Tissue culture-dependent tomato genetic transformation method

Abstract

The invention discloses a non-tissue-culture-dependent tomato genetic transformation method, and belongs to the technical field of genetic engineering. According to the method, seedlings germinated for about one week of tomatoes are utilized, after true leaves are removed, agrobacterium carrying target gene plasmids are used for infecting wounds, then plant hormones are sprayed for induction to form calluses, then the calluses are differentiated to form a large number of seedlings, and the seedlings are subjected to seedling culture. The method comprises the following steps: carrying out preliminary screening on seedlings by using an antibiotic solution corresponding to a resistance gene on a plasmid carried by agrobacterium, and finally carrying out PCR amplification target gene identification on tomato plants subjected to preliminary screening so as to determine finally transformed positive plants. According to the method, the callus tissue is directly induced to differentiate and regenerate on the living plant, so that the step of tissue in-vitro culture required by the traditional tomato genetic transformation is simplified, the transgenic plant can be simply, conveniently and efficiently obtained, and powerful technical support is provided for tomato molecular breeding, target gene function analysis and excellent germplasm innovation.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a tomato genetic transformation method independent of tissue culture. Background Art

[0002] Tomato (Solanum lycopersicum L.) is an annual herbaceous plant of the Solanaceae family, and is also a common vegetable plant with high nutritional and edible value. At present, the cultivation of new tomato varieties is mainly based on traditional breeding methods, but due to the long cycle of this method, it is difficult to meet the requirements of today's variety updates. The rapid development and successful application of emerging biotechnology represented by genetic engineering technology has opened up a new path for tomato gene function research and genetic breeding.

[0003] Since the development of plant genetic engineering technology, the genetic transformation of tomatoes has required the use of conventional tissue culture technology, including the steps of culturing sterile seedlings-explant transformation-inducing callus-inducing seedlings and root differentiation-hardening and transplanting. Since tomato explants are relatively sensitive, browning or vitrification is serious during tissue culture, and the tissue culture cycle is long (the induction callus differentiation time is up to 2-3 months), an efficient, rapid and stable genetic transformation system has not yet been established, which seriously limits the research on the functions of tomato-related genes and hinders the innovation process of tomato germplasm resources. At present, there are many plants that have successfully produced transgenic plants using non-tissue culture-dependent technologies, such as anther infection of Arabidopsis. Compared with conventional genetic transformation technologies that rely on tissue culture, non-tissue culture-dependent technologies are simpler to operate, have shorter cycles, and are less restricted by genotypes. Therefore, how to use a simple and fast transformation method to improve the tomato transformation rate and successfully achieve the transformation of certain specific varieties is a problem that those skilled in the art urgently need to solve. Summary of the invention

[0004] The purpose of the present invention is to provide a tomato genetic transformation method that does not rely on tissue culture in view of the deficiencies of the prior art.

[0005] The purpose of the present invention is achieved through the following technical solutions:

[0006] A tissue culture-independent tomato genetic transformation method comprises the following steps:

[0007] (1) Take tomato seedlings when the cotyledons are unfolded and the true leaves have just grown out, remove the true leaves at the level of the cotyledons, and cover the wound with absorbent cotton; drip the Agrobacterium tumefaciens infection solution carrying the target gene plasmid on the absorbent cotton for infection; the infected tomato seedlings are cultured in a dark environment to maintain the infection activity of Agrobacterium, and then transferred to a normal environment for culture.

[0008] Or: Take tomato seedlings when the cotyledons are unfolded and the true leaves are 2-3 days old, remove the tops of the true leaves to stimulate the expansion and growth of the cotyledons, and after the seedlings continue to grow for 5-7 days, remove the excess epicotyl part at the cotyledons again, then cover the wound with cotton wool, and drop the Agrobacterium tumefaciens infection solution carrying the target gene plasmid on the cotton wool for infection; the infected tomato seedlings are cultured in a dark environment to maintain the infection activity of Agrobacterium, and then transferred to a normal environment for culture.

[0009] (2) Spraying the wound of the tomato seedlings infected with Agrobacterium in step (1) with a solution containing plant hormones to induce callus formation. The plant hormones include one or more of IAA, 6-BA, NAA, ZT, KT, etc.

[0010] (3) After callus formation, stop spraying plant hormones. When the callus differentiates into a seedling with two leaves and one heart, use an antibiotic solution corresponding to the resistance gene on the plasmid carried by Agrobacterium tumefaciens to spray the plant leaves for preliminary screening. The treated plants are grown for 5-7 days, and the plants with yellowing leaves are removed, while the plants with unchanged leaves continue to grow.

[0011] (4) After the initial screening, the plants continue to grow to 5-7 leaves, and DNA is extracted from the leaves to amplify the target gene through PCR. Plants with positive amplification results are successful transformed plants.

[0012] In step (1), the Agrobacterium tumefaciens infection solution is preferably obtained by a method comprising the following steps: taking Agrobacterium tumefaciens carrying the target gene plasmid, inoculating it into LB liquid culture medium for activation, and then expanding the culture. After the expansion culture, the bacterial solution is centrifuged to collect the bacterial cells, the bacterial cells are washed with an activation solution, the bacterial cells are resuspended, and the bacterial solution concentration is adjusted to OD 600 The value is 0.5-0.8, and the infection solution can be obtained by standing at 28°C in the dark for 2-6 hours. The composition of the activation solution is preferably: 1moL / L MES, 200μmoL / L As, and 1moL / L MgCl2.

[0013] In step (1), after removing the true leaves at the cotyledon level, it is preferred to first puncture the wound with a needle and then cover the wound with absorbent cotton. Each wound is preferably punctured 3-5 times, and the puncture depth is preferably about 0.3-0.5 cm.

[0014] In step (1), the infection time is preferably 15-30 minutes.

[0015] In step (1), the infected tomato seedlings are preferably cultured in a dark environment at 28° C. and 80-85% humidity for 24-48 hours.

[0016] In step (2), the solution containing plant hormones is preferably a solution containing IAA and 6-BA. Wherein, the concentration of IAA is preferably 100-200 mg / L, and the concentration of 6-BA is preferably 10-50 mg / L. Or the solution containing plant hormones is preferably a solution containing NAA and KT. Wherein, the concentration of NAA is preferably 100-150 mg / L, and the concentration of KT is preferably 20-30 mg / L.

[0017] In step (2), the solution containing plant hormones is preferably sprayed on the wounds of tomato seedlings 2-3 days per time, and a large number of callus tissue blocks are formed in about 10 days.

[0018] Advantages and beneficial effects of the present invention: The method of the present invention does not require tissue culture during the entire transformation process, and directly induces callus differentiation and regeneration on tomato seedlings, which simplifies the steps of in vitro tissue culture required for traditional tomato genetic transformation, and can easily and efficiently obtain transgenic plants, providing strong technical support for tomato molecular breeding, target gene function analysis and excellent germplasm innovation. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 : Diagram of the tomato genetic transformation process independent of tissue culture of the present invention.

[0020] Figure 2 : Gel electrophoresis of PCR products of transgenic plants transformed by the method of the present invention. Lane CK: negative control; Lane Yang: positive control; M: 2000 bp marker; Lanes 1-9: transgenic plants.

[0021] Figure 3 : GUS staining results of positive plants transformed by the method of the present invention. a: negative control; b: leaves of transformed positive seedlings.

[0022] Figure 4 : Schematic diagram of the first and second true leaf removal methods.

[0023] Figure 5 : Effects of different times of true leaf removal on callus formation and seedling differentiation. DETAILED DESCRIPTION

[0024] The present invention is further described in detail below in conjunction with specific embodiments, but the embodiments of the present invention are not limited thereto.

[0025] The reagents used in the following examples were purchased from the following manufacturers: Micro Tom: laboratory seed preservation. Agrobacterium strain (GV3101): purchased from Wuhan Transduction Biological Laboratory Co., Ltd. LB medium, kanamycin (Kanamycin, Kan), rifampicin (Rifampicin, Rif), acetosyringone (Acetosyringone, AS), morpholineethanesulfonic acid (2-(N-Morpholino)ethanesulfonic acid, MES), indoleacetic acid (IAA), naphthylacetic acid (NAA), 6-benzylaminopurine (6-BA), kinetin (KT), MgCl2 and other reagents were purchased from Shanghai Jizhi Biochemical Technology Co., Ltd.

[0026] Example 1

[0027] 1. Tomato Seed Germination

[0028] Take tomato seeds, soak them in tap water, and then place them at 4℃ for 24h. Evenly spread the tomato seeds after low temperature treatment on moist filter paper and germinate them in dark conditions at room temperature. Sow the white seeds in a small pot filled with nutrient soil and cultivate them at 25℃, keeping the soil moist.

[0029] 2. Preparation of infection solution

[0030] Take the Agrobacterium tumefaciens carrying the target gene plasmid (basic plasmid: pBI121, resistance: Kan+, marker gene: GUS), inoculate it into LB liquid culture medium for activation, and then expand the culture. After the expansion culture, centrifuge the bacterial solution at 4000r / min in a centrifuge for 10 minutes to collect the bacteria. Add an activation solution with an equal volume of the culture medium to resuspend the bacterial solution, then repeat the centrifugation step once, and wash the bacterial solution again. Finally, add a certain amount of activation solution for storage. The amount of activation solution added is adjusted according to the bacterial solution. The final bacterial solution concentration should be OD 600 Value 0.5-0.8. OD 600 The infection solution can be obtained by keeping the bacterial solution with a value of 0.5-0.8 in the dark at 28℃ for 4 hours.

[0031] LB liquid culture medium is: add 100 mg / L Kana + 60 mg / L Rif to each liter of LB culture medium.

[0032] The activation solution formula is: 1moL / L MES, 200μmoL / L As, 1moL / L MgCl2.

[0033] 3. Pre-infection treatment and Agrobacterium infection

[0034] After the seeds germinate for about a week (when the cotyledons are fully expanded and the true leaves have just grown out), cut off the true leaves with scissors at the level of the cotyledons. Immediately cover the wound with absorbent cotton, then drip the infection solution on the absorbent cotton for infection for 30 minutes. After the infection is completed, remove the absorbent cotton, place it in a dark environment at 28°C and 80-85% humidity for 1 day, and then transfer it to a normal environment for cultivation.

[0035] 4. Callus Induction

[0036] A mixed hormone solution containing 150 mg / L IAA and 20 mg / L 6-BA was sprayed on the wounds of the tomato seedlings infected with Agrobacterium tumefaciens, 2 days / time, for about 10 days, until a large number of callus tissue blocks were formed.

[0037] 5. New seedling growth and transgenic plant screening

[0038] After callus formation, stop spraying plant hormones. When the callus differentiates into a seedling with two leaves and one heart, use 500mg / L Kan solution to spray the leaves of the plants for preliminary screening. The treated plants are cultured for about a week, and the plants with yellow leaves are removed with scissors. The plants with no changes in leaves continue to grow and further identification is carried out after multiple true leaves grow.

[0039] 6. Identification of transgenic plants

[0040] The plants after the initial screening continued to grow, and when the seedlings grew to about 5 true leaves, DNA was extracted from the leaves and the target gene was amplified using PCR technology.

[0041] The target gene used in this example is the tomato DOf3.1 gene. The front end of the designed DNA amplification primer contains the promoter sequence on the vector. If it is not transferred into the vector, the gene cannot be amplified. The gene sequence and amplification primer sequence are as follows (5'-3').

[0042] DOf3.1 gene sequence:

[0043] atgcaagatccatcatcaatatattcacagatcaatcctcagttcccagatcaacaagtcctgaaatgccctagatgtgattcaatcaacacgaagttttgttactacaacaattacaatctttctcagccacgccatttttgtaagaattgtaaaaggtattggactaaaggaggtattttgaggaatattccagttggtggaagctctcgtaagaacacaaaacgatcttcttcgaatagctgtaaacgctcctcaacgatgacgatttcatcttcaacttcatcagaacaaaattcaaaaacagagcattttgatacccctgttgttcggaacagcccgattgttgacgccaatgggcctttcggctcgctactagcatcaaacgggccggagatagggaattttttaaatgttttgaatcctaacgggcccgattcgggctcagacgctgctgccgctcaaagtgggaatagtaataataatcatgaatttttgggtgaagattctaattgttggaatggtactaatggttgggctgatcttgctatttacaccccaggttcaacctttcagtaa。

[0044] Amplification primer sequences:

[0045] Dof3.1-F: gagagaacacgggggactctagaatgcaagatccatcatcaat;

[0046] Dof3.1-R: agggactgaccacccggggatccctgaaaggttgaacctgg。

[0047] The PCR amplification system and amplification program are shown in Tables 1 and 2 below.

[0048] Table 1 PCR amplification system (20 μL)

[0049]

[0050] Table 2 PCR amplification program

[0051]

[0052]

[0053] The identification results are as follows Figure 2 As shown in the figure, target DNA bands of about 600 bp can be amplified in lanes 3, 4, 6 and 9, while the control plant has no bands, indicating that lanes 3, 4, 6 and 9 are successfully transformed transgenic plants. The identified transgenic plants continue to be cultured until they bloom and bear fruit ( Figure 1 de).

[0054] Take the tomato seedlings obtained from the preliminary screening, take the leaves for GUS staining, and identify the transgenic plants. GUS staining method: take the tomato leaves and put them into EP tubes, add an appropriate amount of GUS dye solution for dyeing, keep them away from light for 8-12 hours, use alcohol to decolorize until the green color is completely eliminated, and observe the staining. The GUS staining results of positive transgenic tomato plants are as follows Figure 3 The control CK showed no color after alcohol decolorization, and the tomato leaves after successful transformation were blue and could not be decolorized. After final identification, the positive transformation rate could reach 18.8% (Table 3).

[0055] Table 3 Transformation results related data

[0056]

[0057] Example 2

[0058] According to the method in Example 1, in the third step of pre-infection treatment and the step of removing true leaves during Agrobacterium infection, tomato seedlings were taken when the true leaves grew for 2 days, and the tops of the true leaves (such as Figure 4 a), after the true leaves are removed, the seedlings continue to grow for 5-7 days, and then the excess epicotyl is removed again at the cotyledon level ( Figure 4 b), immediately cover the wound with absorbent cotton, then drip the infection solution on the absorbent cotton for infection for 30 minutes, remove the absorbent cotton after infection, place in a dark environment at 28°C and 80-85% humidity for 1 day, and finally transfer to a normal environment for cultivation. The callus formed after the treatment of Example 2 (2 times of decapitation) is larger than that in Example 1 (1 time of decapitation), and the number of seedlings differentiated in the later stage is also significantly increased ( Figure 5 ).

[0059] Example 3

[0060] According to the method in Example 1, different treatments were performed before the infection treatment in step 3 and before the infection by dripping the infection solution in the Agrobacterium infection: (1) No acupuncture treatment: Same as Example 1; (2) Acupuncture treatment: Use a 1 mL syringe needle to acupuncture the wound after the true leaves are removed, and acupuncture each wound 3-5 times with a puncture depth of 0.3-0.5 cm. The results (Table 4) show that the acupuncture treatment has little effect on the differentiation of callus into seedlings, but can greatly improve the transformation success rate.

[0061] Table 4 Effects of different treatments on callus differentiation and transformation rate

[0062]

[0063]

[0064] Example 4

[0065] According to the method in Example 1, in the callus induction step 4, a mixed hormone solution containing 100 mg / L NAA and 20 mg / L KT was sprayed on the wound of the tomato seedlings infected with Agrobacterium, 2 days / time, and treated for 10 days. The results (Table 5) show that the mixed hormone solution containing 100 mg / L NAA and 20 mg / L KT can significantly increase the number of seedlings differentiated from callus.

[0066] Table 5 Effects of different hormone treatments on callus differentiation

[0067]

[0068] The above embodiments are only used to help illustrate the present invention. The implementation methods of the present invention are not limited to the above embodiments. Any modifications, replacements, improvements, etc. made within the basic principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for genetic transformation of tomato independent of tissue culture, characterized in that: The following steps are involved: (1) Take tomato seedlings when the cotyledons are unfolded and the true leaves have just grown out, remove the true leaves at the level of the cotyledons, and cover the wound with absorbent cotton; drip the Agrobacterium tumefaciens infection solution carrying the target gene plasmid on the absorbent cotton for infection; the infected tomato seedlings are first cultured in a dark environment, and then transferred to a normal environment for culture. Or: Take tomato seedlings when the cotyledons are unfolded and the true leaves grow for 2-3 days, remove the top of the true leaves, and after the seedlings continue to grow for 5-7 days, remove the epicotyl part at the level of the cotyledons, then cover the wound with absorbent cotton, and drip the Agrobacterium tumefaciens infection solution carrying the target gene plasmid on the absorbent cotton for infection; the infected tomato seedlings are first cultured in a dark environment, and then transferred to a normal environment for culture; (2) spraying a solution containing plant hormones on the wound of the tomato seedlings infected with Agrobacterium in step (1) to induce callus formation; (3) After callus formation, stop spraying plant hormones. When the callus differentiates into a seedling with two leaves and one heart, spray the leaves of the plant with an antibiotic solution corresponding to the resistance gene on the plasmid carried by Agrobacterium tumefaciens. After the plants grow for 5-7 days, remove the plants with yellow leaves, and continue to grow the plants with unchanged leaves. (4) After the plant obtained in step (3) continues to grow to 5-7 leaves, DNA is extracted from the leaves and the target gene is amplified by PCR. Plants with positive amplification results are considered to be successfully transformed plants.

2. The tissue culture-independent tomato genetic transformation method according to claim 1, characterized in that: In step (1), after removing the true leaves at the level of the cotyledons, the wound is first punctured with a needle and then covered with absorbent cotton.

3. The tissue culture-independent tomato genetic transformation method according to claim 2, characterized in that: Each wound was punctured 3-5 times with a puncture depth of 0.3-0.5 cm.

4. The tissue culture-independent tomato genetic transformation method according to claim 1, characterized in that: In step (1), the infection time is 15-30 minutes.

5. The tissue culture-independent tomato genetic transformation method according to claim 1, characterized in that: In step (1), the infected tomato seedlings are first cultured in a dark environment at 28° C. and 80-85% humidity for 24-48 hours.

6. The tissue culture-independent tomato genetic transformation method according to claim 1, characterized in that: In step (2), the plant hormones include one or more of IAA, 6-BA, NAA, ZT, and KT.

7. The tissue culture-independent tomato genetic transformation method according to claim 1, characterized in that: In step (2), the solution containing plant hormones is a solution containing IAA and 6-BA, or the solution containing plant hormones is a solution containing NAA and KT.

8. The tissue culture-independent tomato genetic transformation method according to claim 7, characterized in that: In the solution containing IAA and 6-BA, the concentration of IAA is 100-200 mg / L, and the concentration of 6-BA is 10-50 mg / L.

9. The tissue culture-independent tomato genetic transformation method according to claim 7, characterized in that: In the solution containing NAA and KT, the concentration of NAA is 100-150 mg / L, and the concentration of KT is 20-30 mg / L.

10. The tissue culture-independent tomato genetic transformation method according to claim 1, characterized in that: In step (2), the solution containing plant hormones is sprayed on the wounds of tomato seedlings every 2-3 days.

Images