Uca fatty acyl reductase bcfar2 gene and expression protein and application thereof

By cloning and expressing the BcFAR2 gene of Brassica oleracea fatty acyl reductase, and constructing overexpression and silencing vectors, the problems of male sterility and stress-resistant breeding in Brassica oleracea were solved, and the pollen fertility was restored and salt tolerance was improved.

CN119351426BActive Publication Date: 2026-07-07ANHUI AGRICULTURAL UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ANHUI AGRICULTURAL UNIVERSITY
Filing Date
2024-10-31
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

The functional research on the BcFAR2 gene of cauliflower fatty acyl reductase in existing technologies is not in-depth, which affects the theoretical and practical application of male sterility and stress-resistant breeding in cauliflower.

Method used

The BcFAR2 gene of cauliflower fatty acyl reductase was cloned and expressed. Overexpression and silencing expression vectors were constructed and applied to restore pollen fertility and improve salt tolerance in male-sterile cauliflower plants. Salt tolerance was enhanced by overexpressing the gene in Arabidopsis thaliana.

Benefits of technology

Overexpression and silencing of the BcFAR2 gene significantly restored the activity of *Brassica napus* pollen and enhanced the salt tolerance of both *Arabidopsis thaliana* and *Brassica napus*, demonstrating broad potential for breeding applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119351426B_ABST
    Figure CN119351426B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of plant genetic breeding, and particularly relates to a Brassica campestris fatty acyl reductase BcFAR2 gene, an expression protein thereof and application, a base sequence of the Brassica campestris fatty acyl reductase BcFAR2 gene is shown as SEQ ID NO. 1, and an amino acid sequence of the expression protein is shown as SEQ ID NO. 2, the Brassica campestris fatty acyl reductase BcFAR2 gene is cloned, and BcFAR2 gene overexpression Brassica campestris sterile plants can restore pollen activity; gene knockout Brassica campestris fertile plants can significantly reduce pollen activity; in Arabidopsis thaliana, overexpression of the gene can significantly improve salt tolerance of the transgenic plants; and in Brassica campestris, overexpression of the gene can significantly enhance salt tolerance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetics and breeding technology, specifically to a BcFAR2 gene of Brassica oleracea fatty acyl reductase, its expressed protein, and its applications. Background Technology

[0002] Chinese cabbage (Brassica campestris L.ssp.chinensis var. rosularis Tsen et Lee) is a variety of Brassica campestris in the Brassicaceae family, and is a biennial herbaceous plant. Its leaves have abundant, bubble-like, tender wrinkles and a high vitamin C content. It is widely cultivated in the Yangtze and Huai River basins of China and is an important economic crop.

[0003] Fatty acyl reductase (FAR) is a key enzyme in lipid metabolism, primarily catalyzing the reduction of fatty acyl-CoA or acyl-ACP substrates to primary fatty alcohols under the influence of NADPH. To date, FAR genes related to sporophytin synthesis have been studied in various plants, including Arabidopsis thaliana, rice, and maize. Besides angiosperms, sporophytin is widely found in green algae, bryophytes, ferns, liverworts, and even fungi. Fatty acyl reductases are enzymes targeting acyl-CoA or acyl-ACP, providing fatty alcohol substrates for lipid synthesis, and fatty alcohols are crucial for sporophytin formation. Therefore, fatty alcohols play an indispensable role in sporophytin synthesis. However, the function of the BcFAR2 gene in *Brucea javanica* has not yet been reported. Therefore, studying the function of the BcFAR2 gene in *Brucea javanica* is of great significance for the theory and practical application of male sterility and stress-tolerant breeding in *Brucea javanica*.

[0004] In view of the above-mentioned defects, the inventors of this invention have finally obtained this invention after a long period of research and practice. Summary of the Invention

[0005] The purpose of this invention is to solve the problem of how to apply the BcFAR2 gene of Brassica oleracea fatty acid reductase to male sterility and stress-resistant breeding of Brassica oleracea, and to provide a BcFAR2 gene of Brassica oleracea fatty acid reductase, its expressed protein and its application.

[0006] To achieve the above objectives, this invention discloses a *Brassica napus* fatty acyl reductase BcFAR2 gene, the base sequence of which is shown in SEQ ID NO.1.

[0007] This invention discloses an expression protein of the BcFAR2 gene of *Brassica napus*, the amino acid sequence of which is shown in SEQ ID NO.2.

[0008] The present invention also discloses an overexpression vector of the BcFAR2 gene of *Brassica napus*, wherein the overexpression vector is p1305-BcFAR2.

[0009] The present invention also discloses a silencing expression vector for the BcFAR2 gene of broccoli oleracea fatty acyl reductase, wherein the silencing expression vector is pCRISPR-BcFAR2 and the target site sequence is shown in SEQ ID NO.3 and SEQ ID NO.4.

[0010] This invention also discloses the application of the above-mentioned overexpression of the BcFAR2 gene of *Brucea javanica* in restoring pollen fertility and improving salt tolerance in male-sterile *Brucea javanica* plants.

[0011] This invention also discloses the application of the above-mentioned BcFAR2 gene of Brassica oleracea fatty acyl reductase in regulating the expression of key genes for salt tolerance in Brassica oleracea.

[0012] The key genes are BcSTZ1 and BcSOS1.

[0013] This invention also discloses the application of the above-mentioned *Brassica napus* fatty acyl reductase BcFAR2 gene in enhancing the salt tolerance of Arabidopsis thaliana. By overexpressing the *Brassica napus* fatty acyl reductase BcFAR2 gene in Arabidopsis thaliana, the salt tolerance of Arabidopsis thaliana is enhanced.

[0014] Compared with existing technologies, the beneficial effects of this invention are as follows: This invention clones the BcFAR2 gene of *Brucea javanica*, and overexpression of the BcFAR2 gene in sterile *Brucea javanica* plants can restore pollen activity; gene knockout in fertile *Brucea javanica* plants can significantly reduce pollen activity; overexpression of this gene in *Arabidopsis thaliana* was found to significantly improve the salt tolerance of transgenic plants; and overexpression of this gene in *Brucea javanica* significantly enhances salt tolerance. Therefore, the BcFAR2 gene has wide applications in pollen development and salt tolerance. Attached Figure Description

[0015] Figure 1 Cloning the BrFAR2 gene from *Brachys edulis*;

[0016] Figure 2 For BcFAR2 gene expression analysis; A, relative expression level of BcFAR2 in different organs of fertile and sterile plants; B, relative expression level of BcFAR2 in different pollen development stages in fertile plants, different lowercase letters indicate significant differences in expression at different stages (P<0.05, Duncan's method); C, relative expression level of BcFAR2 gene in sterile plants relative to that in fertile plants at different pollen development stages, asterisk indicates significant difference according to Student's test, P<0.05 (*) or P<0.01 (**), ns indicates no significant difference, error bar represents the mean ± SE from three independent experiments;

[0017] Figure 3 Pollen fertility analysis of Arabidopsis thaliana mutant far2 overexpressing BcFAR2 gene: A, Pollen fertility of Arabidopsis thaliana wild-type plant (Col-0); B, Pollen fertility of Arabidopsis thaliana far2 mutant (far2); C, Pollen fertility of Arabidopsis thaliana far2 mutant (far2 / BcFAR2) overexpressing BcFAR2 gene.

[0018] Figure 4 This study analyzed the expression of key fertility genes in Arabidopsis thaliana mutants overexpressing the BcFAR2 gene. A, Relative expression levels of the BcFAR2 gene in wild-type Arabidopsis (Col-0), BcFAR2-overexpressing (far2 / BcFAR2), and the far2 mutant (far2); B, Relative expression levels of the AtAMS1 gene in Col-0, far2 / BcFAR2, and far2; C, Relative expression levels of the AtTDF1 gene in Col-0, far2 / BcFAR2, and far2; D, Relative expression levels of the AtMS1 gene in Col-0, far2 / BcFAR2, and far2. *** indicates highly significant (P<0.001).

[0019] Figure 5 Salt tolerance analysis of BcFAR2 in Arabidopsis thaliana: A. The expression levels of AtSTZ1 and AtSOS1 genes in the far2 transgenic plant (far2 / BcFAR2) were significantly higher than those in the mutant plant (far2) under 150 mM NaCl treatment; B. The proline content in the far2 / BcFAR2 plant was significantly higher than that in the far2 plant under 150 mM NaCl treatment, while the malondialdehyde content was significantly lower than that in the far2 plant; C. The relative water content and survival rate of the far2 / BcFAR2 plant were significantly higher than those of the far2 mutant plant under 150 mM NaCl treatment.

[0020] Figure 6Analysis of the BcFAR2 gene's regulatory function on pollen fertility; A: Relative expression levels of the BcFAR2 gene in fertile *Brucea javanica* plants (12-14B), gene-edited *Brucea javanica* plants [CRISPR-BcFAR2(12-14B)], sterile plants (12-14A), and BcFAR2 transgenic *Brucea javanica* plants [35S::BcFAR2(12-14A)]; B: Pollen activity analysis of 12-14B, CRISPR-BcFAR2(12-14B), 12-14A, and 35S::BcFAR2(12-14A) plants; C: 12-14B, CRISPR... D: Relative expression level analysis of BcAMS1 gene in 12-14B, CRISPR-BcFAR2(12-14B), 12-14A, and 35S::BcFAR2(12-14A) plants; E: Relative expression level analysis of BcTDF1 gene in 12-14B, CRISPR-BcFAR2(12-14B), 12-14A, and 35S::BcFAR2(12-14A) plants;

[0021] Figure 7 Salt tolerance analysis of the BcFAR2 gene; A, BcFAR2 gene expression increases with increasing NaCl concentration; BC, expression of BcSTZ1 and BcSOS1 genes in fertile *Brucea javanica* plants 12-14B and their BcFAR2 gene-silenced plants [CRISPR-BcFAR2(12-14B)], sterile plants 12-14A and their BcFAR2 overexpressing plants [35S::BcFAR2(12-14A)] under salt stress; D, salt tolerance analysis of 12-14B, CRISPR-BcFAR2(12-14B), 12-14A, and 35S::BcFAR2(12-14A) plants under salt stress. Relative water content of leaves under stress conditions; E, malondialdehyde content of 12-14B, CRISPR-BcFAR2(12-14B), 12-14A, and 35S::BcFAR2(12-14A) plants under salt stress conditions; F, proline content of 12-14B, CRISPR-BcFAR2(12-14B), 12-14A, and 35S::BcFAR2(12-14A) plants under salt stress conditions; G, survival rate of 12-14B, CRISPR-BcFAR2(12-14B), 12-14A, and 35S::BcFAR2(12-14A) plants under salt stress conditions. Detailed Implementation

[0022] The above-mentioned and other technical features and advantages of the present invention will be described in more detail below with reference to the accompanying drawings.

[0023] Example 1

[0024] Cloning of the BcFAR2 gene

[0025] 1. Take flower buds from fertile *Brucea javanica* plants during their full bloom period (12-14B), extract total RNA from the tetrad stage flower buds, and reverse transcribe it into cDNA.

[0026] 2. Search the BRAD and NCBI databases for the CDS sequence of the FAR2 gene in cruciferous plants such as Arabidopsis thaliana, Chinese cabbage, and rapeseed; after BLAST alignment, design upstream and downstream specific primers FAR2-F1 and FAR2-R1 based on homologous regions.

[0027] FAR2-F1:ATGGAAGCTCTCTTCTTGAC

[0028] FAR2-R1:TTAAGCTCTTCCCTTCAAG

[0029] 3. Using cDNA template, with FAR2-F as the upstream primer and FAR2-R as the downstream primer, perform PCR reaction: 12.5 μL Taq PCRMaster Mix (25 mM / L), 1 μL cDNA (100 ng / μL), 1 μL Forward Primer (10 μmol / L), 1 μL Reverse primer (10 μmol / L), and 9.5 μL ddH2O.

[0030] 4. The PCR purified product was ligated into the pMD19-T vector to obtain the pMD-BcFAR2 recombinant vector; this vector was transformed into DH5α Escherichia coli, and after positive PCR verification of the bacterial culture, sequencing was performed to confirm the result.

[0031] like Figure 1 As shown, the full-length BcFAR2 gene sequence, which is 1842 bp and encodes 614 amino acids, was cloned from *Brucea javanica*. Its base sequence is shown in SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown in SEQ ID NO.2.

[0032] Example 2

[0033] BcFAR2 gene expression level detection

[0034] 1. Take the inflorescences of the fertile line 12-14B and the male sterile line 12-14A of Chinese spinach during their full bloom period, divide the flower buds into four developmental stages: pollen mother cell stage, pre-tetraditional stage, post-tetraditional stage, and pollen grain maturation stage, and extract RNA from each stage and reverse transcribe it into cDNA.

[0035] 2. Using the BcFAR2 gene sequence as a template, design specific primers BcFAR2-F2 and BcFAR2-R2 for upstream and downstream of real-time PCR.

[0036] BcFAR2-F2: TGCTAAGCATGGAGTGGTGA

[0037] BcFAR2-R2:AAGAAGCTCTGCCAAGTCCT

[0038] 3. Using the BcActin gene as an internal reference (BcActin-F: TGGGTTTGCTGGTGACGAT, BcActin-R: TGCCTAGGACGACCAACAATACT), quantitative real-time PCR analysis was performed.

[0039] The results are as follows Figure 2 As shown, the BcFAR2 gene is expressed in the roots, stems, leaves, and flowers of fertile 12-14B plants and sterile 12-14A plants, but its expression level is highest in flower buds. Figure 2 A); The expression levels of the BcFAR2 gene at different developmental stages of the anthers in fertile plants of 12-14B showed that the expression level of this gene was significantly increased during the tetrad stage. Figure 2 B) indicates that this gene may be related to tapetum development; the BcFAR2 gene count was significantly lower in sterile plants compared to fertile plants at the tetrad stage. Figure 2 C) indicates that this gene is involved in tapetum development, and abnormal expression of this gene may lead to pollen abortion.

[0040] Example 3

[0041] Construction of BcFAR2 gene overexpression vector

[0042] 1. The homologous recombination primer sequences 1305FAR2-F and 1305FAR2-R of the BcFAR2 gene were designed using software such as CE Design V and Snap Gene.

[0043] 1305FAR2-F:gacgatgacgataagggatccATGGAAGCTCTCTTCTTGACTTCTTC

[0044] 1305FAR2-R:tgcctgcaggtcgactctagaTTAAGCTCTTCCCTTCAAGACATG

[0045] 2. Using the pMD-BcFAR2 recombinant vector template, PCR amplification was performed with 1305FAR2-F as the upstream primer and 1305FAR2-R as the downstream primer, and the PCR product BcFAR2 fragment was purified.

[0046] 3. The pCAMBIA1305 vector (containing the 35S-MYC-nos multiple cloning expression cassette) was double-digested using BamHI and XbaI restriction endonucleases, and the digested fragments were recovered.

[0047] 4. Use The plus One step PCR Cloning Kit ligates the purified PCR product BcFAR2 fragment with the pCAMBIA1305 double-digested fragment; the ligation product is transformed into E. coli DH5α and verified by bacterial PCR. Positive bacterial cultures are selected for sequencing confirmation, and finally the p1305-BcFAR2 overexpression vector is obtained.

[0048] 5. The p1305-BcFAR2 overexpression vector was transformed into Agrobacterium GV3101 to finally obtain the GV3101-p1305-BcFAR2 engineered strain.

[0049] Example 4

[0050] Construction of BcFAR2 gene silencing vector

[0051] 1. The BcFAR2 gene knockout target site sequences T1 and T2 were designed online using CHOPCHOP software, as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0052] T1(50%GC):CGAGAACGGGAGATACATTGAGG

[0053] T2(50%GC):GGCATTGTCAGTTTCTCCAAGG

[0054] 2. Based on the target sites T1 and T2, using the BcFAR2 gene as a template, design forward and reverse primers FAR2gRT1 and FAR2-U3dT1, and FAR2gRT2 and FAR2-U3dT2 containing the target sites, respectively.

[0055] FAR2gRT1:AACTTCTTCCCTTGGAGGAAACgttttagagctagaaat

[0056] FAR2-U3dT1:GAAGCATCAAACCAGAGAGGTCgaccaatggtgctttg

[0057] FAR2gRT2: CAGCTTCTTTGTTTTTGGCTTTgttttagagctagaaat

[0058] FAR2U3dT2: TGCTGAGACATTGGTTCTGTCTgaccaatgttgctcc

[0059] 3. Using the pYLgRNA-AtU3d-LacZ intermediate vector as a template, amplification was performed using primer pairs UF(CTCCGTTTTACCTGTGGAATCG) and FAR2-U3dT1, and FAR2gRT1 and gR-R(CGGAGGAAAATTCCATCCAC), respectively. 1 μL of each of the above PCR products was diluted 10-fold and used as a template. U3dT1-gRNA fragment PCR amplification was performed using primer pairs Pps-RC(TTCAGAggtctcTACCGACTAGTATGGAATCGGCAGCAAAGG) and Pgs-GG2(AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC) as primer pairs. The PCR products were then purified to obtain the T1sgRNA expression cassette. Using the same method, pYLsgRNA-AtU3b was used as a template, and PCR was performed with primer pairs UF and FAR2-U3dT2 and FAR2gRT2 and gR-R, respectively. Then, U3bT2-gRNA fragment PCR amplification was performed with primer pairs Pps-GG2(TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG) and Pgs-LC(AGCGTGggtctcGCTCGACGCGTATCCATCCACTCCAAGCT) as primer pairs. After purification, T2sgRNA expression cassette was obtained.

[0060] 4. Take the purified products of the T1sgRNA expression cassette and T2sgRNA expression cassette and perform an enzyme digestion-ligation reaction with the pYLCRISPR / Cas9 plasmid (10×CutSmart Buffer 3μL, 10mM ATP 3μL, pYLCRISPR / Cas9 plasmid 160ng, T1sgRNA expression cassette 30ng, BsaI-HF 1μL, T4 DNAligase 0.2μL, H2O 30μL); reaction program: 37℃ 1min, 16℃ 1min, 30 cycles, 55℃ 5min; the purified product is transformed into DH5α Escherichia coli, the plasmid is extracted and verified by Mlu I enzyme digestion, and then sequenced to obtain the pCRISPR-BcFAR2 silencing vector.

[0061] 5. The pCRISPR-BcFAR2 silencing vector was transformed into Agrobacterium GV3101 to finally obtain the GV3101-pCRISPR-BcFAR2 engineered bacteria.

[0062] Example 5

[0063] The BcFAR2 gene was genetically transformed into the Arabidopsis thaliana mutant far2.

[0064] 1. Using the GV3101-p1305-BcFAR2 engineered bacteria obtained in Example 3, the Arabidopsis thaliana mutant far2 was infected by inflorescence infection method to obtain T0 generation transgenic seeds.

[0065] 2. The obtained T0 generation transgenic seeds were screened for hygromycin resistance to identify resistant plants, and positive plants were obtained by PCR.

[0066] 3. After obtaining T1 seeds from positive plants, use the same method as above until T3 generation stable genetic transgenic plants (far2 / BcFAR2) are obtained.

[0067] During the full bloom period of T3 generation transgenic plants, pollen viability was determined using Alexander staining solution, and the results were as follows: Figure 3 As shown, genetic transformation of the Arabidopsis mutant far2 with the BcFAR2 gene can completely restore its pollen fertility.

[0068] The expression levels of the target gene and key tapetum development genes AtAMS1, AtTDF1, and AtMS1 in the transgenic plant far2 / BcFAR2 were detected using quantitative real-time PCR. Results are as follows: Figure 4 As shown, the expression levels of AtAMS1, AtTDF1, and AtMS1 genes in the transgenic plant far2 / BcFAR2 were restored to the expression levels in the wild-type Col-0.

[0069] Salt tolerance of the far2 mutant and its BcFAR2 overexpressing plant, far2 / BcFAR2 (4 leaves and 1 bud), to 150 mM NaCl was analyzed. The expression levels of salt-tolerant genes such as AtSTZ1 and AtSOS1 were measured after 12 h of treatment. Simultaneously, the relative water content, proline, and malondialdehyde (MDA) content in the leaves were also measured. Two days after treatment, the plants were transferred to NaCl-free conditions, and the number of surviving plants was counted. Results are as follows: Figure 5 As shown, under salt stress treatment, the expression levels of AtSTZ1 and AtSOS1 salt tolerance genes and the relative proline content in far2 / BcFAR2 plants were significantly upregulated. Figure 5 (A, B) The relative water content of far2 / BcFAR2 plants was significantly higher than that of far2 mutant plants. Figure 5 C), the malondialdehyde content was significantly lower than that of the far2 mutant plants. Figure 5 B), and the survival rate of far2 transgenic plants was significantly increased under salt damage treatment ( Figure 5 C).

[0070] Example 6

[0071] BcFAR2 gene genetic transformation of Chinese spinach plants

[0072] 1. Using the GV3101-p1305-BcFAR2 engineered bacteria obtained in Example 3, the flower buds of fertile *Brucea javanica* plants 12-14B were infected using the inflorescence infection method. After the infected flower buds opened, the pollen was transferred to the stigma of sterile plants 12-14A to obtain T0 generation transgenic seeds. Using the GV3101-pCRISPR-BcFAR2 engineered bacteria obtained in Example 4, the flower buds of fertile *Brucea javanica* plants 12-14B were infected using the inflorescence infection method to obtain T0 generation transgenic seeds.

[0073] 2. After the p1305-BcFAR2 transgenic seeds germinated, positive transgenic plants were obtained by hygromycin and BcFAR2 target gene PCR identification. The expression level of BcFAR2 gene in the positive plants was detected by real-time quantitative PCR, and plants with BcFAR2 gene overexpression [35S::BcFAR2(12-14A)] were screened.

[0074] 3. After germination of pCRISPR-BcFAR2 transgenic seeds, positive gene-edited plants were obtained by hygromycin and Cas9 gene sequence PCR identification. The editing effect of the target site was detected by using the target site detection primers (T1L: AATAGGGAGCAGAGTTCACCA, T1R: AACTTCTTCCCTTGGAGGAAAC; T2L: GAGACGGGAGATACATTGAGG, T1R: CAGCTTCTTTGTTTTTGGCTTT). The expression level of BcFAR2 gene in the edited plants was detected by real-time quantitative PCR, and plants with silenced expression of BcFAR2 gene [CRISPR-BcFAR2(12-14B)] were screened.

[0075] Quantitative real-time PCR was used to analyze the expression levels of BcAMS1, BcTDF1, and BcMS1 in flower buds at the tetrad stage of transgenic plants with BcFAR2 gene overexpression and gene silencing; the results are as follows. Figure 6 As shown, overexpression of the BcFAR2 gene [35S::BcFAR2(12-14A)] in sterile *Brucea javanica* plants significantly restored pollen fertility and also restored the expression levels of BcAMS1, BcTDF1, and BcMS1 genes. In contrast, silencing the BcFAR2 gene [CRISPR-BcFAR2(12-14B)] in fertile *Brucea javanica* plants significantly reduced pollen fertility and also significantly downregulated the expression levels of BcAMS1, BcTDF1, and BcMS1 genes.

[0076] Fertility plants of *Brassica napus* (12-14B) at one month of age were treated with 0, 50, 100, 150, and 200 mM NaCl, respectively. The expression level of the BcFAR2 gene was detected after 12 hours. The results showed that the expression level of the BcFAR2 gene increased with increasing NaCl concentration. Figure 7 A). Salt tolerance of *Brucea javanica* fertile plants 12-14B, BcFAR2 gene-silenced plants [CRISPR-BcFAR2(12-14B)], and sterile 12-14A one-month-old seedlings was analyzed using 150 mM NaCl. The expression levels of genes such as BcSTZ1 and BcSOS1 were measured after 12 hours of treatment, along with relative water content and proline and malondialdehyde (MDA) content. Two days after treatment, the plants were transferred to NaCl-free conditions, and the number of surviving plants was counted. Results are as follows: Figure 7 As shown in Figure BG, under salt stress treatment, the expression of BcSTZ1 and BcSOS1 salt tolerance genes and the relative proline content in CRISPR-BcFAR2(12-14B) plants were significantly downregulated, as were the relative water content survival rate and proline content, while the malondialdehyde content was significantly upregulated. Figure 7 In F) 35S::BcFAR2(12-14A) plants, the expression of BcSTZ1 and BcSOS1 salt tolerance genes and relative proline content were significantly upregulated, as were relative water content, survival rate, and proline content, while malondialdehyde content was significantly downregulated. This indicates that upregulated expression of the BcFAR2 gene can enhance the salt tolerance of the plant.

[0077] The above description is merely a preferred embodiment of the present invention and is illustrative rather than restrictive. Those skilled in the art will understand that many changes, modifications, and even equivalents can be made within the spirit and scope defined by the claims of the present invention, all of which will fall within the protection scope of the present invention.

Claims

1. Overexpression of spinach fatty acyl reductase BcFAR2 The application of genes in restoring pollen fertility and improving salt tolerance in male-sterile *Brucea javanica* plants is characterized by, The fatty acyl reductase of black vegetable BcFAR2 The base sequence of the gene is shown in SEQ ID NO.

1.

2. The application as described in claim 1, characterized in that, The fatty acyl reductase of black vegetable BcFAR2 The amino acid sequence of the expressed protein of the gene is shown in SEQ ID NO.

2.

3. The application as described in claim 1, characterized in that, The fatty acyl reductase of black vegetable BcFAR2 The gene overexpression vector was constructed using the pCAMBIA1305 vector.

4. Knockout of fatty acyl reductase in black spinach BcFAR2 The application of genes in causing pollen abortion in fertile *Brucea javanica* plants and reducing the salt tolerance of fertile *Brucea javanica* plants is characterized by, The fatty acyl reductase of black vegetable BcFAR2 The base sequence of the gene is shown in SEQ ID NO.1.