTATTTTCA

[0122] GGATATGAAACAGCGGATTGAGAAATAACGAGGTTTGAACTTGGATGTTACAACACGATGAAGTCATACGAAGATGCTTGTAGTTATAAACTATGACTACAGATTGTGTTGGTGGAATACATTCTTCC

[0123] ATTTAGGCTTCGCCTTTTCGTTTTAATGAACTTTGCGTTTATGAAAGTTATTAAGTTGAACGGGATATACACGATGGGTTTTCTCCCTTAGTTACTGATAGGATAAAGCATTATCTTAAATTTTTGTAATT

[0124] TCTTTTTGTTATTGACTTGGTTCCTGTGTTTATGCGGGCAGAGTGGGATGAGAAGGAAGAAGAGATAGATTCAACACCACAACAATGGGAGGATGATTGGGATGATGATGATGTCAACGATGATTTCT

[0125] CTCTGCAGCTGAAGACGGAACTCGAGAGCAACGCTGAGAAGAGCTAAGTTCATGTCTCATTGGCTTCCTTCCTAATGAACTTCATGATCGTAGTGATTCGGTATAACCTAGTATGCCTGTGATTTGGTG

[0126] GGTAGCCAAGCCCTTTCATTAGAGTATCGAAAACTGCAGTATTTACCGTTCTTGTTAAAAGATAATCGACTTGCAAGATTTCAGTAACTCGTTATGTTCGGAATCATGAAGAGTGATGAGCACCACTTA

[0127] ACTATGTTCTCGCGATTATCGTTCTGTATTTGAATGTGGTCTGTTTCTTCCCTTTGAAGTTTATGTATGAGTCAGTAGTTAAGAAATTTATAGGCTTCGACGTCTAACGTGTTCTAGGACGAAGCTTCTA

[0128] ACTGTATGCATCACTTTCATGGCTATCTCTGCAGCCCCAGATCCCCTTCTTCCTCTTCTATTTCTCCATCTACGCCGTCGACTATCTCACTGTTCGTCAGCTCAGTCTCCTTCTGTAATGCTCTCCCATCTT

[0129] CCCCCTAATCTTCAAACCCATGCGATAGCTATGACCTTCTTTCCCGATTTTTCCTTTTTCGGCATACAATACCATGTCGCCCATTTTCAATAGTTACAAACACATCCCGACGTTCGTAATATGCCAATCA

[0130] ATTTTGTAAGGAGTTG

[0131] The nucleotide sequence of Cluster-23533.39576 is shown in SEQ ID NO:3.

[0132] GGCATACTACCTGGCAATCAGGCATCGAATCTTGGAATCACGGCGACCCAAAGCCAAGCGAACCAAGCCACCACTCCACGCCTATGGCGGTCCTTCCTCTTCCCCTTCCCCTTCATCTCCTCCCCTT

[0133] TCCTCCCCATCGTCATCGCCTTCTCCTCCGTCCTCCTCCACCCAATTCGCATATAGAATTTCACTCTCACTTTCCACGCGCTCCGCAACTCTCTTTGCTCTTCTGCTCCATCGCCGCCGGCTCGCACTCAAG

[0134] GCATAGAGGGCTGAAGACGCGTCTGTCTGCAACCCAAACCCAAAGGTTCATTTTGCGATTGGGTTTTGGCATCTGGATTTTGCCCGGTTTCCCATTTTCCAGGTACCCATTTGATTATTTCTTTGATTT

[0135] GGTTATTTGGGTTGTGTTGAATTCGGATCTAAATTCGACAAAGTTTGCAACTTTTGAGGTTTACGTTGTGTTATTTTGATTGGTTGTTGGCTGAAATTCGGTTCTTTTGATTTGGTTTTGGTGAAATTGTT

[0136] TCAATCGTCGTCGGGATTGGTGTTCGGGGATATTATGGTTCTCTGTGGTTTTGATAGAGTTGTCATAAATGGAGGATCTTAGTGAAGTTGATGAACATGCTTGTGATTGTTGGCTCGAAGGAAATTATA

[0137] TGGTGTGATCAATACTATGTGTAACAAAGGAATTGCCTGCTTGAGCGACTCCGACTCCGACTCCGAAAACCCAATTGATCATCAGGCTGTATACTTGATGGATAGCCCTTCGGCTACCCCGCACTTTGG

[0138] TTCTAATTCCACCGCTGCTTCGTCCCCCAATTCGAATGACGAAAACCCGCGTGTTAAGTTTCTGTGTAGTTTTTCGGGGAGTATATTGCCCCGCCCACAAGATGGGAAGCTCCGTTATGTGGGAGGAGA

[0139] GACGCGAATTGTGAGTGTTCCACGAGATATCAAGTTTGATGAGTTGATTAACAAAATGAGGGAGCTTTATGAAGGTGCAGCAGTGCTCAAGTATCAGCAACCCGATGAGGACCTTGATGCTCTTGTCT

[0140] CAGTTGTGAACGATGATGATGTGACTAACATGATGGAAGAGTATGATAAGTTGGGATCTGGCGATGGTTTCACTAGGCTCAGGATTTTTTTGTTTTCGCATCCTGACCAGGACAGCTCATCGCACTATG

[0141] AGGGTGATGAAAGGGATAATGAGAGGAGGTATGTCGATGCTCTCAATAATTTAAATGATAGCTCCGAATTCAGGAAGCAATATCCTGAGTCCCCTCTTACTAATCCCGTTGATGACCTCCATATAGCG

[0142] GAACAATTTTTTAGTCCAATGAGTCTTGAGGGTGGCCTTCACGGTCAGAGAAATTGTGATATATCCATGGCTCAAAACAACTTGCATCAGCTCAAGATACCTCATGCAGGATCGGGGCAACACCATCA

[0143] ACCAATTAGTCAGAGGTATAACGAAATGGAAGCTCCTTGGAGTCCTGCATACTATTCTCCCAGGCACCACGCGCACCTTGATCCAAGACCAATGGCTGAGTTTCCTTCCTCTCCTTCCTCTGCACGGTA

[0144] CTGTATGCCGTTTCCAGATGTACCCGATAAATGTTTAGATAGAATGCCTGAAGAATATGCACGACAGCCATTGAATCATCAGCCTCCATATGAACACCAACCACAGTATTCTGAGAATGTTGTATGGC

[0145] TTCCAAGTGGAGCAATAGGTGGTGAAAGGTCAGGATTTCCAGGTAACATTTTTCATGGAAACAATGCCGTCGAAGGAAACAGTATTTGTGAACACTGCCAGATGACTTTCCAGAGAAACCAACCACA

[0146] TTTTGAGCAACCAATCGTGGCAAATGGATTTCAGCATGTTGCTAATCCAAGCGGCAAGTGTACGCCAAATAGAGAGACTTTCGTGATGAATCCAGATGCAAAGTTGCACCATGAAATATACGTAAGTG

[0147] AACAGAATACTGGTCCTCTTCGTTTTAGTGAGACTCCAAATCATGAAAGAGGCTGGACTCCACATCTTCATTTGAATTGCCGGACTGAGGAAGGACGACCACATGCTTCTGGAGCTGGGAAATTGAAT

[0148] GATCCTTACATTGTAGATGGTCACATAAATTTGCCTCTTGGTCCTAATACTGTGGATGACCATCATGTCACTTCCAATTATGTTCATCACCCAGCTGGACCTGAAATGGGAAATGAAGTGTTTCACGAA

[0149] CGATCTGTGGCTGCTCCACCCCATGTACACATTGCTCCTGTAGAAGAGCATGGTGTTCGTCATGGAAATTTTCCTTATCCCTATGGAGGAGATAATATTTATCGGGGGTCTCATGGACATGCACCTGGA

[0150] CAGGCATTATGGAGAAATGTTCAGAGCCCCAATGCATGCTGCGCCCCCTTACGAAGCATCCATTTCTGCTCCACAAGTGAATGTTTCGTTTAATGTGGGATATCTCAGACGTGAAGATAGTCCAGGTGTTT

[0151] TCCATTGGATTAGACAATCAAAATATTTGGGTTGACACCTCGCAGGAAATGTTAGGTTTTGGAAGGAAGCTGTTCCTCCGGACTATTCTTATGGGCACGCTGTGAAGTTGAACCCAAACCCACTCTG

[0152] TCAAGAAAATCATCAAGCATATCCTCCAGACCGCGTTCAACCTACACCTGATATGATAAATTGTGCTATTCCTTTGGACCCCAACTCCATTTTAAGGTTTGAGGAAAAGAGTTCACCTGGAGTAAATGA

[0153] GGTGAATCTTGTGGACAGCGTGGAGAACCCTGAAACAGAGGTTATAAATCCAAACAATCATTGTGATAAAAATGGTCGTGTGGTATCTCTTGAGTCAATAAATTCGAATTTTGCTAAGCTTGCAGAAG

[0154] AAAGTGGTAATGTTGGCAAAACAAGTGACAAGGATCAGTCTACTTGTGCACTTTCAAAGCTTTCTGTTAACAATTTGAGTTTCATACCGGAATTGATTGCTTCTGTTAAAAAAGCTGCTCTAGAGGGGG

[0155] CTAAGGAGGTGAAAACGAATGCTGAAGAAAGTACCGACCCTGAGAGGAGTAGTTCAATAGACAAAGAAGCAGCTGCAAAAAATTTGGAACAACCGAACACTCCTGGAGACAGGGAATTGGATTCTG

[0156] ATAGTGATAATCTAAACAATTCCAAAATTGAGCCAACAAAGGCCGAGGCAGAAGCTATTGCCAAGGGATTGCAGACAATAAGGAATGATGATCTAGAGGAGATCCGAGAATTAGGTTCTGGGACTTA

[0157] CGGGGCTGTGTTTCATGGGAAGTGGAAGGGGTCTGATGTAGCAATAAAGAGAATAAAGTCCAGTTGTTTTGCTGGGAGACCATCAGAAAGAGAACGTTTGATTGCGGATTTCTGGAAGGAGGCTTTA

[0158] ATACTGAGTTCATTGCATCACCCAAATGTTGTTTCAATGTATGGTATTGTGCGAGATGGCCCTGATGGATCTTTAGCAACCGTGACTGAATTCATGGTTAATGGTTCTTTGAAACAGTTTTTGCAGAAA

[0159] AAAGACCGAACAATTGATCGTCGTAAAAGATTGATCATAGCTATGGATGCTGCATTTGGGATGGAGTATCTGCATGGAAAAAATATTGTGCATTTTGATTTAAAGTGTGAAAATCTATTAGTAAATAT

[0160] GAGAGATCCACAACGGCCTGTATGCAAGGTTGGATGATTTAAATATCAAATTCTGTCACCTCCTTTCCACTTTCTTAGCATGCTTTTCTTTTTGGGACTCATATGATGTGTGTACGTTCTTTAGATTGGT

[0161] GATTTGGGATTATCCAAAGTAAAACAACAGACTTTAGTGTCTGGAGGTGTTCGTGGAACTTTACCCTGGATGGCACCTGAGCTTCTTAGCGGGAAAAGTAACATGGTAACAGAGAAGATTGATGTTTA

[0162] CTCATTTGGGATTGTTATGTGGGAACTGCTTACGGGAGAAGAGCCATATACAGATATGCATTGTGCGTCTATAATTGACCTGTTACATAGCCGTGCTTGAGATCTTATATGAATGGTTTGCAAGCTTCT

[0163] TAATATAGGAGGTATTGTGAACAACATGTTGCGCCCTCGAATTCCCACGTGGTGCGACCCAGAATGGAAGTCTTTGATGGAAAGTTGTTGGGCCTCTGATCCTTCCCAGAGGCCATCGTTTTCTGAAAT

[0164] TTCTCAGAAGCTAAGAAATATGGCTGCTGCAATGAATGTGAAATAATTCCAGTCTCGATGAAGTTGATTCGCTTCTTGCATTGTATGTTAGCCAGGACTTAGCCGAAGAGGAAATAAATTTTAAGAAT

[0165] AGATTTTGCAGTTTAAGGGCAGCACTGGTTTCCAAGTATATTGAGGCTAATAGTGTATATTTAAGCAACCTAATGTATACTGCTGTGAAATGGTAATTTTCTTTGGAAAGTGCTGGATATGCGCTTTGC

[0166] AGTGGCTTTTACCTGGAAAAGGCTTCCATCATACACGAAGCGGAGCCATGATGGTTTATAAGTTACTTTGGTTGAGACCAGAATGGCGGTCCCGCTATCGAAGCTGAACCAAGGTTGCTTCCGAATGA

[0167] TGTGTATATACATTAAATGTTATTACCATGTTTAAAAGCTTATATCATGAGACGATAATGACGCATTATGCTCCCAAAATTTACGCAATTGAACTGTTGTTCTTGCTCGTATTCTGGGCCTCTGCTTAGT

[0168] ATCCTAGATACTACAGCTAGGGACATCTGTTTATATGTTCCAACTTTTGCCTTGGCTCTACGAATGTAAAAAGCATGATTATCTGTTAGAACCTCTTCACACTGTTAAGGTCTTGCTTCAGTGTTTATTC

[0169] TCCCTAGCAATAAGACACTCTTAAGTACAAAATTGCTTGGATATTGATCAGATTTGTACCCAGTACAGCGACGGGAATCCAAGTTGATCGGAAAATGTTTGGAACACAATGTGAAATTCTGATGGAAA

[0170] ATACAAATAAACATCGACTTTCTTTTCTTTTATTTACGCTTCTATTATTACTCTTGCAAAGAAGGATGTATGGTACTGTTTACCCAGAAAAACATAAGCTACTACTTTGGTAGCAGTTATTACAAAAA

[0171]

Claims

1. The internal reference gene is any of the following: (1) The reference gene as shown in (a) or (b) or (c) below: (a): an internal reference gene as set forth in SEQ ID NO: 1; or a polynucleotide having a sequence with 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as set forth in SEQ ID NO: 1, or a polynucleotide derived from the genus Malus and being a natural allele of the internal reference gene as set forth in SEQ ID NO: 1, or a polynucleotide having a sequence with 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as set forth in SEQ ID NO: 1 and derived from the genus Malus and being a natural allele of the internal reference gene as set forth in SEQ ID NO: 1; (b): a fragment of the reference gene described in (a) and the fragment can be specifically amplified; (c) an internal reference gene as shown in nucleotides 845 to 1103 of SEQ ID NO:1; or a polynucleotide having a sequence having 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in nucleotides 845 to 1103 of SEQ ID NO:1, or a polynucleotide derived from the genus Malus and being a natural allele of the internal reference gene as shown in nucleotides 845 to 1103 of SEQ ID NO:1, or a polynucleotide having a sequence having 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in nucleotides 845 to 1103 of SEQ ID NO:1 and being derived from the genus Malus and being a natural allele of the internal reference gene as shown in nucleotides 845 to 1103 of SEQ ID NO:1; (2) An internal reference gene as shown in (d), (e), or (f) below: (d) an internal reference gene as shown in SEQ ID NO: 2; or a polynucleotide having a sequence with 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in SEQ ID NO: 2, or a polynucleotide derived from the genus Malus and being a natural allele of the internal reference gene as shown in SEQ ID NO: 2, or a polynucleotide having a sequence with 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in SEQ ID NO: 2 and derived from the genus Malus and being a natural allele of the internal reference gene as shown in SEQ ID NO: 2; (e): A fragment of the polynucleotide described in (d) that can be specifically amplified; (f) an internal reference gene as shown in nucleotides 1128 to 1401 of SEQ ID NO:2; or a polynucleotide having a sequence having 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in nucleotides 1128 to 1401 of SEQ ID NO:2, or a polynucleotide derived from the genus Malus and being a natural allele of the internal reference gene as shown in nucleotides 1128 to 1401 of SEQ ID NO:2, or a polynucleotide having a sequence having 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in nucleotides 1128 to 1401 of SEQ ID NO:2 and being derived from the genus Malus and being a natural allele of the internal reference gene as shown in nucleotides 1128 to 1401 of SEQ ID NO:2; (3) The reference gene as shown in (g), (h), or (i) below: (g): an internal reference gene as shown in SEQ ID NO: 3; or a polynucleotide having a sequence with 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in SEQ ID NO: 3, or a polynucleotide derived from the genus Malus and being a natural allele of the internal reference gene as shown in SEQ ID NO: 3, or a polynucleotide having a sequence with 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in SEQ ID NO: 3 and derived from the genus Malus and being a natural allele of the internal reference gene as shown in SEQ ID NO: 3; (h): A fragment of the polynucleotide described in (g) that can be specifically amplified; (i) an internal reference gene as shown in nucleotides 1874 to 2179 of SEQ ID NO:3; or a polynucleotide having a sequence having 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in nucleotides 1874 to 2179 of SEQ ID NO:3, or a polynucleotide derived from the genus Malus and being a natural allele of the internal reference gene as shown in nucleotides 1874 to 2179 of SEQ ID NO:3, or a polynucleotide having a sequence having 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more similarity to the sequence of the internal reference gene as shown in nucleotides 1874 to 2179 of SEQ ID NO:3 and being derived from the genus Malus and being a natural allele of the internal reference gene as shown in nucleotides 1874 to 2179 of SEQ ID NO:3; (4) Reference gene composition: consisting of the reference gene shown in (1) and the reference gene shown in (2) above; (5) Reference gene composition: consisting of the reference gene shown in (1) and the reference gene shown in (3) above; (6) Reference gene composition: consisting of the reference gene shown in (2) and the reference gene shown in (3) above; (7) Reference gene composition: composed of the reference gene shown in (1), the reference gene shown in (2) above, and the reference gene shown in (3) above.

2. The internal reference gene according to claim 1, characterized in that: The genus Malus is Malustransitoria; And / or, the internal reference gene is an internal reference gene applicable to a plant in the genus Malus, preferably, the plant in the genus Malus is Malus transitoria.

3. The internal reference gene according to claim 1 or 2, characterized in that: The internal reference gene is an internal reference gene used to detect the gene expression level of plants under drought stress conditions or under no stress conditions; Preferably, the method for detecting gene expression level is real-time fluorescence quantitative PCR.

4. Any of the following primer pairs or primer pair combinations: (1) a primer pair for amplifying the internal reference gene described in claim 1 (1); (2) a primer pair for amplifying the internal reference gene described in claim 1 (2); (3) a primer pair for amplifying the internal reference gene described in claim 1 (3); (4) a combination of the primer pair described in (1) above and the primer pair described in (2) above; (5) a combination of the primer pair described in (1) above and the primer pair described in (3) above; (6) a combination of the primer pair described in (2) above and the primer pair described in (3) above; (7) A combination of the primer pair described in (1) above, the primer pair described in (2) above, and the primer pair described in (3) above.

5. The primer pair or primer pair combination according to claim 4, characterized in that: The primer pair for amplifying the internal reference gene described in claim 1 (1) is: the primer pair shown in SEQ ID NO: 4 and SEQ ID NO: 5, or the primer pair for amplifying the internal reference gene described in claim 1 (c), wherein the upstream primer sequence has a similarity of 98% or more, 99% or more, or 99.5% or more to SEQ ID NO: 4, and the downstream primer sequence has a similarity of 98% or more, 99% or more, or 99.5% or more to SEQ ID NO: 5; The primer pair for amplifying the internal reference gene described in claim 1 (2) is: the primer pair shown in SEQ ID NO: 6 and SEQ ID NO: 7, or the primer pair for amplifying the internal reference gene described in claim 1 (f), wherein the upstream primer sequence has a similarity of 98% or more, 99% or more, or 99.5% or more to SEQ ID NO: 6, and the downstream primer sequence has a similarity of 98% or more, 99% or more, or 99.5% or more to SEQ ID NO: 7; The primer pair for amplifying the internal reference gene described in claim 1 (3) is: a primer pair as shown in SEQ ID NO: 8 and SEQ ID NO: 9; or, a primer pair for amplifying the internal reference gene described in claim 1 (i), wherein the upstream primer sequence has a similarity of more than 98%, more than 99%, or more than 99.5% to SEQ ID NO: 8, and the downstream primer sequence has a similarity of more than 98%, more than 99%, or more than 99.5% to SEQ ID NO:

9.

6. The primer pair or primer pair combination according to claim 4 or 5, characterized in that: The primer pair is a primer pair used to amplify an internal reference gene when detecting the expression level of a plant gene; Preferably, the plant is a plant of the genus Malus; More preferably, the Malus plant is Malus transitoria.

7. The primer pair or primer pair combination according to any one of claims 4 to 6, characterized in that: The internal reference gene is an internal reference gene used to detect the gene expression level of plants under drought stress conditions or under no stress conditions; Preferably, the method for detecting gene expression level is real-time fluorescence quantitative PCR.

8. Any of the following applications: Use of the internal reference gene according to any one of claims 1 to 3 in detecting the expression level of plant genes; Use of the primer pair or primer pair combination described in any one of claims 4 to 7 in detecting plant gene expression levels.

9. A method for detecting the expression level of a plant gene, comprising the steps shown in (a) or (b): (a) using the internal reference gene according to any one of claims 1 to 3 as an internal reference gene; (b) using the primer pair or primer pair combination described in any one of claims 4 to 7 as a primer for amplifying an internal reference gene.

10. The use according to claim 8 or the method according to claim 9, characterized in that: The plant is any one or several species of the genus Malus; preferably, the plant is Malus transitoria; And / or, the plant is a plant under drought stress conditions or a plant without any stress conditions; Preferably, the method for detecting the expression level of plant genes is real-time fluorescence quantitative PCR.

Images