Methods of producing synthetic embryos

Abstract

Methods of producing synthetic embryos are provided. Accordingly, a method of producing a synthetic embryo is provided, comprising inducing expression of a factor in a subset of primitive pluripotent stem cells (PSC) that induces differentiation into trophoderm cells to obtain trophoderm originating cells; inducing expression of factors which are induced to differentiate into extraembryonic primitive endoderm cells in the second subgroup of the primitive state PSC to obtain extraembryonic primitive endoderm originating state cells; and mixing the trophoblast ectoderm originating state cells and the extraembryonic primitive endoderm originating state cells with primitive state PSC under conditions that allow the formation of aggregated cells. Articles, mixtures, and aggregates of cells and methods of using the same are also provided.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 317,036, filed on March 6, 2022, and U.S. Provisional Application No. 63 / 390,695, filed on July 20, 2022, the contents of which are incorporated herein by reference in their entirety. Sequence Listing Statement

[0002] The XML file filed concurrently with this application is incorporated herein by reference, the XML file is named 95053.XML, created on March 6, 2023, and contains 327,680 bytes. Technical Field

[0003] The present invention, in some embodiments thereof, relates to methods of producing synthetic embryos.

[0004] Advanced artificial embryogenesis using in vitro established embryonic stem cell lines and induced pluripotent stem cell lines (iPSCs) while avoiding the use of oocytes and fertilized eggs or blastocysts has been a desirable goal in the fields of developmental biology and reproductive medicine. Establishing methods and systems for generating such synthetic embryos (abbreviated as sEmbryo or sEmbryoids; also referred to as stem cell-derived embryos or embryoid body models (SEM) or stem cell-derived whole embryoid body models (SWEM)) outside the uterus can be a powerful tool for basic research, such as a framework for studying the emergence of cellular diversity, cell fate determination, and how tissues and organs emerge from single pluripotent cells; and as a source of cells, tissues, embryos, and organs for transplantation, testing the effects of drugs on embryonic development, and potentially bioengineering embryos.

[0005] The blastocyst (early mammalian embryo) forms all embryonic and extraembryonic tissues, including the placenta. This structure appears at the 64-cell stage, shortly after the embryo loses its "ball of cells" shape and forms a cavity. In this structure, the inner cell mass (ICM) will develop into a true embryo and is located above the blastocyst cavity, which is the hallmark of the blastocyst stage. The cells wrapped around the ICM are trophectoderm (TE) cells, which will later form the trophoblast extraembryonic placental tissue (fetal placenta). Part of the ICM further differentiates into primitive endoderm (PRE), which then produces the extraembryonic yolk sac and membranes in preparation for implantation [Zhang et al. (2020) Front. Bioeng. Biotechnol. 8:781].

[0006] Embryonic stem cell lines (ESCs) and iPSCs of varying pluripotent states can be expanded in vitro and can contribute to the formation of embryonic and / or extraembryonic tissues when injected into a host embryo. For example, after microinjection into mouse blastocysts, mouse naive ESCs or iPSCs (Bayerl et al. Cell Stem Cell (2021) 28(9):1549-1565.e12; Weinberger et al. Nat Rev Mol Cell Biol (2016) 17(3):155-69; Manor et al. Curr Opin Genet Dev (2015) 34:35-45; Shakiba et al. Nat Commun (2015) 16 6:7329; Gafni et al. Nature (2013) 504(7479):282-6; Geula et al. Science (2015) 347(6225):1002-6) can function like resident pluripotent cells and similarly contribute to embryogenesis (Nicols and Smith Cell Stem Cell (2016) 28(9):1549-1565.e12; Weinberger et al. Nat Rev Mol Cell Biol (2016) 17(3):155-69; Manor et al. Curr Opin Genet Dev (2015) 34:35-45; Shakiba et al. Nat Commun (2015) 16 6:7329; Gafni et al. Nature (2013) 504(7479):282-6; Geula et al. Science (2015) 347(6225):1002-6). Cell (2009) 4 (6): 487-92). In contrast, mouse primed pluripotent stem cells (also known as epiblast stem cells (EpiSCs)) expanded under N2B27 FGF2 / ACTIVIN conditions are extremely inefficient in generating chimeric embryos and fail to contribute significantly to such embryos when injected into host blastocysts or E7.5 embryos (Alejandro-Castrejon et al. Nature (2021) 593 (7857): 119-124).

[0007] Mouse trophoblast stem cells (TSCs) can be derived from early mouse embryos (E5.5-E7.5 post-implantation mouse embryos) or directly from in vitro mouse ESCs (through a process that requires several generations of growth and selection to establish stable mouse TSC lines, and is usually accompanied by overexpression of transgenes such as Cdx2). After microinjection of traditional stable mouse TSC lines into blastocysts, they can slightly promote late embryonic placental development, but they have never been shown to be able to reconstruct the entire placenta and trophectoderm progeny (Posfai et al. Nat Cell Biol (2021) 23 (1): 49-60). Injection of mouse naive ESCs or iPSCs by tetraploid embryo complementation microinjection can produce unique "all ESC / iPSC" chimeras, in which all embryonic cells come only from the injected mouse stem cells, and extraembryonic cells come only from the electro-fused cells of the host embryo (Choi et al. Nature (2017) 548 (7666): 219-223).

[0008] However, the goal of artificial embryos is to create embryo-like structures without any donated germ cells, fertilized eggs or blastocysts. Several studies have attempted to create synthetic embryos by co-aggregation of two or three different cell types [see, e.g., Zhang et al. (2020) Front. Bioeng. Biotechnol. 8:781]. For example, Harrisone et al. [Science (2017) DOI: 10.1126 / science.aa1810] used in vitro expanded mouse PSCs, non-pluripotent conventional trophoblast stem cells (TSCs), Sozen et al. (Nature Cell Biology volume 20, pages 979–989 (2018)) used in vitro expanded mouse PSCs, non-pluripotent conventional trophoblast stem cells (TSCs), and non-pluripotent extraembryonic endoderm cells (called XEN cells); while Amadei et al. [Developmental Cell (2021) 56, 366–382] used primitive iPSCs, non-pluripotent conventional TSC lines, and mouse ES cells that transiently overexpressed the Gata4 transcription factor to promote primitive endoderm fate (instead of using stable mouse XEN lines). However, the embryos obtained were severely malformed, unable to undergo or complete gastrulation or initiate organogenesis, and had abnormal morphology and lacked key embryo-defining features (DOI:10.1126 / sciadv.add2913). Summary of the invention

[0009] According to an aspect of some embodiments of the present invention there is provided a method of producing a synthetic embryo, the method comprising: (a) inducing the expression of factors that induce differentiation into trophectoderm cells in a subpopulation of naive pluripotent stem cells (PSCs) to obtain trophectoderm-initiated cells; and (b) mixing trophectoderm-derived cells with naive PSCs under conditions that allow the formation of aggregated cells, Wherein, when the factor inducing differentiation into trophectoderm cells is an exogenous factor, the induced expression includes induced transient expression starting from 14 days to 0 hours before mixing and ending no later than 120 hours after mixing; and Wherein, when the factor inducing differentiation into trophectoderm cells is an endogenous factor, inducing expression comprises: culturing the primitive PSC subpopulation under conditions capable of achieving expression of the factor starting within 14 days to 6 hours before the mixing, Thus creating a synthetic embryo.

[0010] According to some embodiments of the present invention, the method further includes: inducing the expression of factors that induce differentiation into extraembryonic primitive endoderm cells in a second subpopulation of primitive PSCs in (a) to obtain extraembryonic primitive endoderm initial cells; and mixing the extraembryonic primitive endoderm initial cells with the cells in (b).

[0011] According to some embodiments of the invention, wherein, when the factor inducing differentiation into extraembryonic primitive endoderm cells is an exogenous factor, the induced expression comprises induced transient expression starting from 14 days to 0 hours before mixing and ending no later than 120 hours after mixing; and Wherein, when the factor inducing differentiation into extraembryonic primitive endoderm cells is an endogenous factor, the inducing expression comprises: culturing the primitive PSC subpopulation under conditions capable of achieving the expression of the factor starting within 14 days to 6 hours before the mixing.

[0012] According to an aspect of some embodiments of the present invention there is provided a method of producing a synthetic embryo, the method comprising: (a) transient expression of exogenous factors that induce differentiation into trophectoderm cells in a subpopulation of naive pluripotent stem cells (PSCs) to obtain trophectoderm-initiated cells; and (b) mixing trophectoderm-derived cells with naive PSCs under conditions that allow the formation of aggregated cells, wherein the induction of transient expression begins from 14 days to 0 hours before the mixing and ends no later than 120 hours after the mixing, Thus creating a synthetic embryo.

[0013] According to some embodiments of the present invention, the method further includes: transient expression of exogenous factors that induce differentiation into extraembryonic primitive endoderm cells in a second subpopulation of primitive PSCs in (a) to obtain extraembryonic primitive endoderm initial state cells; and mixing the extraembryonic primitive endoderm initial state cells with the cells in (b).

[0014] According to some embodiments of the present invention, mixing naive PSCs, trophectoderm-initiating cells, and extraembryonic primitive endoderm-initiating cells is performed simultaneously.

[0015] According to some embodiments of the invention, mixing naive PSCs and extraembryonic primitive endoderm-initiating cells is performed prior to mixing with trophectoderm-initiating cells.

[0016] According to some embodiments of the invention, the trophectoderm cells and / or the extraembryonic primitive endoderm-initiating cells express pluripotency markers at 0 hours.

[0017] According to some embodiments of the invention, the trophectoderm cells and / or the extraembryonic primitive endoderm initiating cells express pluripotency markers when mixed.

[0018] According to some embodiments of the invention, the trophectoderm-initiating cells express trophectoderm markers at 0 hours.

[0019] According to some embodiments of the invention, the trophectoderm-initiating cells express trophectoderm markers when mixed.

[0020] According to some embodiments of the invention, the extraembryonic endoderm initiating state cells express extraembryonic primitive endoderm markers at 0 hours.

[0021] According to some embodiments of the invention, the extraembryonic endoderm-initiating cells express extraembryonic primitive endoderm markers when mixed.

[0022] According to an aspect of some embodiments of the present invention, there is provided an article comprising: (i) trophectoderm-initiated cells, wherein the trophectoderm-initiated cells include naive pluripotent stem cells (PSCs), and the naive pluripotent stem cells (PSCs) contain exogenous polynucleotides suitable for transiently expressing factors that induce differentiation into trophectoderm cells; and (ii) Original PSC.

[0023] According to some embodiments of the present invention, the article further comprises: (iii) extraembryonic primitive endoderm-initiation cells, wherein the extraembryonic primitive endoderm-initiation cells include primitive pluripotent stem cells (PSCs), and the primitive pluripotent stem cells (PSCs) contain exogenous polynucleotides suitable for transiently expressing factors that induce differentiation into extraembryonic primitive endoderm cells.

[0024] According to an aspect of some embodiments of the present invention, there is provided an article comprising: (i) trophectoderm-initiated cells, wherein the trophectoderm-initiated cells include naive pluripotent stem cells (PSCs), and the naive pluripotent stem cells (PSCs) contain exogenous polynucleotides suitable for transiently expressing factors that induce differentiation into trophectoderm cells; and (ii) extraembryonic primitive endoderm-initiation cells, wherein the extraembryonic primitive endoderm-initiation cells include primitive pluripotent stem cells (PSCs), and the primitive pluripotent stem cells (PSCs) contain exogenous polynucleotides suitable for transiently expressing factors that induce differentiation into extraembryonic primitive endoderm cells.

[0025] According to some embodiments of the invention, (i), (ii) and (iii) are located in a single container.

[0026] According to some embodiments of the invention, (i), (ii) and (iii) are located in different containers.

[0027] According to an aspect of some embodiments of the present invention, there is provided a method for culturing synthetic embryos extrauterine, the method comprising mixing cells of a product under conditions that allow the formation of aggregated cells, wherein the method comprises transient expression of an induction factor commencing within 14 days to 0 hours prior to mixing and ending no later than 120 hours after mixing, thereby producing a synthetic embryo.

[0028] According to an aspect of some embodiments of the present invention there is provided a mixture or an aggregate obtainable by the method.

[0029] According to an aspect of some embodiments of the present invention, there is provided a mixture or aggregate comprising: (i) Naive pluripotent stem cells (PSC); (ii) trophectoderm-initiated cells, wherein the trophectoderm-initiated cells include stem cells expressing endogenous trophectoderm markers and endogenous pluripotent markers; and (iii) extraembryonic primitive endoderm-initiation cells, wherein the extraembryonic primitive endoderm-initiation cells include stem cells expressing endogenous extraembryonic primitive endoderm markers and endogenous pluripotency markers, wherein the mixture or aggregate is not structurally organized as a natural embryo at any stage of development; and Wherein the mixture or aggregate is capable of forming a synthetic embryo that is structurally organized as a natural embryo at at least the post-implantation egg cylinder stage or the bilayer disc stage of development.

[0030] According to an aspect of some embodiments of the present invention, there is provided a mixture or aggregate comprising: (i) trophectoderm-initiated cells, wherein the trophectoderm-initiated cells include stem cells expressing exogenous factors inducing differentiation into trophectoderm cells, endogenous trophectoderm markers, and endogenous pluripotency markers; and (ii) Naive pluripotent stem cells (PSCs).

[0031] According to some embodiments of the present invention, the mixture or aggregate further comprises: (iii) extraembryonic primitive endoderm-initiation cells, wherein the extraembryonic primitive endoderm-initiation cells include stem cells expressing exogenous factors inducing differentiation into extraembryonic primitive endoderm cells, endogenous extraembryonic primitive endoderm markers and endogenous pluripotency markers.

[0032] According to some embodiments of the invention, factors inducing differentiation into extraembryonic primitive endoderm cells include Gata4, Gata6 and / or SOX17.

[0033] According to some embodiments of the present invention, the factors inducing differentiation into extraembryonic primitive endoderm cells include Gata4 and / or Gata6.

[0034] According to some embodiments of the invention, inducing expression of a factor inducing differentiation into extraembryonic primitive endoderm cells comprises culturing the second subpopulation of naive PSCs with the factor inducing differentiation into extraembryonic primitive endoderm cells starting within 14 days to 6 hours prior to mixing.

[0035] According to some embodiments of the invention, the method further comprises contacting the second subpopulation of naive PSCs with a factor that induces differentiation into extraembryonic primitive endoderm cells within 14 days to 0 hours prior to mixing.

[0036] According to some embodiments of the invention, the factor inducing differentiation into extraembryonic primitive endoderm cells is selected from the group consisting of a GSK-3 inhibitor, a WNT ligand, heparin, FGF2, FGF4, PDGF, leukemia inhibitory factor (LIF) and insulin.

[0037] According to some embodiments of the invention, the factor inducing differentiation into extraembryonic primitive endoderm cells is selected from the group consisting of a GSK-3 inhibitor, a WNT ligand, heparin, FGF2 and FGF4.

[0038] According to some embodiments of the invention, the factor inducing differentiation into trophectoderm cells is selected from the group consisting of Cdx2, Gata3 and Gata2.

[0039] According to some embodiments of the invention, inducing expression of a factor inducing differentiation into trophectoderm cells comprises culturing a subpopulation of naive PSCs with the factor inducing differentiation into trophectoderm cells starting within 14 days to 6 hours prior to mixing.

[0040] According to some embodiments of the invention, the method further comprises contacting the subpopulation of naive PSCs with a factor that induces differentiation into trophectoderm cells within 14 days to 0 hours prior to the mixing.

[0041] According to some embodiments of the invention, the factors inducing differentiation into trophectoderm cells are selected from the group consisting of TGFR inhibitors, FGFR inhibitors, MEK / ERK inhibitors, BMP4, JAK inhibitors, ROCK pathway inhibitors, FGF4, FGF2, heparin, SUMOylation inhibitors, histone deacetylase inhibitors, HIPPO signaling pathway inhibitors and factors inducing YAP nuclear translocation.

[0042] According to some embodiments of the invention, the factor inducing differentiation into trophectoderm cells is selected from the group consisting of FGF4, FGF2, heparin, a SUMOylation inhibitor, a histone deacetylase inhibitor, a HIPPO signaling pathway inhibitor and a factor inducing YAP nuclear translocation.

[0043] According to some embodiments of the invention, transient expression is achieved by introducing a polynucleotide encoding the factor.

[0044] According to some embodiments of the invention, the polynucleotide is DNA.

[0045] According to some embodiments of the invention, expression of the polynucleotide is regulated by an inducible promoter.

[0046] According to some embodiments of the invention, the introducing is performed by transient transfection.

[0047] According to some embodiments of the invention, the polynucleotide is RNA.

[0048] According to some embodiments of the invention, induction of transient expression begins within 120 to 0 hours before mixing.

[0049] According to some embodiments of the invention, induction of transient expression begins within 48 to 0 hours prior to mixing.

[0050] According to some embodiments of the invention, induction of transient expression begins within 24 to 0 hours prior to mixing.

[0051] According to some embodiments of the invention, induction of transient expression begins within 48 to 12 hours prior to mixing.

[0052] According to some embodiments of the invention, inducing transient expression is completed no later than 48 hours after mixing.

[0053] According to some embodiments of the invention, inducing transient expression is performed for no longer than 96 hours.

[0054] According to some embodiments of the invention, inducing the expression of the endogenous factor begins within 10 to 1 day prior to mixing.

[0055] According to some embodiments of the invention, the ratio between naive PSCs and trophectoderm-initiated cells is between 1:1 and 1:5.

[0056] According to some embodiments of the invention, the ratio between naive PSCs and trophectoderm-initiated cells is 1:3.

[0057] According to some embodiments of the invention, the ratio between naive PSCs and primitive endoderm-derived cells is between 1:1 and 2:1.

[0058] According to some embodiments of the invention, the ratio between naive PSCs and primitive endoderm-initiating cells is 1:1.

[0059] According to some embodiments of the invention, the method further comprises culturing the aggregated cells ex utero after (b).

[0060] According to an aspect of some embodiments of the present invention there is provided a method of culturing a synthetic embryo ex utero, the method comprising culturing the mixture or aggregate ex utero.

[0061] According to some embodiments of the invention, the culturing is performed in static culturing followed by dynamic culturing.

[0062] According to some embodiments of the invention, static culturing is performed until the embryos reach at least the early post-implantation egg cylinder stage or the bilayer disc stage.

[0063] According to some embodiments of the invention, dynamic culturing begins at the latest when the embryos reach the early somite stage.

[0064] According to an aspect of some embodiments of the present invention, a method for culturing synthetic embryos ex utero is provided, the method comprising culturing synthetic embryos at the aggregate stage ex utero in static culture followed by dynamic culture, wherein the static culture is performed until the embryos reach at least the early post-implantation egg cylinder stage or the double-layer disc stage; and the dynamic culture is initiated at the latest when the embryos reach the early somite stage.

[0065] According to some embodiments of the present invention, the dynamic culture comprises shake flask culture, roller culture or a sequential combination thereof.

[0066] According to some embodiments of the invention, the dynamic culturing is performed at a high pressure greater than 0.1 and less than 10.2 pounds per square inch (psi).

[0067] According to some embodiments of the invention, the dynamic culturing is performed at a high pressure greater than 5 and less than 10.2 pounds per square inch (psi).

[0068] According to some embodiments of the invention, the culturing is performed in an atmosphere comprising 10%-40% oxygen.

[0069] According to some embodiments of the present invention, the culturing is performed using a medium containing an increased concentration of serum or serum replacement during the culturing process.

[0070] According to some embodiments of the invention, culture is performed using a medium containing at least 15% serum or serum replacement from the start of culture until the embryos reach the early post-implantation egg cylinder stage or the bilayer disc stage, and thereafter culture is performed using a medium containing at least 30% serum or serum replacement.

[0071] According to some embodiments of the invention, for at least a portion of the culturing, the culturing is performed using a medium comprising human serum.

[0072] According to some embodiments of the invention, the method further comprises transferring the synthetic embryo into the uterus.

[0073] According to some embodiments of the invention, the cell is a mammalian cell.

[0074] According to some embodiments of the invention, the mammalian cell is a mouse cell.

[0075] According to some embodiments of the invention, the mammalian cell is a human cell.

[0076] According to some embodiments of the invention, the mammalian cell is a non-human primate cell.

[0077] According to some embodiments of the invention, the mammalian cell is a livestock cell.

[0078] According to some embodiments of the present invention, there is provided a synthetic embryo obtainable by the method.

[0079] According to an aspect of some embodiments of the present invention, there is provided a method for obtaining extraembryonic primitive endoderm-derived cells, the method comprising culturing primitive PSCs in a basal medium without activin A, wherein the culture conditions allow the primitive PSCs to differentiate into GATA4 + GATA6 + OCT4 + Nanog - Extraembryonic primitive endoderm initiating state cells, thereby obtaining extraembryonic primitive endoderm initiating state cells.

[0080] According to some embodiments of the invention, the culturing is performed for at least 1 day.

[0081] According to some embodiments of the invention, the culturing is carried out for up to 10 days.

[0082] According to some embodiments of the invention, the cells can be expanded in culture for at least five generations while maintaining GATA4 + GATA6 + OCT4 + Nanog - Phenotype.

[0083] According to some embodiments of the invention, the basal culture medium is supplemented with at least one of a GSK-3 inhibitor, leukemia inhibitory factor (LIF) and insulin.

[0084] According to some embodiments of the invention, the basal culture medium is supplemented with at least one of a GSK-3 inhibitor, heparin, FGF4, PDGF and BSA.

[0085] According to some embodiments of the invention, the cell is a human cell.

[0086] According to some embodiments of the invention, the cell is a mouse cell.

[0087] Unless otherwise defined, all technical and / or scientific terms used herein have the same meanings as those of ordinary skill in the art to which the invention belongs. Although methods and materials similar or equivalent to the methods and materials described herein can be used in practice or testing embodiments of the present invention, exemplary methods and / or materials are described below. In the event of a conflict, the patent specification (including definitions) shall prevail. In addition, materials, methods and examples are for illustrative purposes only and are not intended to be limiting. BRIEF DESCRIPTION OF THE DRAWINGS

[0088] Some embodiments of the present invention are described herein by way of example only and with reference to the accompanying drawings. With specific reference now to the accompanying drawings, it should be emphasized that the details shown are only provided as examples and for the purpose of illustrative discussion of embodiments of the present invention. In this regard, the description in conjunction with the accompanying drawings will make it clear to those skilled in the art how embodiments of the present invention may be implemented.

[0089] In the attached picture:

[0090] Figure 1 Immunostained images of passage 3 E6.5 mouse embryo-derived mouse TSC line #1 (day 14 after derivation) are shown, demonstrating the expression of TSC markers Cdx2 and Gata3. DAPI was used for counterstaining.

[0091] Figure 2 Immunostaining images of passage 5 mouse TSC line #1 (day 25 after derivation) are shown, demonstrating expression of TSC markers Cdx2, TBR2, Gata3, and TFAP2C, but not Oct4 and Nanog. DAPI was used for counterstaining.

[0092] FIG. 3A to FIG. 3B The parental ESC lines ( Figure 3A ) and the 3rd generation mouse TSC line #2 derived from transient Oct4 knockdown of the parental ES line (approximately day 12 from protocol initiation) ( Figure 3B ) demonstrates the expression of TSC markers Cdx2 and Gata3, but not Oct4, in established TSC lines. DAPI was used for counterstaining.

[0093] Figure 4Immunostaining images of mouse TSC line #2 at passage 5 (day 30 from protocol initiation) are shown, demonstrating expression of TSC markers Cdx2, TBR2, Gata3, and TFAP2C, but not Oct4 and Nanog. DAPI was used for counterstaining.

[0094] Figure 5 Immunostaining images of mouse TSC line #3 at passage 4 (approximately day 24 from protocol initiation and transfection) are shown, demonstrating expression of TSC markers Cdx2 and Gata3 as well as TFAP2C, but not Oct 4. DAPI was used for counterstaining.

[0095] Fig. 6A Shown are immunostained images of mouse XEN line #7 at passage 5, demonstrating expression of XEN markers Foxa2 and Gata4, but not Oct4 and Nanog. DAPI was used for counterstaining.

[0096] Figure 6B RNA expression levels of XEN markers Gata6, PDGFRA, Sox17, and Gata4 in mouse XEN lines XEN-ICR clone #7 and XEN-Prep 1 determined by real-time PCR analysis are shown. Mouse V6.5 naive ESCs expanded under 2i-LIF conditions were used as reference controls (values ​​set to 1).

[0097] Fig. 7A Figures C to C demonstrate that co-aggregation of naive mouse PSCs (V6.5-GFP), mouse XEN cells (mouse XEN line #7 cells), and mouse TSCs (mouse TSC line #1 cells) and subsequent ex utero culture does not result in the formation of organized embryos. Fig. 7AAggregation medium (AM) – 1:1 DMEM-F12 (Thermo 11320033) and Neurobasal (Thermo 21103049), Glutamax 1x, Sodium Pyruvate 1mM, Pen / Strep 1x, NEAA 1x, N2 supplement 1x (Thermo 17502048), B27 supplement 1x (Thermo 17504044), β-mercaptoethanol 0.1mM (Thermo 31350010) and 0.45% BSA (Sigma Aldrich A7979) (500ml total). IVC1 medium – Advanced DMEM / F12 (Gibco12634010) Glutamax1x, Pen / Strep 1x, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, N-acetyl-L-cysteine ​​25μM and serum as indicated in the protocol [total 500ml]. EUCM – 25% DMEM (GIBCO 11880), 25% HAS (adult serum or human umbilical cord serum), 50% rat serum (RAS), Glutamax 1X (GIBCO 35050038), HEPES2mM (GIBCO 15630056), Pen / Strep 1x. Figure 7B Shown are representative images of embryoid body aggregates immunostained on day 4 of the protocol: TBR2 (red) marks the trophectoderm lineage, Gata4 marks the primitive endoderm lineage, and GFP signal marks ESCs contributing to the epiblast. Figure 7C Images or representative structures from protocol day 7 are shown, demonstrating the absence of an organized embryo in the yolk sac and no signs of the emergence of neural folds and cardiac regions.

[0098] FIG. 7D to FIG. 7F It was shown that co-aggregation of naive mouse PSCs (V6.5-GFP), mouse KH2-Gata4 Dox-inducible ES cells, and mouse TSCs (mouse TSC line #1 cells) followed by ex utero culture did not result in the formation of organized embryos. Fig.7DAggregation medium (AM) – 1:1 DMEM-F12 (Thermo 11320033) and Neurobasal (Thermo 21103049), Glutamax 1x, Sodium Pyruvate 1mM, Pen / Strep 1x, NEAA 1x, N2 supplement 1x (Thermo 17502048), B27 supplement 1x (Thermo 17504044), β-mercaptoethanol 0.1mM (Thermo 31350010), 0.45% BSA (Sigma Aldrich A7979) (500ml total). IVC1 medium – Advanced DMEM / F12 (Gibco12634010) Glutamax 1x, Pen / Strep1x, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, N-acetyl-L-cysteine ​​25μM and serum or KSR as indicated in the protocol (500ml total). EUCM – 25% DMEM (GIBCO 11880), 25% HAS (adult serum or human umbilical cord serum), 50% rat serum (RAS), Glutamax1X (GIBCO 35050038), HEPES2mM (GIBCO 15630056), Pen / Strep 1x. Fig. 7E Shown are representative images of embryoid body aggregates immunostained on days 5 and 6 of the protocol: TBR2 (red) marks the trophectoderm lineage, Gata4 marks the primitive endoderm lineage, and GFP signal marks ESCs contributing to the epiblast. Figure 7F Images or representative structures from days 7 and 8 of the protocol are shown, demonstrating the absence of an organized embryo in the yolk sac and no signs of the emergence of neural folds and cardiac regions.

[0099] Figure 8 Schematic diagram showing the generation and validation of KH2-Gata4 Dox-inducible naive ES cells.

[0100] Fig. 9 Real-time PCR analysis of exogenous GATA4 expression in different KH2-Gata4 mouse ES clones targeting TetOn-Gata4 in the collagen locus after treatment with DOX is shown. KH2-WT and irradiated mouse fibroblasts (MEFs) were used as negative controls.

[0101] Fig.10Shown are images of immunostaining of different KH2 mouse naive ES clones targeting TetOn-Gata4 in the collagen locus (KH2-Gata4) before and after treatment with DOX under naive 2i / LIF conditions. Gata4 was strongly expressed in the tested clones only after DOX treatment. DAPI was used for counterstaining.

[0102] Fig.11 A schematic diagram of the generation and validation of KH2-Cdx2 Dox-inducible cells is shown.

[0103] Fig.12 Real-time PCR analysis showing exogenous Cdx2 expression in different KH2-Cdx2 mouse ES clones targeting TetOn-Cdx2 in the collagen locus after treatment with DOX. KH2-WT cells were used as negative control.

[0104] Fig.13 Immunostaining of KH2 mouse naive ES clone #3 targeting the collagen locus TetOn-Cdx2 (KH2-Cdx2) before and after treatment with DOX under naive 2i / LIF conditions is shown. Cdx2 was strongly expressed in the clones tested only after DOX treatment. DAPI was used for counterstaining.

[0105] Fig.14 Immunostaining of KH2 mouse naive ES clone #7 targeting TetOn-Cdx2 in the collagen locus (KH2-Cdx2) is shown before and after treatment with DOX under naive 2i / LIF conditions. Cdx2 was strongly expressed in the clones tested only after DOX treatment. DAPI was used for counterstaining.

[0106] FIG. 15A to FIG. 15F It was shown that coaggregation of naive KH2-WT ES cells with DOX-pretreated KH2-Gata4 naive ES cells and DOX-pretreated KH2-Cdx2 naive ES cells followed by ex utero culture resulted in the generation of organized embryos. Fig.15AAggregation medium (AM) – 1:1 DMEM-F12 (Thermo 21331-020) and Neurobasal (Thermo 21103049), Glutamax 1x, sodium pyruvate 1mM, Pen / Strep 1x, NEAA 1x, N2 supplement 1x (Thermo 17502048), B27 supplement 1x (Thermo 17504044), β-mercaptoethanol 0.1mM (Thermo31350010), 0.45% BSA (SigmaAldrich A7979) (total 500ml); EUCM2-CMRL-CMRL (Gibco11530037), Glutamax 1x, sodium pyruvate 1mM, Pen / Strep 1x+NEAA 1x, D-glucose 4mg / mL, ITS-X1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 20% FBS (total 500ml). EUCM3-CMRL-CMRL (Gibco 11530037), Glutamax 1x, sodium pyruvate 1mM, Pen / Strep 1x+NEAA 1x, D-glucose 4mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 30% FBS (total 500ml). EUCM4-CMRL -CMRL (Gibco 11530037), Glutamax 1x, sodium pyruvate 1mM, Pen / Strep 1x+NEAA 1x, D-glucose 4mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 30% HSA (total 500ml). EUCM–25% DMEM (GIBCO 11880), 25% HSA, 50% rat serum, Glutamax 1X (GIBCO 35050038), HEPES 2mM (GIBCO 15630056), Pen / Strep 1x. Fig. 15B Phase contrast images of synthetic embryos acquired at the indicated time points are shown. On days 4 and 5, embryos with an egg-cylindrical shape are clearly visible, with the extra embryonic ectoderm (EXE) appearing on the contralateral side. On day 6.5, the yolk sac and ectoplacental cone are clearly visible, with the embryo-like structure encapsulated inside. On day 7, embryos that have completed gastrulation are clearly visible, with distinct neural folds and somite formation and a beating heart. FIG. 15C to FIG. 15FImmunostaining images of synthetic embryos obtained are shown. Embryos obtained on day 7 of the protocol correspond to E8.5 stage embryos ( FIG. 15C to FIG. 15D ).exist Fig. 15C In the figure, the embryo shows that the neural folds are stained positive for the Sox2 marker (red) and the mesoderm is stained positive for brachyury (green). Fig.15D In the figure, the embryo shows neural folds that stain positively for the Pax6 marker (green) and the Sox17 marker (red), which marks the developing gut endoderm. Embryos obtained on day 8 of the protocol correspond to E9.5 stage embryos ( FIG. 15E to FIG. 15F ).exist Fig.15E In the middle, the embryo shows neural tube closure and somites formation (positive staining for Sox9 in red). Otx2 (magenta) marks the forebrain region. Fig.15F In the figure, the embryo shows advanced organogenesis and normal morphology, with abundant distribution of neural brain cells, staining positive for the Tuj1 marker (green).

[0107] FIG. 16A to FIG. 16B It was shown that in the presence of Dox, co-aggregation of KH2-WT naive ES cells with naive KH2-Gata4 and KH2-Cdx2 naive cells followed by ex utero culture resulted in the generation of organized embryos. Fig.16AAggregation medium (AM) – 1:1 DMEM-F12 (Thermo 11320033) and Neurobasal (Thermo 21103049), Glutamax 1x, sodium pyruvate 1mM, Pen / Strep 1x, NEAA 1x, N2 supplement 1x (Thermo 17502048), B27 supplement 1x (Thermo 17504044), β-mercaptoethanol 0.1mM (Thermo 31350010), 0.45% BSA (SigmaAldrich A7979) (total 500ml); EUCM2-CMRL-CMRL (Gibco 11530037), Glutamax 1x, sodium pyruvate 1mM, Pen / Strep 1x+NEAA 1x, D-glucose 4mg / mL, ITS-X 1x (Gibco51500056), β-estradiol 8nM, progesterone 20ng / ml, 20% FBS (total 500ml). EUCM3-CMRL-CMRL (Gibco11530037), Glutamax 1x, sodium pyruvate 1mM, Pen / Strep 1x+NEAA 1x, D-glucose 4mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 30% FBS (total 500ml). EUCM4-CMRL-CMRL (Gibco 11530037), Glutamax 1x, sodium pyruvate 1mM, Pen / Strep 1x+NEAA 1x, D-glucose 4mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 30% HAS (total 500ml). EUCM–25% DMEM (GIBCO 11880), 25% HAS, 50% rat serum (RAS), Glutamax 1X (GIBCO35050038), HEPES 2mM (GIBCO 15630056), Pen / Strep 1x. Fig. 16B Phase contrast images of composite embryos acquired at the indicated time points are shown. On days 4 and 6, embryos with a clear egg-cylindrical shape are evident, with the extraembryonic ectoderm (EXE) appearing on the contralateral side. On day 6.5, the yolk sac and ectoplacental cone are evident, with embryo-like structures enclosed within. On day 7, embryos that have completed gastrulation are evident, with prominent neural folds and early somite formation and a beating heart.

[0108] FIG. 17A to FIG. 17BThese results suggest that coaggregation of KH2-WT naive ES cells with Dox-pretreated naive KH2-Gata4 ES cells and Dox-pretreated KH2-Cdx2 naive ES cells followed by ex utero culture resulted in the generation of organized embryos. Fig.17A Aggregation medium (AM) – 1:1 DMEM-F12 (Thermo 11320033) and Neurobasal (Thermo 21103049), Glutamax 1x, sodium pyruvate 1mM, Pen / Strep 1x, NEAA 1x, N2 supplement 1x (Thermo 17502048), B27 supplement 1x (Thermo 17504044), β-mercaptoethanol 0.1mM (Thermo31350010), 0.45% BSA (SigmaAldrich A7979) (total 500ml); EUCM2-CMRL-CMRL (Gibco11530037), Glutamax 1x, sodium pyruvate 1mM, Pen / Strep 1x+NEAA 1x, D-glucose 4mg / mL, ITS-X1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 20% FBS (total 500ml). EUCM3-CMRL-CMRL (Gibco 11530037), Glutamax 1x, sodium pyruvate 1mM, Pen / Strep 1x+NEAA 1x, D-glucose 4mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 30% FBS (total 500ml). EUCM4-CMRL-CMRL (Gibco 11530037), Glutamax 1x, sodium pyruvate 1mM, Pen / Strep 1x+NEAA 1x, D-glucose 4mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 30% HAS (total 500ml). EUCM–25% DMEM (GIBCO 11880), 25% HAS, 50% RAS, Glutamax 1X (GIBCO 35050038), HEPES 10mM (GIBCO 15630056), Pen / Strep 1x. Fig. 17BPhase contrast images of synthetic embryos obtained at the indicated time points are shown. At day 6, embryos with a clear egg cylindrical shape are clearly visible, and the contralateral extraembryonic ectoderm (EXE) appears. At day 6.5, yolk sac and ectopladenal cones are clearly visible, with embryo-like structures encased inside. At day 7, embryos that have completed gastrulation are clearly visible, with distinct neural folds and early somite formation and a beating heart, comparable to E8.5.

[0109] Fig.18A Panel B shows that in the presence of Dox, co-aggregation of KH2-WT naive ES cells with KH2-Gata4 naive ES cells and KH2-Cdx2 naive ES cells followed by in vitro culture resulted in the generation of organized embryos. Fig.18AAggregation medium (AM) – 1:1 DMEM-F12 (Thermo 11320033) and Neurobasal (Thermo 21103049), Glutamax 1x, Sodium Pyruvate 1mM, Pen / Strep 1x, NEAA 1x, N2 supplement 1x (Thermo 17502048), B27 supplement 1x (Thermo 17504044), β-mercaptoethanol 0.1mM (Thermo 31350010), 0.45% BSA (SigmaAldrich A7979) (500ml total). EUCM2-CMRL - ​​1:1 mixture of advDMEM / F12-CMRL (Gibco 11530037) and advanced DMEM / F12 (Thermo 12634010), Glutamax 1x, Sodium Pyruvate 1 mM, Pen / Strep 1x+NEAA 1x, D-Glucose 1 mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8 nM, Progesterone 20 ng / ml, 20% FBS (500 ml total). EUCM3-CMRL - ​​1:1 mixture of advDMEM / F12-CMRL (Gibco 11530037) and advanced DMEM / F12 (Thermo 12634010), Glutamax 1x, Sodium Pyruvate 1mM, Pen / Strep 1x+NEAA 1x, D-Glucose 4mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, Progesterone 20ng / ml, 30% FBS (500ml total). EUCM4-CMRL-advDMEM / F12-CMRL (Gibco 11530037) and Advanced DMEM / F12 (Thermo 12634010) 1:1 mixture, Glutamax 1x, sodium pyruvate 1mM, Pen / Strep 1x+NEAA 1x, D-glucose 4mg / mL, ITS-X 1x (Gibco51500056), β-estradiol 8nM, progesterone 20ng / ml, 30% HAS (total 500ml). EUCM-25% DMEM (GIBCO 11880), 25% HAS, 50% RAS, Glutamax 1X (GIBCO35050038), HEPES 10mM (GIBCO 15630056), Pen / Strep 1x. Fig.18BPhase contrast images of synthetic embryos obtained at the indicated time points are shown. At days 4, 5, and 6, embryos with a clear egg-cylindrical shape are evident, with the presence of the extraembryonic ectoderm (EXE) on the contralateral side. At day 6.5, the yolk sac, ectoplacental cone, and umbilical cord invagination are evident, with embryo-like structures encased inside. At day 7, embryos that have completed gastrulation are evident, with distinct neural folds and early somite formation and a beating heart.

[0110] Fig.19A Figure B shows that co-aggregation of KH2-WT naive ES cells with Dox-pretreated KH2-Gata4 naive ES cells and Dox-pretreated KH2-Cdx2 naive ES cells followed by ex utero culture resulted in the generation of organized embryos. Fig.19A Aggregation medium (AM) – 1:1 DMEM-F12 (Thermo 11320033) and Neurobasal (Thermo 21103049), Glutamax 1x, Sodium Pyruvate 1mM, Pen / Strep 1x, NEAA 1x, N2 supplement 1x (Thermo 17502048), B27 supplement 1x (Thermo 17504044), β-mercaptoethanol 0.1mM (Thermo31350010), 0.45% BSA (SigmaAldrich A7979) (500ml total). IVC1-Advanced DMEM / F12 (Gibco12634010) Glutamax 1x, Pen / Strep 1x, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, N-acetyl-L-cysteine ​​25μM, and indicated FBS or HSA (total 500ml). EUCM-25% DMEM (GIBCO 11880), 25% HAS, 50% RAS, Glutamax 1X (GIBCO 35050038), HEPES 2mM (GIBCO15630056), Pen / Strep 1x. Fig.19B Phase contrast images of synthetic embryos acquired at the indicated time points are shown. At day 6, an embryo with a clear egg-cylindrical shape is evident, and the extraembryonic ectoderm (EXE) is present on the contralateral side. At day 6.5, a yolk sac and an ectoplacental cone are evident, with embryo-like structures enclosed within.

[0111] FIG. 20A to FIG. 20BThese results suggest that coaggregation of KH2-WT naive ES cells with Dox-pretreated KH2-Gata4 and Dox+FGF4+LPA-pretreated KH2-Cdx2 naive ES cells followed by ex utero culture resulted in the generation of organized embryos. Fig. 20AAggregation medium (AM) – 1:1 DMEM-F12 (Thermo 11320033) and Neurobasal (Thermo 21103049), Glutamax 1x, Sodium Pyruvate 1mM, Pen / Strep 1x, NEAA 1x, N2 supplement 1x (Thermo 17502048), B27 supplement 1x (Thermo17504044), β-mercaptoethanol 0.1mM (Thermo31350010), 0.45% BSA (SigmaAldrich A7979) (500ml total). EUCM2-CMRL-advDMEM / F12-a 1:1 mixture of CMRL (Gibco 11530037) and advanced DMEM / F12 (Thermo 12634010), Glutamax 1x, sodium pyruvate 0.5mM, Pen / Strep1x+NEAA0.5x, D-glucose 4mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 20% FBS (500ml in total). EUCM3-CMRL-advDMEM / F12–1:1 mixture of CMRL (Gibco11530037) and advanced DMEM / F12 (Thermo 12634010), Glutamax 1x, sodium pyruvate 0.5 mM, Pen / Strep 1x+NEAA 0.5x, D-glucose 4 mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8 nM, progesterone 20 ng / ml, 30% FBS (500 ml total). EUCM4-CMRL-advDMEM / F12-CMRL (Gibco11530037) and advanced DMEM / F12 (Thermo 12634010) 1:1 mixture, Glutamax 1x, sodium pyruvate 0.5mM, Pen / Strep 1x+NEAA0.5x, D-glucose 4mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 30% HAS (total 500ml). EUCM-25% DMEM (GIBCO 11880), 25% HAS, 50% RAS, Glutamax 1X (GIBCO 35050038), HEPES 2mM (GIBCO 15630056), Pen / Strep 1x. Fig. 20BPhase contrast images of synthetic embryos obtained at the indicated time points are shown. On day 6, embryos with a clear egg cylindrical shape and amnion are clearly visible, and the extraembryonic ectoderm (EXE) appears on the contralateral side. On day 6.5, the yolk sac and the ectoplacental cone and umbilical cord are clearly visible, with embryo-like structures enclosed inside. On day 7, embryos that have completed gastrulation are clearly visible, with distinct neural folds and early somite formation and a beating heart.

[0112] Fig.21A schematic scheme of co-aggregation of KH2-WT naive cells with Dox+CHIR99021 pretreated KH2-Gata4 naive cells and Dox+LPA pretreated KH2-Cdx2 naive cells followed by ex utero culture leading to organized embryos is shown. Aggregation medium (AM) - 1:1 DMEM-F12 (Thermo 11320033) and Neurobasal (Thermo 21103049), Glutamax 1x, Sodium Pyruvate 1mM, Pen / Strep 1x, NEAA 1x, N2 supplement 1x (Thermo 17502048), B27 supplement 1x (Thermo 17504044), β-mercaptoethanol 0.1mM (Thermo 31350010), 0.45% BSA (SigmaAldrich A7979) (500ml total). EUCM2-CMRL - ​​1:4 mixture of advDMEM / F12 CMRL (Gibco 11530037) and advanced DMEM / F12 (Thermo 12634010), Glutamax 1x, sodium pyruvate 0.5mM, Pen / Strep 1x+NEAA 0.5x, additional D-glucose 2mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 20% FBS (500ml total). EUCM3-CMRL-advDMEM / F12–4:1 mixture of CMRL (Gibco11530037) and advanced DMEM / F12 (Thermo 12634010), Glutamax 1x, sodium pyruvate 0.5mM, Pen / Strep 1x+NEAA0.5x, additional D-glucose 2mg / mL, ITS-X 1x (Gibco51500056), β-estradiol 8nM, progesterone 20ng / ml, 30% FBS (500ml total). EUCM4*-CMRL-advDMEM / F12-a 4:1 mixture of CMRL (Gibco11530037) and advanced DMEM / F12 (Thermo 12634010), Glutamax 1x, sodium pyruvate 0.5mM, Pen / Strep 1x+NEAA0.5x, additional D-glucose 3mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 20% RAS, 10% HAS, 10% KSR, HEPES 2mM (GIBCO 15630056) (total 500ml).EUCM5-CMRL-advDMEM / F12-a 4:1 mixture of CMRL (Gibco 11530037) and advanced DMEM / F12 (Thermo12634010), Glutamax 1x, sodium pyruvate 0.5mM, Pen / Strep 1x+NEAA0.5x, additional D-glucose 3mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 30% RAS, 15% HAS, 5% KSR, HEPES 2mM (GIBCO 15630056) (total 500ml). EUCM-25% Advanced DMEM / F12 (Thermo12634010), 25% HAS, 50% RAS, Glutamax 1X (GIBCO 35050038), HEPES 2mM (GIBCO15630056), Pen / Strep 1x.

[0113] Fig. 22A schematic scheme of co-aggregation of KH2-WT naive ES cells with Dox+CHIR99021 pre-treated KH2-Gata4 naive ES cells and Dox+LPA pre-treated KH2-Cdx2 naive ES cells followed by ex utero culture leading to organized embryos is shown. Aggregation medium (AM) - 1:1 DMEM-F12 (Thermo 11320033) and Neurobasal (Thermo 21103049), Glutamax 1x, Sodium Pyruvate 1mM, Pen / Strep 1x, NEAA 1x, N2 supplement 1x (Thermo 17502048), B27 supplement 1x (Thermo 17504044), β-mercaptoethanol 0.1mM (Thermo31350010), 0.45% BSA (SigmaAldrich A7979) (500ml total). EUCM2-CMRL-advDMEM / F12: 1:4 mixture of CMRL (Gibco 11530037) and advanced DMEM / F12 (Thermo 12634010), Glutamax 1x, sodium pyruvate 0.5mM, Pen / Strep 1x+NEAA 0.5x, additional D-glucose 2mg / mL, ITS-X 1x (Gibco51500056), β-estradiol 8nM, progesterone 20ng / ml, 20% FBS (500ml total). EUCM3-CMRL-advDMEM / F12: 4:1 mixture of CMRL (Gibco 11530037) and advanced DMEM / F12 (Thermo 12634010), Glutamax 1x, Sodium Pyruvate 0.5mM, Pen / Strep 1x+NEAA 0.5x, additional D-glucose 2mg / mL, ITS-X 1x (Gibco51500056), β-estradiol 8nM, progesterone 20ng / ml, 30% FBS (total 500ml). EUCM4*-CMRL - ​​4:1 mixture of advDMEM / F12-CMRL (Gibco 11530037) and advanced DMEM / F12 (Thermo 12634010), Glutamax 1x, sodium pyruvate 0.5mM, Pen / Strep 1x+NEAA 0.5x, additional D-glucose 3mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 20% RAS, 10% HAS+HEPES 2mM (GIBCO 15630056) (total 500ml).EUCM5-CMRL-advDMEM / F12-a 4:1 mixture of CMRL (Gibco 11530037) and advanced DMEM / F12 (Thermo12634010), Glutamax 1x, sodium pyruvate 0.5mM, Pen / Strep 1x+NEAA 0.5x, additional D-glucose 3mg / mL, ITS-X 1x (Gibco 51500056), β-estradiol 8nM, progesterone 20ng / ml, 30% RAS, 15% HAS, HEPES 2mM (GIBCO 15630056) (total 500ml). EUCM-25% Advanced DMEM / F12 (Thermo12634010), 25% HAS, 50% RAS, Glutamax1X (GIBCO 35050038), HEPES2mM (GIBCO15630056), Pen / Strep 1x.

[0114] FIG. 23A to FIG. 23D Representative immunostaining images of synthetic embryos obtained according to the protocol described in Example 2 are shown, demonstrating that organized synthetic embryos were generated. Fig.23A Shown are immunostainings of representative day 4 mouse synthetic embryos from indicated schemes. OTX2 (grey) is used to stain the pluripotent epiblast of the initial state, Gata4 (red) is used to stain the extraembryonic primitive endoderm progeny, and TFAP2C (green) is used to mark the trophoblast lineage. The image shows a normal embryonic structure with an egg cylindrical morphology, in which the trophoblast EXE and the pluripotent epiblast are self-organized on the opposite side of the embryo as expected, and Gata4 primitive endoderm cells surround the embryo. Fig. 23B Shown are immunostainings of representative day 4 mouse synthetic embryos from the indicated scheme.Oct4 (grey) is used to dye the pluripotent epiblast of the initial state in the egg cylindrical shape epiblast, and Sox17 (red) is used to dye the extraembryonic primitive endoderm progeny, and Cdx2 is used to mark the trophoblast pedigree.Image shows the normal embryonic structure with egg cylindrical morphology, wherein, trophoblast EXE and pluripotent epiblast (Oct4+ region) are self-organized to the opposite side of the Cdx2+ region, and Sox17+ primitive endoderm cells surround the embryo. Fig.23CShown are immunostainings of representative day 4 or day 5 mouse synthetic embryos from the indicated scheme.Oct4 (grey) is used for dyeing the primordial state pluripotent epiblast in the egg cylindrical shape epiblast, and Sox17 (red) is used for dyeing the extraembryonic primitive endoderm progeny, and Cdx2 is used for marking trophoblast pedigree.Image shows the normal embryonic structure with egg cylindrical state, wherein, trophoblast EXE and pluripotent epiblast (Oct4+ region) are self-organized to the opposite side of the Cdx2+ region, and Sox17+ primitive endoderm cells surround the embryo. Fig.23D Shows the Fig.21 Immunostaining of representative mouse synthetic embryos in the scheme shown in . Oct4 (magenta) is used to stain the primordial pluripotent epiblast in the egg cylindrical epiblast. T / Brachyury marks the appearance of the primitive streak, stained green. DAPI is blue and used for counterstaining. The egg cylindrical mouse embryo on day 6 shows the primitive streak formation and simulated gastrulation on day 7 of the scheme, as shown by specific immunostaining.

[0115] Fig.24 The results show that KH2-Gata4 naive ES cells before and after Dox administration and in Fig.17A Endogenous expression of the indicated markers in day 4 synthetic embryos obtained according to the protocol described in , as determined by real-time PCR.

[0116] Fig.25 The results show that the expression of KH2-Cdx2 in naive ES cells before and after Dox administration and in the Fig.17A Endogenous expression of the indicated markers in day 4 synthetic embryos obtained according to the protocol described in , as determined by real-time PCR.

[0117] Fig.26 The results show that the expression of KH2-Cdx2 in naive cells before and after administration of Dox and LPA and in the Fig.19A Endogenous expression of the indicated markers in day 4 synthetic embryos obtained according to the protocol described in , as determined by real-time PCR.

[0118] Fig. 27 Shown are endogenous expression of the indicated markers in KH2-Cdx2 naive ES cells before and after treatment with Dox and the indicated media and factors, as determined by real-time PCR.

[0119] Fig.28 Schematic representation of the targeting vectors for Cdx2 or Gata3 designed to generate human TetON-inducible Gata4 or Gata3-2A-Cdx2 overexpression inserts is shown.

[0120] Fig.29 Human naive PSC clones correctly targeted for overexpression of GATA4 or CDX2 are shown. Western blot analysis before and after targeting regimen and DOX treatment is shown, demonstrating specific overexpression of the corresponding TF after DOX.

[0121] Fig.30 Shown is the plasmid design used to generate a lentivirus that allows TetOn-inducible overexpression of Gata4 following treatment of lentiviral-infected mouse or human PSCs with Dox. The green reporter is also DOX-responsive. This lentivirus can be used with PSCs already expressing M2RTTA or co-infected with a lentivirus encoding FUW-CAGGS-M2Rtta.

[0122] Fig.31 Shown is the plasmid design used to generate a lentivirus that allows TetOn-inducible overexpression of CDX2 following treatment of lentivirus-infected mouse or human PSCs with Dox. The green reporter is also DOX-responsive. This lentivirus can be used with PSCs already expressing M2RTTA or co-infected with a lentivirus encoding FUW-CAGGS-M2Rtta.

[0123] Fig.32 Shown is the plasmid design of the pcDNA3 plasmid used for transient transfection of mouse or human naive PSCs, encoding GATA4-IRES-Green fluorescence under the CMV promoter.

[0124] Fig.33 Shown is the plasmid design used for transient transfection of human naive PSCs encoding human CDX2-IRES-Green fluorescence under the CAGGS promoter.

[0125] Fig.34 The plasmid design for generating human lentivirus is shown, allowing TetOn-induced overexpression of YAP*mut (a mutant carrying enforced YAP nuclear localization) after treatment of lentivirus-infected mice or human PSCs with Dox. The green GFP reporter gene is also DOX-responsive. This lentivirus can be used with PSCs already expressing M2RTTA, or co-infected with FUW-CAGGS-M2Rtta-encoding lentivirus. For this construct, constitutively active (mut) human YAP was used - serine at positions 61, 109, 127, 128, 131, 163, 164 and 381 were changed to alanine (phosphorylation sites), see addgene entry #27371, from which the insert fragment was taken (Yap-mut).

[0126] Fig.35The plasmid design for generating lentivirus is shown, allowing for TetOn-inducible overexpression of Gata3 following treatment of lentiviral-infected mouse or human PSCs with Dox. The CFP reporter is also DOX-responsive. This lentivirus can be used with PSCs already expressing M2RTTA, or co-infected with a lentivirus encoding FUW-CAGGS-M2Rtta.

[0127] Fig.36 Shown is the plasmid design of plasmids used for transient transfection of mouse or human naive PSCs encoding GATA3-IRES-CFP fluorescence under the CAGGS promoter.

[0128] Fig.37 Plasmid design of pcDNA3 plasmids for transient transfection of mouse or human naive PSCs is shown, encoding YAP*mut-IRES-CFP fluorescence under the CMV promoter. Yap-mut: A mutant carrying enforced YAP nuclear localization. For this construct, constitutively active (mut) human YAP was used—serine at positions 61, 109, 127, 128, 131, 163, 164, and 381 were changed to alanine (phosphorylation sites), see addgene entry #27371, from which the insert was taken (Yap-mut).

[0129] Fig.38A Figures B to B show images of representative synthetic embryoid bodies obtained according to the protocol described in Example 3, demonstrating the generation of a human day 4.5 synthetic embryo. Fig.38A Phase contrast images of day 4.5 synthetic human embryoid bodies are shown. Fig.38B Shown are images of representative day 4.5 synthetic human embryoid bodies immunostained for the Oct4 pluripotency marker, the Sox17 primitive endoderm (hypoblast) marker, and the CDX2 trophectoderm marker. The image demonstrates a typical human embryo with aggregates of OCT4+ pluripotent cells surrounded by spheres of trophectoderm CDX2+ cells, with a SOX17+ primitive endoderm-hypoblast region located just below the OCT4+ cell mass.

[0130] FIG. 39A to FIG. 39G These results suggest that naive ESC-derived synthetic embryos complete gastrulation within the extraembryonic membranes and reach the stage of organogenesis. Fig.39ASchematic diagram of synthetic embryo generation and culture protocol is shown. Three naive ESC-derived populations were pre-induced with DOX (Gata4 induction period in 2iLIF was -1 day, Cdx2 induction period in TSC-LPA medium was -14 to -1 day) and aggregated, and then cultured in AM (containing DOX for the first 2 days), EUCM2 (20-30% FBS), EUCM2 (30% FBS), and EUCM for 8 days to generate self-organized synthetic embryos ["sEmbryo(iCdx2)], which grew to early organogenesis. Fig.39B Brightfield images of representative embryos from each day of the culture protocol are shown, compared with stage-matched natural embryos. Fig.39C Shown is the electronically controlled roller bottle ex vivo culture platform setup for sEmbryo proliferation. Fig.39D Images of sEmbryo at day 7 and day 8 of ex vivo culture in roller bottle culture are shown. Fig.39E Shown is a bright field image of a day 8 sEmbryo growing within the extraembryonic membranes of the uterus (yolk sac and amnion). Fig.39F Images of day 8 sEmbryo(iCdx2) and E8.5 natural embryos after dissection and removal of extraembryonic membranes are shown. Insets are magnified views of the dashed boxes. Figure 39G Representative images of empty yolk sacs obtained after continuous culture in IVC (static culture-based protocol). All images are representative of at least three biological replicates. Scale bar, FIG. 39B to FIG. 39C 100 μM, Figure 39G 500 μm in the middle. A-anterior; AC-amniotic cavity; Am-amnion; A-allantoic; AB-allantoic bud; BI-blood island; Epi-epidermal; EC-extraembryonic coelom; EPC-extraplacental cone; ExE-extraembryonic ectoderm; Fg-foregut pouch; H-heart; NF-neural fold; NT-neural tube; P-posterior; PAC-anterior part of the amniotic cavity; PS-primitive streak; S-somite; VE-visceral endoderm; YS-yolk sac.

[0131] FIG. 40A to FIG. 40G It was shown that the expression pattern of lineage markers in the egg-cylindrical sEmbryo (iCdx2) was similar to that in natural embryos. Fig.40A Shown are confocal images of mid-sections of day 4 egg-cylinder-shaped sEmbryo (iCdx2) and native E5.5 embryos immunostained for extraembryonic ectoderm, visceral endoderm, and epiblast markers. Fig.40B Shown is the migration of the anterior visceral endoderm (AVE) from distal to future anterior as shown by CER1 staining (magenta) in day 4 sEmbryo(iCdx2). Fig.40CShown are representative immunofluorescence images of visceral endoderm, trophoblast, epiblast, and gastrulation markers (Brachyury, yellow arrows) in day 5 sEmbryo (iCdx2) compared to matched E6.5 natural embryos (middle panel). FIG. 40D to FIG. 40E Demonstrated are the migration of the primitive streak and the establishment of definitive endoderm in day 6 sEmbryo(iCdx2) and control E7.5 natural embryos. Fig.40D Immunofluorescence images showing BRACHYURY + Cell migration and the presence of Brachyury / Foxa2 double-positive cells. Fig.40E SOX17 / FOXA2 immunostaining is shown, revealing invaginated definitive endoderm cells; FOXA2 along the epiblast + / SOX17 - Cells reveal nodal organizers in sEmbryo(iCdx2). Inset is a magnified view of the dashed box. Fig.40F A mid-section image of Blimp1-mVenus fluorescence of day 5 sEmbryo(iCdx2) detected by live imaging marker PGC specification is shown (top). Sox2+ PGCs show correct partitioning to the anteroventral side of sEmbryo(iCdx2) at day 8 (bottom). Figure 40G Flow cytometry images of Blimp1-Venus / Stella-CFP in day 4 and day 5 sEmbryo(iCdx2) are shown, indicating their expected appearance on day 5 (equivalent to E6.5). Scale bars are indicated for each graph.

[0132] FIG. 41A to FIG. 41E We show that at day 8 after gastrulation sEmbryo(iCdx2) correctly recapitulates the spatial expression pattern of tissues derived from all three germ layers. Fig.41A Representative whole mount immunofluorescence images of day 8 sEmbryo(iCdx2) are shown, showing the correct expression of neural (Sox2), cardiac (MHC-II), and notochordal (Brachyury) lineage markers. Scale bar, 200 μM. Fig.41B Shown are maximum intensity projection confocal images of Sox2 and Brachyury in day 8 sEmbryo(iCdx2) compared to native in utero E8.5 embryos. Scale bar, 200 μM. Fig.41C Shown are maximum intensity projection confocal images of OTX2 and FOXA2 in day 8 sEmbryo (iCdx2) compared to naturally grown in utero E8.5 embryos. Scale bar, 200 μM. Fig.41DSchematic representation of the cutting planes for neural tube sections is shown (top). Representative immunosection confocal images of closed neural tubes in day 8 sEmbryo (iCdx2) (middle, cross-section) compared to naturally grown intrauterine E8.5 embryos (bottom). Scale bar, 20 μM. Fig.41E Schematic diagram of the cutting plane of the heart section is shown (top). Representative immunohistochemistry images of the heart tube of sEmbryo (iCdx2) on day 8 (mid-section, cross-section) (bottom). Scale bar, 50 μM. Images are representative of at least 3 biological replicates. FB-forebrain; FP-floor plate; H-heart; LV-left ventricle; Nc-notochord; NF-neural fold; NT-neural tube; RV-right ventricle; TB-tail bud.

[0133] FIG. 42A to FIG. 42F It was shown that sEmbryo(iCdx2) grew within the extraembryonic membranes and developed into the allantois, blood islands, and ectoplacental cone. Fig.42A Representative images of day 7 and day 8 sEmbryo(iCdx2) are shown, demonstrating the presence of the amnion, yolk sac, allantoic sac, exoplacental cone, and blood islands. Scale bar, 200 μM. Fig.42B is a schematic diagram of the extraembryonic compartments present in day 8 sEmbryo(iCdx2). Fig.42C Representative whole mount immunofluorescence images of typical markers in yolk sacs isolated from day 8 sEmbryo (iCdx2) and E8.5 intrauterine natural embryos are shown. Scale bar, 500 μM. Fig.42D Representative images of RUNX1 immunostaining in yolk sac obtained from day 8 sEmbryo(iCdx2), equivalent to E8.5 natural embryos, are shown. Scale bar, 50 μM. Fig.42E Kit in the yolk sac (upper panel) and sEmbryo (iCdx2) (lower panel) is shown. + CD41 + Representative flow cytometry profiles of CD45 and CD34 expression in progenitor cells and Kit and CD41 expression in the E8.5 lineage-negative population. Gates were set based on the fluorescence minus 1 (FMO) of each cell surface marker antibody. Fig.42F The colony forming potential and morphology of erythroid progenitor cells derived from day 8 sEmbryo (iCDX2) and natural intrauterine control E8.5 derived erythroid progenitor cells based on methylcellulose in vitro culture are shown. Data represent at least 3 biological replicates. Scale bars are marked on each figure.

[0134] FIG. 43A to FIG. 43D scRNA-seq analysis of natural and synthetic embryos is shown. Fig.43Ais a UMAP plot showing individual cells (n=15,284 natural E8.5 embryos; n=31,151 synthetic day 8 embryos). Points are colored according to their assigned cell cluster. Clusters were annotated for cell lineage based on marker genes for the major cell types identified in E8.5 mouse embryos. EN=total embryo number; CN=total cell number. Fig.43B is a UMAP image showing individual cells from the different samples shown. The colors are as follows Fig.43A shown. Fig.43C Shown are natural embryonic cells (black) and synthetic embryonic cells (red) projected onto the same UMAP map. Fig.43D Pie charts depicting the proportional abundance of each cell cluster in natural and synthetic embryos are shown. Asterisks indicate clusters with statistically significant differences between the two groups. *T-test p<0.05.

[0135] FIG. 44A to FIG. 44M An optimized gas and pressure regulation controller for a drum incubator is presented. Fig.44A It is a schematic diagram of the fetal incubation system. Fig.44B is an image of an exemplary fetal incubation system. Fig.44C is a diagram depicting the configuration of the electronic module for gas and pressure regulation. 2 、N 2 and CO 2 It enters the system at a pressure of 0.1-0.5 psi and is mixed by a centrifugal blower. The gas is then injected into a water bottle inside the incubator by a pump that allows the gas pressure to be controlled (high pressure conditions). Lph = liters per hour. Fig.44D is a schematic diagram of an exemplary gas and pressure controller. Fig.44E A perspective view of an exemplary gas and pressure controller is shown, which is configured to monitor and provide CO 2 and / or N 2 To manipulate CO 2 and O 2 level. Fig.44F A top view of the gas and pressure controller is shown opened with the internal components visible. Figure 44G is a front view of the gas and pressure controller. Figure 44H is a schematic diagram of an exemplary gas mixing box. Fig.44I is an image of an exemplary gas mixing box. Fig.44J is a schematic diagram of an exemplary incubator. Figure 44K An image of the interior of a precision incubator system (BTCEngineering) showing the direction of gas flow (indicated by white arrows). Figure 44L is an image of an embryo cultured in a spinner bottle (yellow arrow). Figure 44M is a flow chart of an exemplary method associated with a fetal incubation system.

[0136] FIG. 45A to FIG. 45E It was shown that co-aggregation of human naive PSCs with DOX-pretreated iGata4 human naive PSCs and DOX-pretreated iCdx2 human naive PSCs followed by ex utero culture resulted in the generation of organized embryos. Fig.45A is a schematic diagram of the protocol. Figure 45-E shows phase contrast and immunostaining images of synthetic embryos acquired at the indicated time points after aggregation. Fig.45B Shown is the emergence of the bilaminar disc at day +4. Fig.45C Demonstrated is the formation of the primary yolk sac at day +5. Fig.45D Demonstrated is the formation of the secondary yolk sac at day +6 after coaggregation. Fig.45E Shown is the consolidation of the two-germ layer embryonic disc of a human synthetic embryo at day +7.

[0137] Fig.45F Schematic diagram of inducible plasmids for transient expression of human CDX2, GATA3, GATA4 or GATA6 is shown. Shown is a PiggyBac plasmid expressing the selected cDNA insert under the control of a doxycycline inducible promoter. The piggybac vector used (www(dot)addgene(dot)org / 104454 / ) carries M2Rtta and sites for cDNA inserts of transcription factors of interest. This vector was used to generate 4 different plasmids: human CDX2 or Gata3 (for promoting differentiation of human PSCs to trophectoderm) and human GATA4 or GATA6 (for promoting priming of human PSCs to human primitive endoderm).

[0138] FIG. 46A to FIG. 46C Shown are images of immunostaining of human PSC lines expressing the inducible plasmids presented in Figure 45. Fig.46AJH33 iPS (human iPSC lines without genetic modification made by healthy adult white males) and WIBR3 WT human female ESC are shown for the production of CDX2 inducible lines (iCDX2) using a piggybac plasmid with a CDX2 insert. Immunostaining analysis of CDX2 protein expression of human primordial PSC grown under mTESR conditions with and without the addition of DOX (2 μg / ml Dox) is shown. CDX2 expression is specifically detected only after the addition of DOX. Figure 46N shows WIBR3 WT human female ESC for the production of GATA4 or GATA6 DOX inducible lines (iGATA4 or iGATA6) using a piggybac plasmid with human GATA4 or GATA6 (as shown). Immunostaining analysis of GATA6 or GATA4 protein expression of human primordial PSC (respectively iGATA6 or iGATA4) grown under mTESR conditions with and without the addition of DOX (the final concentration of Dox is 2 μg / ml) is shown. As indicated, GATA4 or GATA6 expression was specifically detected only after addition of DOX in the corresponding lines. Fig.46C WIBR3 WT human female ESCs are shown, which were used to generate a GATA3 inducible line (iGATA3) using a piggybac plasmid with a GATA3 insert. Immunostaining analysis of GATA3 protein expression of human primed PSCs grown under mTESR conditions with and without the addition of DOX (the final concentration of Dox in the growth medium was 2 μg / ml) is shown. GATA3 expression was specifically detected only after the addition of DOX.

[0139] FIG. 47A to FIG. 47C The ability of alternative conditions to generate naive PSCs as a starting population for generating organized embryos is demonstrated. Fig.47A A schematic diagram of the scheme is shown. Fig.47B Shown are oval cylindrical shaped sEmbryos obtained from BVSC, KH2-iGata4, and Kh2-iCDX2 cells expanded in 2i / LIF and a2i / LIF (alternative to 2i / Lif) conditions on day 6 of the protocol (blue arrows highlight normal day 6 sEmbryo morphology). Fig.47C Shown are the efficiencies of oval sEmbryos obtained from BVSC, KH2-iGata4 and Kh2-iCDX2 cells expanded in 2i / LIF and a2i / LIF (alternative 2i / LIF) conditions, EPS (LCDM naive conditions) and serum-LIF conditions at protocol day 5. Error bars represent SEM from the mean.

[0140] Fig.48It is shown that the two-step aggregation protocol improves the efficiency of sEmbryo formation. The protocol and schematic diagrams of different protocols are shown, as well as a graph showing the efficiency of oval cylindrical sEmbryos obtained on day 5 of the protocol.

[0141] FIG. 49A to FIG. 49D The generation of human trophectoderm (TE)-primed cells by inducing endogenous expression of differentiation factors is demonstrated. Fig.49A is a schematic diagram of the culture conditions. Fig.49B Immunostaining characterization of human trophectoderm (TE) primed cells is shown. Staining was performed on day 3 of the trophectoderm induction protocol (TE). Fig.49C Shown are immunostaining characterizations of human trophectoderm-primed cells with or without transgenic iGATA3 expression. Staining was performed on day 3 of the trophectoderm induction protocol (TE). Fig.49D RT PCR expression of different trophectoderm markers in WT and iGATA3 WIBR3 cells is shown.

[0142] FIG. 50A to FIG. 50D It is demonstrated that extraembryonic primitive endoderm (PRE) cells are generated by inducing endogenous expression of differentiation factors. Fig.50A Shown are FACS analyses of PDGFRa expression after 6 days of induction in the indicated media. Fig.50B Shown are FACS analyses of PDGFRa expression in iGATA6 cells after 6 days of induction in the indicated media. Fig.50C RT PCR expression of PRE markers (PDGFRa, GATA4, GATA6, Nid2, SOX17) and definitive endoderm markers (Gsc and Foxa2) in WT and iGATA6 WIBR3 cells is shown. Fig.50D Immunostaining characterization of human PRE cells with or without transgenic iGATA3 expression is shown. Staining was performed on day 6 of the PRE induction protocol.

[0143] FIG. 51A to FIG. 51L It shows that human naive PSC cells and FIG. 49A to FIG. 49D Trophectoderm (TE)-derived cells and FIG. 50A to FIG. 50D The coaggregation of extraembryonic primitive endoderm initiating cells described in followed by ex utero culture resulted in the generation of organized embryos. Fig.51A A schematic diagram of the scheme is shown. Fig.51BThe progression of human sEmbryo from D4 to D8 of the protocol is shown (top panel) compared to 9-12 dpf of the human embryo (bottom schematic). The top panel shows images of human day 4-8 sEmbryo immunostained with OCT4 (cyan), SOX17 (yellow), and CK7 (magenta), which are markers of the epiblast, hypoblast, and trophoblast, respectively. Scale bar: 50 μm. Abbreviations: TB, trophoblast; EB, epiblast; HB, hypoblast; L, blastocoel; AC, amniotic cavity; PYS, primary yolk sac; ChC, chorionic cavity; ExEM, extraembryonic mesoderm; SK, stalk; dpf, days post fertilization. Fig.51C Characterization of epiblast pluripotency in human sEmbryo is shown. Shown are images of D4 sEmbryo immunostained for OCT4, SOX2, KLf17, and DNA (DAPI). Scale bar: 2 5 μm. Top panel - 2x magnification of the epiblast region. Figures 51D to 51E Apical cell polarity and lumen formation in human sEmbryo are shown. Fig.51D Images of D6 sEmbryo immunostained for OCT4 (cyan), F-actin (red), and DNA (DAPI, gray) are shown. Scale bar: 50 μm. Asterisks indicate the presumptive chorionic cavity. Top right, 2x magnification of the amniotic cavity. Bottom right, 2x magnification of the yolk sac cavity. Arrows mark the apical cell surface with aPKC (green). Scale bar: 12.5 μm. Fig.51E Images of D6 sEmbryo immunostained for SOX17 (yellow), F-actin (red), and DNA (DAPI, grey) are shown. Scale bar: 50 μm. Right, zoom-in of the yolk sac cavity showing the yolk sac layer with a cylindrical shape (top) and squamous cells (bottom). The cell perimeter is outlined with a dotted line. Scale bar: 5 μm. OCT4 and SOX17 mark the epiblast and hypoblast, respectively. Figures 51F to 51G A disruption of the anterior-posterior symmetry of human sEmbryo is shown. Fig.51F Shown are images of D6 sEmbryo immunostained for OCT4 (cyan), CER1 (red) and DNA (DAPI, grey). Scale bar: 50 μm. Bottom, 4X magnification of the hypoblast region with CER1-enriched apical vesicles (arrowheads) constituting the AVE (anterior visceral endoderm). Figure 51GImages of D6sEmbryo immunostained for OCT4 (cyan), Brachyury (BRA, red), and DNA (DAPI, gray) are shown. Scale bar: 50 μm. Right, 4x magnification of BRA-positive epiblast cells (arrowheads). OCT4 marks the pluripotent epiblast, while BRA and CER1 are early markers of epiblast and hypoblast differentiation, respectively, and are associated with disruption of anterior-posterior symmetry in early postimplantation human embryos. Figures 51H to 51J Trophoblast compartment features of sEmbryo are shown. Fig.51H Images of D6 sEmbryo immunostained for three different markers of epiblast (OCT4, cyan), hypoblast (SOX17, yellow), and trophoblast (CK7, SDC1, GATA3, magenta) are shown. All three trophoblasts are present in the structure and form a surrounding layer covering the structure. Fig.51I The top panel shows an image of a D6 sEmbryo immunostained for F-ACTIN (red) and HCGB (green), demonstrating the membrane and syncytiotrophoblast. Zoomed in shows multinucleated cells expressing HCGB, a characteristic of the syncytiotrophoblast. Fig.51I The lower panel shows an image of a D6sEmbryo immunostained for CK7 (magenta) and HCGB (green), demonstrating partial but not complete overlap of the two markers, indicating the presence of cyto- (CK7+ only) and syncytiotrophoblast (CK7+ and HCGB+). Fig.51J The upper panel shows an image of a D6sEmbryo immunostained for F-ACTIN and HCGB. The monolayer markers F-actin and HCGB show the blastocoel formed by the syncytiotrophoblast (dashed line). Fig.51J The lower panel shows a maximum projection, demonstrating that the syncytiotrophoblast surrounds the entire structure. Scale bar: 50 μm. Figure 51K to Figure 51L The presence and organization of the extraembryonic mesoderm (ExEm) of sEmbryo are shown. Figure 51K Images of D6 sEmbryo immunostained for epiblast (OCT4, cyan), PYS (SOX17, yellow), and ExEm markers (BST2, GATA6, red) are shown. The top panel shows that BST2+ cells invade the space between the yolk sac (SOX17+) and the outer trophoblast (DAPI, SOX17-, OCT4-, BST2-), indicating the presence of ExEM cells. The middle panel shows that ExEM also expresses GATA6, a common marker for HB / PYS, but at lower levels than PYS. The bottom panel shows that ExEM cells organize and form a cavity between PYS and trophoblast cells, indicating the formation of the chorionic cavity (asterisk). Figure 51LA magnification of the middle portion of an immunofluorescence image stained for OCT4 (cyan), SOX17 (green), and BST2 (red) is shown. BST2 is expressed between the yolk sac (SOX17+) and the outer trophoblast cells (DAPI, SOX17-, OCT4-, BST2-) and in the epiblast (OCT4+). Cells are characterized in this ExEM by expressing BST2 and lacking expression of SOX17 and OCT4. Scale bar: 50 μm. Abbreviations: Max.Proj., maximum intensity projection of the z-stack.

[0144] FIG. 52A to FIG. 52B Demonstrated is the generation of naive rhesus monkey (RM) PSCs. Fig.52A Phase images are shown, demonstrating the typical dome-shaped morphology of RM-1 naive hESCs expanded in the indicated passages under NENSM conditions. Fig.52B Shown are images of monkey naive RM1-ESCs immunostained for various naive pluripotency markers: DPPA3, TFCP2L1, KLF17, and NANOG. DAPI was used for counterstaining.

[0145] Fig.53 is a schematic diagram of the protocol for generating RM synthetic embryos.

[0146] Fig.54 It shows that the RM primitive PSC cells described in Example 12 are co-aggregated with human trophectoderm (TE) primary cells and human extraembryonic primitive endoderm primary cells, followed by extrauterine culture to produce organized embryos. The figure shows the progress of human sEmbryo from D6 of the scheme (left figure) compared with RM embryos of 9-12dpf (schematically shown in the right figure). sEmbryo was immunostained for OCT4 (green), SOX17 (red) and Gata3 (magenta), which are markers of epiblast, hypoblast and trophoblast, respectively. Scale bar: 50 μm.

[0147] Fig.55 Demonstrated the formation of a stable human TSC line. Shown are images of cells immunostained for CDX2, cytokeratin 7 (CK7), GATA3, and TFAP2C. DAPI was used for counterstaining.

[0148] Fig.56It shows that the human stable derived TSC line cannot form normal sEmbryo. The three starting cell types were coagulated, and the original WT hESC was cultured in HENSM medium; for the primitive endoderm compartment, the original WT cells were seeded under the conditions of mouse embryonic fibroblasts on HENSM with the addition of ROCKi 10 μM (Axon Medchem 1683), and the culture medium was replaced with RCL culture medium the next day, RCL was maintained for 72 hours, and the culture medium was replaced every 24 hours; and for the trophoblast compartment, the human TSC line (generation 5) derived from WIBR3 primitive ESC was used. The latter was produced by transferring the human primitive WIBR3 amplified under HENSM conditions to TSC culture medium on a MEF-coated plate and continuously passaged in TSC culture medium and verified as a TSC system. The TSC system was constitutively labeled with RFP encoding lentivirus (marked in red). Human TSC was introduced on days 0, 1, and 2 of the sEmbryo protocol. In all cases, it is understandable that at day 5 cells co-localize to one side of the aggregate (as indicated by their red labeling) rather than surround the entire sEmbryo, which is inconsistent with the expected morphology and would not result in a normally developing embryo surrounded only by the trophoblast lineage at the periphery.

[0149] FIG. 57A to FIG. 57C We demonstrate the derivation of new stable mouse extraembryonic primitive endoderm (mouse PRE)-initiation cells from WT mouse naive ESCs / iPSCs or after transient overexpression of Gata4 in mouse ESCs. Fig.57A Three strategies for deriving mouse PRE cells that can be permanently expanded in mouse PRE indicator medium are shown. Images were taken at time 0 (naive ESCs at the 2i / LIF stage) and after the start of differentiation. As indicated, continuous DOX was used for 72 hours in the first protocol. Fig.57B FACS analysis of cells using anti-PDGFRa antibody is shown. The parental ESC line is shown as a control. Unstained samples are shown as negative controls. It is worth noting that MEFs are also known to express PDGFRA, but at lower levels than mouse PRE cells. Fig.57C Representative images of cells immunostained for the indicated markers are shown. Immunostaining of genetically unmodified CD1 iPSC-derived mouse PRE cells expanded in PRE medium. DAPI was used as a counterstain.

[0150] Fig.58 It shows that the original mouse PSC and Fig.57A Co-aggregation of mouse PRE cells and mouse iCDX2 trophectoderm-primed cells followed by ex utero culture was able to generate organized embryos as described in panel C. The figure shows an image of day 8 mouse sEmbryo generated according to the protocol shown in the figure.

[0151] FIG. 59A to FIG. 59B It was shown that, as described in Example 15 below, co-aggregation of human naive PSC cells with trophectoderm (TE) initiated cells and extraembryonic primitive endoderm initiated cells followed by ex utero culture resulted in the generation of organized embryos. Fig.59A A schematic diagram of the scheme is shown. Fig.59B is a representative phase image showing the bilayer disc formation, the amniotic cavity, and the yolk sac cavity, all surrounded by the trophoblast compartment.

[0152] FIG. 60A to FIG. 60B It was shown that co-aggregation of human naive PSC cells with trophectoderm (TE)-initiated cells followed by ex utero culture resulted in the generation of organized embryos, as described in Example 16 below. Fig.60A A schematic diagram of the scheme is shown. Fig.60B is a representative phase image showing the bilayer disc formation, the amniotic cavity, and the yolk sac cavity, all surrounded by the trophoblast compartment. DETAILED DESCRIPTION

[0153] The present invention, in some embodiments thereof, relates to methods of producing synthetic embryos.

[0154] Before explaining at least one embodiment of the invention in detail, it should be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

[0155] Advanced artificial embryogenesis using embryonic stem cell lines (ESC) and induced pluripotent stem cell lines (iPSC) established in vitro while avoiding the use of oocytes and fertilized eggs or blastocysts has always been a desired goal in the field of developmental biology and reproductive medicine. Although stem cells in different pluripotent states can be expanded in vitro and can promote embryonic and / or extraembryonic tissues when injected into host embryos, it has not been successful to date to obtain advanced gastrula-like structures with embryonic and extraembryonic compartments in the absence of microinjected host embryos (see, for example, Zhang et al. (2020) Front. Bioeng. Biotechnol. 8: 781; Harrison et al. Science (2017) DOI: 10.1126 / science.aa1810; Amadei et al. Developmental Cell (2021) 56, 366–382; as shown in Example 1 of the Examples section below).

[0156] While reducing specific embodiments of the present invention to practice, the inventors have now developed a method for generating synthetic embryos having both embryonic and extra-embryonic compartments by starting with only naive ESCs and then culturing them under a controlled ex utero embryo culture platform.

[0157] As shown below and in the Examples section that follows, the inventors show that three mouse stem cell populations, namely, untransduced naive PSCs, naive PSCs transiently overexpressing the master regulatory transcription factor (Cdx2) of trophectoderm cells, and naive ESCs transiently overexpressing the master regulatory transcription factor (Gata4) of extraembryonic primitive endoderm cells, are coagulated, and then the aggregates are cultured ex utero under the recently described controlled platform and growth conditions (Aguilera-Castrejon et al., 2021a), resulting in the assembly of complete synthetic mouse embryos, which complete gastrulation and develop progenitor cells of the brain, neural folds, neural tubes, beating hearts, somites, and other organs (Examples 2-3 and 7-8 of the Examples section that follow). Synthetic embryos develop in extraembryonic membranes like natural embryos. In addition, a thorough analysis of both embryonic and extraembryonic compartments shows that these synthetic embryos have reached the same level of lineage complexity as natural intrauterine embryos, with all annotated cell types being embodied in synthetic embryos at the equivalent developmental stage of E8.5. In addition, for each tissue, it is observed that there is a very high gene expression correlation between natural intrauterine embryos and synthetic mouse embryos. Similarly, the inventor shows that the same three kinds of stem cell colonies from human sources are co-aggregated, and then the aggregate is cultivated outside the uterus, resulting in the assembly into a complete synthetic human embryo with both embryonic compartments and extraembryonic compartments (embodiment 4-6 of the following examples). Next, the inventor shows that a variety of culture conditions can also support the original state PSC (mouse, people or rhesus monkey source) to be differentiated into trophectoderm (TE) initial state cells or extraembryonic primitive endoderm (PRE) initial state cells; These stem cell groups are co-aggregated, and aggregates are subsequently cultivated outside the uterus, resulting in the assembly into complete synthetic embryos (embodiment 9-12 and 14-16 of the following examples).

[0158] Establishing methods and systems for producing such synthetic embryos ex utero could become a powerful tool for basic research, for example as a framework for studying the emergence of cellular diversity, cell fate determination, and how tissues and organs emerge from single pluripotent cells; and as a source of cells, tissues, embryos, and organs for transplantation, testing the effects of drugs on embryonic development, and possible embryonic bioengineering.

[0159] Therefore, according to one aspect of the present invention, there is provided a method for producing a synthetic embryo, the method comprising: (a) inducing the expression of factors that induce differentiation into trophectoderm cells in a primitive pluripotent stem cell (PSC) subpopulation to obtain trophectoderm-initiated cells; and (b) mixing the trophectoderm-initiated cells with naive PSCs under conditions that allow the formation of aggregated cells, Wherein, when the factor inducing differentiation into trophectoderm cells is an exogenous factor, the inducing the expression includes inducing transient expression starting from 14 days to 0 hours before the mixing and ending no later than 120 hours after the mixing; and Wherein, when the factor inducing differentiation into trophectoderm cells is an endogenous factor, the inducing the expression comprises culturing the primitive PSC subpopulation under conditions capable of achieving the expression of the factor starting 14 days to 6 hours before the mixing, Thus creating a synthetic embryo.

[0160] According to a further or alternative aspect of the present invention, there is provided a method of producing a synthetic embryo, the method comprising: (a) inducing transient expression of exogenous factors that induce differentiation into trophectoderm cells in a primitive pluripotent stem cell (PSC) subpopulation to obtain trophectoderm-initiated cells; and (b) mixing the trophectoderm-derived cells with the naive PSCs under conditions that allow the formation of aggregated cells, wherein said inducing said transient expression starts within 14 days to 0 hours before said mixing and ends no later than 120 hours after said mixing, Thus creating a synthetic embryo.

[0161] According to a specific embodiment, the method also includes inducing the expression of factors that induce differentiation into extraembryonic primitive endoderm cells in the second subpopulation of primitive PSCs in (a) to obtain extraembryonic primitive endoderm initial state cells; and mixing the extraembryonic primitive endoderm initial state cells with the cells in (b).

[0162] According to a specific embodiment, the method also includes transient expression of exogenous factors that induce differentiation into extraembryonic primitive endoderm cells in the second subpopulation of primitive PSCs in (a) to obtain extraembryonic primitive endoderm initial state cells; and mixing the extraembryonic primitive endoderm initial state cells with the cells in (b).

[0163] According to a further or alternative aspect of the present invention, there is provided a cell mixture or aggregate obtainable by the method disclosed herein, as further described below.

[0164] According to a further or alternative aspect of the present invention, there is provided a synthetic embryo obtainable by the method disclosed herein.

[0165] As used herein, the term "synthetic embryo" refers to a collection of at least one distinct group of cells produced in vitro using pluripotent stem cells without any donated germ cells, fertilized eggs or blastocysts. When cultured, the synthetic embryo undergoes self-organization and differentiation to produce a variety of tissue types that organize like or exhibit embryo-like properties like natural embryos.

[0166] According to specific embodiments, the synthetic embryonic structure simulates the developmental stages of a natural or naturally occurring embryo, at least the early stages of embryonic development after the blastocyst stage of development.

[0167] According to specific embodiments, the synthetic embryo is not a blastocyst (eg, a structure having the characteristics of E3.5 / 4-5 of an intrauterine natural mouse embryo or the characteristics of PFD6 / PFD7 of an intrauterine natural human embryo).

[0168] According to a specific embodiment, the synthetic embryo simulates at least Carnegie 5, Carnegie 6, Carnegie 8 or higher developmental stages (relevant to humans), an embryo with primary and secondary yolk sacs, a two-layer disc stage surrounded by trophoblast cells, and the formation of the amnion, yolk and chorionic cavities, including the formation of extraembryonic mesoderm cells.

[0169] According to specific embodiments, the mouse synthetic embryo simulates at least the formation of the egg cylinder stage, the completion of gastrulation (E7.5), and the onset of organogenesis (E8.0 or higher in mouse embryos).

[0170] According to a specific embodiment, the synthetic embryos are produced exclusively ex utero.

[0171] As used herein, the phrase "pluripotent stem cell (PSC)" refers to an undifferentiated cell (eg, mammalian cell, primate cell) that is capable of differentiating into all three embryonic germ cell layers (ie, mesoderm, ectoderm, and endoderm embryonic germ layers) or remaining in an undifferentiated state.

[0172] Methods for determining the ability of stem cells to differentiate into endoderm, mesoderm, and ectodermal embryonic germ layers are known in the art and are disclosed, for example, in International Patent Application Publication No. WO2014 / 174470, the contents of which are incorporated herein by reference in their entirety, and include, for example, the generation of embryoid bodies (in vitro) or teratomas (in vivo).

[0173] According to some embodiments of the invention, the pluripotent stem cells are selected from the group consisting of embryonic stem cells (ESC), induced pluripotent stem cells (iPSC) and embryonic germ cells (EGC).

[0174] According to a specific embodiment, the cell is a mammalian cell, such as a rodent (e.g., mouse, rat), human (Homo sapiens), monkey (e.g., chimpanzee, gorilla, rhesus monkey and / or baboon), livestock (e.g., cow, sheep, pig, goat, horse, donkey, mule).

[0175] According to a specific embodiment, the cell is a mouse cell.

[0176] According to a specific embodiment, the cell is a human cell.

[0177] According to other specific embodiments, the cell is of a non-human primate (eg, a macaque).

[0178] The phrase "embryonic stem cell" refers to an embryonic cell that can be differentiated into all three embryonic germ layers (i.e., endoderm, ectoderm, and mesoderm) cells or maintain an undifferentiated state. The phrase "embryonic stem cell" may include cells obtained from embryonic tissue (e.g., blastocyst) formed after pregnancy (before embryo implantation (i.e., preimplantation blastocyst)), expanded blastocyst cells (EBC) (see WO2006 / 040763) obtained from postimplantation / pre-gastrulation stage blastocysts, and embryonic germ (EG) cells obtained from fetal reproductive tissues at any time during pregnancy (preferably before 10 weeks of pregnancy).

[0179] Embryonic stem cells of some embodiments of the present invention can be obtained using well-known cell culture methods. For example, human embryonic stem cells can be isolated from human blastocysts. Human blastocysts are usually obtained from preimplantation embryos in the human body or from in vitro fertilization (IVF) embryos. Alternatively, single-cell human embryos can be expanded to the blastocyst stage. In order to separate human ES cells, it is necessary to remove the zona pellucida from the blastocyst and separate the inner cell mass (ICM) by immunosurgery, wherein the trophectoderm cells are lysed and removed from the complete ICM by gentle pipetting.

[0180] The ICM is then placed in a tissue culture flask containing an appropriate medium to enable its growth. After 9 to 15 days, the ICM-derived outgrowth is separated into clumps by mechanical dissociation or enzymatic degradation, and the cells are then re-seeded into fresh tissue culture medium. Colonies that exhibit an undifferentiated morphology are individually selected with a micropipette, mechanically separated into clumps, and re-seeded. The resulting ES cells are then routinely isolated every 4-7 days. For more details on methods for preparing human ES cells, please refer to Thomson et al., [U.S. Patent No. 5,843,780; Science 282:1145, 1998; Curr. Top. Dev. Biol. 38:133, 1998; Proc. Natl. Acad. Sci. USA 92:7844, 1995]; Bongso et al., [Hum Reprod 4:706, 1989]; and Gardner et al., [Fertil. Steril. 69:84, 1998].

[0181] Another method for preparing ES cells is described in Chung et al. Cell Stem Cell, Volume 2, Issue 2, 113-117, 7 February 2008. This method involves removing a single cell from an embryo during in vitro fertilization. The embryo is not destroyed during this process.

[0182] It will be appreciated that, according to some embodiments of the present invention, commercially available stem cells may also be used. Human ES cells may be purchased from the NIH Human Embryonic Stem Cell Registry [Hypertext Transfer Protocol: / / grants(dot)nih(dot)gov / stem_cells / registry / current(dot)htm]. Non-limiting examples of commercially available embryonic stem cell lines are BG01, BG02, BG03, BG04, CY12, CY30, CY92, CY10, TE03, TE32, CHB-4, CHB-5, CHB-6, CHB-8, CHB-9, CHB-10, CHB-11, CHB-12, HUES1, HUES 2, HUES 3, HUES 4, HUES 5, HUES 6, HUES 7, HUES 8, HUES 9. HUES10, HUES11, HUES12, HUES13, HUES14, HUES15, HUES16, HUES17, HUES18, HUES19, HUES20, HUES21, HUES22, HUES23, HUES2 4. HUES25, HUES26, HUES27, HUES28, CyT49, RUES3, WA01, UCSF4, NYUES1, NYUES2, NYUES3, NYUES4, NYUES5, NYUES6, NYUES7, UCLA 1. UCLA2, UCLA3, WA077(H7), WA09(H9), WA13(H13), WA14(H14), HUES 62, HUES 63, HUES 64. CT1, CT2, CT3, CT4, MA135, Eneavour-2, WIBR1, WIBR2, WIBR3, WIBR4, WIBR5, WIBR6, HUES 45, Shef 3, Shef 6, BJNhem19, BJNhem20, SA001, SA001.

[0183] In addition, ES cells can also be obtained from other species, including mice (Mills and Bradley, 2001), golden hamsters [Doetschman et al., 1988, Dev Biol. 127:224-7], rats [Iannaccone et al., 1994, Dev Biol. 163:288-92], rabbits [Giles et al. 1993, Mol Reprod Dev. 36:130-8; Graves & Moreadith, 1993, Mol Reprod Dev. 1993, 36:424-33], and various livestock species [Notarianni et al., 1991, J Reprod Fertil Suppl. 43:255-60; Wheeler 1994, Reprod Fertil Dev. 6:563-8; Mitalipova et al., ... et al., 2001, Cloning. 3:59-67] and non-human primate species (rhesus monkeys and marmosets) [Thomson et al., 1995, Proc Natl Acad Sci US A. 92:7844-8; Thomson et al., 1996, Biol Reprod. 55:254-9].

[0184] Non-limiting examples of commercially available mouse embryonic stem cell lines are v6.5, KH2, BVSC ES line, NGFP1 iPSC line, NGFP2 iPSC line.

[0185] Extended blastocyst cells (EBCs) can be obtained from blastocysts at least nine days after fertilization at the stage before gastrulation. Prior to culturing the blastocysts, the zona pellucida is digested [e.g., using Tyrode's acid solution (Sigma Aldrich, StLouis, MO, USA)] to expose the inner cell mass. The blastocysts are then cultured in vitro as complete embryos for at least 9 days but no more than 14 days after fertilization (i.e., before the gastrulation event) using standard embryonic stem cell culture methods.

[0186] EG cells are prepared from primordial germ cells obtained from a fetus of about 8-11 weeks of gestation (in the case of a human fetus) using laboratory techniques known to those skilled in the art. The genital ridges are isolated and cut into small pieces, which are then broken down into cells by mechanical separation. The EG cells are then grown in a tissue culture flask with an appropriate culture medium. The cells are cultured with a daily culture medium change until a cell morphology consistent with that of EG cells is observed, usually after 7-30 days or 1-4 passages. For more detailed information on methods for preparing human EG cells, see Shamblott et al., [Proc. Natl. Acad. Sci. USA 95: 13726, 1998] and U.S. Pat. No. 6,090,622.

[0187] Induced pluripotent stem cells (iPS; embryonic-like stem cells) are cells with pluripotency (i.e., capable of differentiating into three embryonic germ cell layers, i.e., endoderm, ectoderm, and mesoderm) obtained by dedifferentiating adult cells. According to some embodiments of the present invention, such cells are obtained from differentiated tissues (e.g., somatic tissues, such as skin) and dedifferentiated by genetic manipulation, which reprograms the cells to obtain the characteristics of embryonic stem cells. According to some embodiments of the present invention, induced pluripotent stem cells are formed by inducing the expression of Oct-4, Sox2, Kfl4, and c-Myc in somatic stem cells.

[0188] Induced pluripotent stem cells (iPS) (embryonic stem cells) can be generated from somatic cells by genetic manipulation of somatic cells, for example, by retroviral transduction of somatic cells such as fibroblasts, hepatocytes, gastric epithelial cells with transcription factors such as Oct-3 / 4, Sox2, c-Myc and KLF4 [Yamanaka S, Cell Stem Cell. 2007, 1(1): 39-49; Aoi T, et al., Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells. Science. 2008 Feb 14. (Epub ahead of print); IH Park, Zhao R, West JA, et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008; 451: 141-146; K Takahashi, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007; 131: 861-872]. Other combinations of iPSCs produced by overexpression of pluripotency factors are also included (Buganim et al. Cell (2012) 150 (6): 1209-1222 www (dot) doi (dot) org / 10.1016 / j.cell.2012.08.023). Other embryonic stem cells can be generated by nuclear transfer to oocytes, fusion with embryonic stem cells, or nuclear transfer to fertilized eggs (if the recipient cell is arrested in mitosis).

[0189] The methods of some embodiments of the present invention utilize the PSC in a pristine state.

[0190] The phrase "naive pluripotent stem cells (PSCs)" refers to PSCs that express pluripotent markers (e.g., Oct4, Nanog, and Klf4) and lack extraembryonic endoderm, trophectoderm, and early somatic lineage-specific markers. These cells retain unrestricted developmental potential, as they can robustly differentiate into all cell types in vitro, and after injection into blastocysts, they efficiently contribute to the three germ layers and the germline of chimeric animals.

[0191] The naive PSCs of humans and non-human primates are also in a pre-X inactivation state.

[0192] X chromosome inactivation is an early developmental process in mammalian females that transcriptionally silences one of a pair of X chromosomes, thereby providing dosage equivalence between males and females. This process is regulated by multiple factors, including a region of the X chromosome called the X inactivation center (XIC). The XIC contains multiple non-coding and protein-coding genes, and the XIST gene is the first non-coding gene identified in the XIC.

[0193] When XIST bodies are present, XIST is expressed exclusively from the XIC of the inactivated X chromosome and is essential for the spread of X inactivation.

[0194] According to some embodiments of the invention, the pre-X inactivation state is characterized by the presence of two unmethylated alleles of the X-inactivation specific transcript (XIST) gene promoter in female cells and one unmethylated allele of the XIST gene promoter in male cells.

[0195] This is in contrast to human and nonhuman primate “primed PSCs” or “conventional PSCs,” which are characterized by the presence of one XIST methylated allele and one XIST unmethylated allele in female cells and one methylated allele in male cells.

[0196] The XIST gene is located on human chromosome Xq13.2 and has a sequence described in clone NC_000023.10 (73040486.73072588, based on GenBank version GRCh37.p10 supplement). The XIST gene has a non-coding RNA, which is provided in GenBank accession number NR_001564.2.

[0197] Methods for determining the methylation status of the XIST gene are known in the art and disclosed in, for example, Lengner Cell 141, 872–883 (2010); Hanna et al., Cell 143, 508–525; (2010); TAKASHI SADO et al., DEVELOPMENTAL DYNAMICS 205: 421-434 (1996); and International Patent Application Publication Nos. WO2016 / 016894 and WO2014 / 174470, each of which is incorporated herein by reference in its entirety, and includes, for example, bisulfite sequencing and Southern blot analysis.

[0198] According to some embodiments of the invention, the presence of two unmethylated alleles of the XIST gene in female cells refers to less than about 20% of the CpG methylation reads sequenced in the XIST promoter, such as less than about 19%, less than about 18%, less than about 17%, less than about 16%, less than about 15%, less than about 14%, less than about 13%, less than about 12%, less than about 11%, less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, less than about 1%, such as 0% (e.g., completely absent) of the CpG methylation reads sequenced in the XIST promoter.

[0199] According to some embodiments of the invention, the presence of an unmethylated allele of the XIST gene in male cells refers to less than about 20% of the CpG methylated reads sequenced in the XIST promoter, for example, less than about 19%, less than about 18%, less than about 17%, less than about 16%, less than about 15%, less than about 14%, less than about 13%, less than about 12%, less than about 11%, less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, less than about 1%, for example, 0%

[0200] A non-limiting example of a XIST promoter includes a CpG island, which can be provided in the XIST promoter amplicon set forth in SEQ ID NO:65 in either methylated or unmethylated form.

[0201] According to some embodiments of the invention, naive PSCs exhibit a pre-X inactivation state similar to that of the human inner cell mass (ICM).

[0202] According to some embodiments of the invention, the naive PSC is characterized by reduced CpG island methylation compared to the level of CpG island methylation in the naive PSC.

[0203] According to some embodiments of the invention, naive PSCs are characterized by significantly low levels of total methylated cytosines (eg, 1-2%) per total guanine nucleotides per cell as determined by quantitative analysis by liquid chromatography-mass spectrometry (LC-MS).

[0204] According to some embodiments of the invention, the naive PSC is characterized in that the total methylated cytosine accounts for 0-3% of the total guanine nucleotides in the naive PSC cell. For comparison, the total methylated cytosine accounts for 3.5%-5% of the total guanine nucleotides in the naive PSC cell or somatic cells.

[0205] According to some embodiments of the invention, the human naive PSC expresses XIST.

[0206] Methods for detecting XIST expression are known in the art and include, for example, reverse transcriptase-polymerase chain reaction (RT-PCR) analysis using XIST-specific PCR primers, e.g., forward primer: 5'-AGGGAGCAGTTTGCCCTACT (SEQ ID NO:66), and reverse primer: 5'-CACATGCAGCGTGGTATCTT (SEQ ID NO:67).

[0207] According to some embodiments of the invention, the naive PSC lacks XIST bodies.

[0208] As used herein, the phrase "XIST body" refers to an inactive X chromosome coated with XIST.

[0209] Methods for detecting XIST bodies are known in the art and include, for example, RNA fluorescence in situ hybridization. RNA fluorescence in situ hybridization (FISH) was performed as previously described [Hanna J., et al., Cell 143, 508–525]. Briefly, human pluripotent stem cells were harvested, MEFs were removed, and the cells were cytospun onto slides before fixation. cDNA probes were generated for XIST exon 1 (GenBank Accession No. U80460: 61251–69449, SEQ ID NO: 26) and exon 6 (GenBank Accession No. U80460: 75081–78658, SEQ ID NO: 27) and labeled with Cy3-dUTP (Amersham) by nick translation (Roche), and Cot-1 DNA was labeled with fluorescein-12-dUTP using the Prime-It Fluor labeling kit (Stratagene).

[0210] According to some embodiments of the invention, the naive PSC lacks H3K27me3 / polycomb foci.

[0211] As used herein, the phrase "H3K27me3 / polycomb focus" refers to a nuclear focus obtained after immunostaining that corresponds to a condensed inactive X chromosome.

[0212] Methods for detecting H3K27me3 / polycomb foci are known in the art and include, for example, immunofluorescence analysis using anti-H3K27me3 antibodies (e.g., rabbit anti-H3K27me3, Millipore, CA, USA catalog number 07-449), such as Fig.23C -D as shown.

[0213] According to some embodiments of the invention, the naive PSCs have low XIST expression levels in the naive state, without any inactivation of the X chromosome, and without the presence of XIST bodies.

[0214] It should be noted that the naive PSCs of some embodiments of the present invention (in the pre-X inactivated and naive states) may inactivate one of the X chromosome alleles and methylate one of the XIST genes upon differentiation.

[0215] According to specific embodiments, the expression level of transcription factor E3 (TFE3) in naive PSCs is characterized by a nuclear to cytoplasmic expression ratio equal to or greater than 1, as determined by, for example, an immunostaining assay.

[0216] According to specific embodiments, the naive cells express c-Kit on their cell surface as determined by, for example, flow cytometry or immunostaining assays.

[0217] In contrast to known primed PSCs, the naive PSCs of some embodiments of the present invention are "resistant" to differentiation induced by FGFR / MEK / ERK inhibitors, JNK inhibitors and / or P38 inhibitors. Therefore, according to some embodiments of the present invention, when the isolated naive PSCs are incubated in the presence of an agent selected from the group consisting of FGFR / MEK / ERK inhibitors, JNK inhibitors and P38 inhibitors, the naive PSCs maintain a pluripotent state.

[0218] According to some embodiments of the invention, the naive PSC has an inhibited p38 pathway compared to the naive PSC. For example, p38 activity is inhibited in the naive PSC.

[0219] According to some embodiments of the invention, the p38 RNA and / or phosphorylated p38 protein levels in naive PSCs are less than about 30%, e.g., less than about 20%, e.g., less than about 5%, e.g., less than about 0.5%, e.g., less than about 0.1%, respectively, compared to the p38 RNA and / or phosphorylated p38 protein levels in non-naive PSCs incubated and / or cultured under the same conditions but not subjected to p38 inhibition.

[0220] According to some embodiments of the invention, the naive PSC has an inhibited JNK pathway compared to the naive PSC. For example, the JNK activity in the naive PSC is inhibited.

[0221] According to some embodiments of the invention, the levels of JNK RNA and / or phosphorylated JNK protein in naive PSCs are less than about 30%, e.g., less than about 20%, e.g., less than about 5%, e.g., less than about 0.5%, e.g., less than about 0.1%, respectively, compared to the levels of JNK RNA and / or phosphorylated JNK protein in non-naive PSCs incubated and / or cultured under the same conditions but not subjected to JNK inhibition.

[0222] According to some embodiments of the invention, the naive PSC has an inhibited ROCK pathway compared to the naive PSC. For example, the ROCK activity in the naive PSC is inhibited.

[0223] According to some embodiments of the invention, the levels of ROCK RNA and / or phosphorylated ROCK protein in naive PSCs are less than about 30%, e.g., less than about 20%, e.g., less than about 5%, e.g., less than about 0.5%, e.g., less than about 0.1%, respectively, compared to the levels of ROCK RNA and / or phosphorylated ROCK protein in non-naive PSCs incubated and / or cultured under the same conditions but not subjected to ROCK inhibition.

[0224] According to some embodiments of the invention, a naive PSC maintained in an undifferentiated, pluripotent, and naive state (as defined above) expresses significantly lower levels of SOX1 compared to the expression level in a naive PSC (e.g., a naive ESC) under the same SOX1 assay conditions, and wherein the naive PSC exhibits one methylated and one unmethylated allele of XIST (in female cells) or one methylated allele of XIST (in male cells); expresses XIST; exhibits XIST bodies; and exhibits H3K27me3 / polycomb foci.

[0225] According to some embodiments of the invention, the naive PSC expresses lower levels of MHC class I compared to the naive PSC under the same detection assay conditions, and wherein the naive PSC exhibits one methylated and one unmethylated allele of XIST (in female cells) or one methylated allele of XIST (in male cells); expresses XIST; exhibits XIST bodies; and exhibits H3K27me3 / polycomb foci.

[0226] The level of MHC class I can be determined by various methods known in the art, such as FACS analysis using specific antibodies to detect surface expression of MHC class I molecules, and the use of fluorescently labeled anti-HLA-A, B, C antibodies (BD Biosciences).

[0227] According to some embodiments of the invention, the naive PSC is characterized by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% more RNA polymerase II paused on the chromosome compared to the naive PSC under the same assay conditions, and wherein the naive PSC exhibits one methylated and one unmethylated allele of XIST (in female cells) or one methylated allele of XIST (in male cells); expresses XIST; exhibits XIST bodies; and exhibits H3K27me3 / polycomb foci.

[0228] According to specific embodiments, the naive PSC expresses pluripotency markers, ie, is positive for one or more pluripotency markers.

[0229] According to a specific embodiment, an endogenous protein is expressed.

[0230] Positive is also abbreviated as (+). Being positive for a marker means that at least about 70%, 80%, 85%, 90%, 95% or 100% of the cells in the population present a detectable level of the marker as determined by methods known to those skilled in the art. Developmental markers can be detected using immunological techniques well known in the art [e.g., described in Thomson JA et al., (1998). Science 282: 1145-7]. Examples include, but are not limited to, immunostaining, microscopy, flow cytometry, western blotting and enzyme immunoassay. Other non-limiting methods include PCR analysis, RNA fluorescence in situ hybridization (FISH), northern blotting, single cell RNA sequencing.

[0231] Pluripotency markers are well known in the art and include, but are not limited to, Oct4, NANOG, KLF4, KLF17, SUSD2, TFCP2L1.

[0232] Naive PSCs according to some embodiments of the invention are characterized by positive expression of C-KIT protein (also known as CD117) on the cell surface.

[0233] According to a specific embodiment, naive PSCs can be obtained by culturing in a naive state without exogenous expression of Oct4, Sox2, Klf4 and / or c-Myc factors.

[0234] According to specific embodiments, the naive PSCs are negative for differentiation markers.

[0235] Negative is also abbreviated as (-). Negative for a marker means that no more than about 30%, no more than about 25%, no more than about 20%, no more than about 15%, no more than about 10%, no more than about 5%, no more than about 4%, no more than about 3%, no more than about 2%, no more than about 1% of cells in a population present a detectable level of marker by methods known to those skilled in the art (e.g., FACS, immunofluorescence, immunohistochemistry, Western blot analysis, RT-PCR). Non-limiting examples of differentiation markers include Gata3, Gata2, tbr2, tfap2c, Cdx2, Elf5, Hand1, EOMES, ETS2, Foxa2, Gata4, Gata6, PDGFRA, Sox17.

[0236] Determination of PSC differentiation can also be achieved by measuring alkaline phosphatase activity. Undifferentiated human ES cells have alkaline phosphatase activity, which can be detected by fixing the cells with 4% paraformaldehyde and developing with the Vector Red substrate kit according to the manufacturer's instructions (Vector Laboratories, Burlingame, California, USA).

[0237] According to a specific embodiment, naive PSCs can be obtained by culturing in a naive state under feeder-free conditions [e.g., on a surface coated with Matrigel, laminin and / or fibronectin, rather than on feeder cells such as fibroblast feeder cells, e.g., mouse embryonic fibroblasts (MEFs)].

[0238] According to a specific embodiment, naive PSCs can be obtained by culturing in a naive pluripotent state in the absence of exogenous L-glutamine in the culture medium.

[0239] According to a specific embodiment, naive PSCs can be obtained by culturing in a naive pluripotent state in the absence of DNA methyltransferase 1 (DNMT1) expression.

[0240] Methods for obtaining primitive PSCs and maintaining them in a primitive and pluripotent state are known in the art and are further disclosed in the following Examples section and in the literature that is part of this specification, such as Choi, J., Huebner, A., Clement, K. et al. Nature 548, 219–223 (2017), www(dot)doi(dot)org / 10.1038 / nature23274; Yang et al. Cell (2017) 169(2): 243-257, www(dot)cell(dot)com / fulltext / S0092-8674%2817%2930183-6; Bayerl et al. 2021, Cell Stem Cell 28, 1549–1565 and International Patent Application Publication Nos. WO2016 / 016894 and WO2014 / 174470, the contents or entirety of which are incorporated herein by reference.

[0241] A variety of naive PSC cell lines are also known, such as the V6.5 mouse ESC line, the BVSc ES line, the NGFP1 iPSC line, the WIBR3 line, the WIS1 ES line, and the WIS ES line, and are commercially available from public cell line repositories.

[0242] As used herein, the term "trophectoderm (TE) initiated cell" refers to a stem cell derived from a primitive PSC comprising an exogenous nucleic acid sequence encoding a factor that induces differentiation into a trophectoderm cell and / or a cell derived from a primitive PSC committed to the trophectoderm lineage (e.g., a trophectoderm cell). It should be understood that before the induction factor (i.e., the protein product expressed by the exogenous nucleic acid sequence or the endogenous factor) is expressed, the cell is in a primitive and undifferentiated state (i.e., a primitive PSC), and after the induction factor is expressed, the cell acquires the characteristics of a trophectoderm cell.

[0243] According to specific embodiments, the trophectoderm-primed cells comprise an exogenous polynucleotide suitable for transiently expressing a factor that induces differentiation into trophectoderm cells, as further described below.

[0244] According to specific embodiments, the trophectoderm-primed cells comprise a protein product expressed by an exogenous nucleic acid sequence encoding a factor.

[0245] According to other specific embodiments, the trophectoderm-initiated cells do not contain a protein product expressed by an exogenous nucleic acid sequence encoding a factor.

[0246] As used herein, "trophectoderm cell" refers to a cell that has the restricted potential to give rise to all placental lineages, but no other cell lineages.

[0247] According to some embodiments, the trophectoderm cells give rise to the ectoplacental cone and / or the extraembryonic ectoderm (ExE) and / or the umbilical cord and / or the chorion.

[0248] Non-limiting examples of trophectoderm cell markers include Gata3, Gata2, tbr2, tfap2c, Cdx2, Elf5, Hand1, EOMES, KLF5, and ETS2.

[0249] According to a specific embodiment, the trophectoderm cells express Cdx2, ie are positive for Cdx2.

[0250] According to a specific embodiment, the trophectoderm-initiating cells express a trophectoderm marker. According to a specific embodiment, the trophectoderm-initiating cells express at least one trophectoderm marker selected from the group consisting of Gata3, Gata2, Cdx2 and Elf5.

[0251] According to a specific embodiment, the trophectoderm-initiation cell expresses a pluripotency marker. Such markers are known in the art and are further described above and below. According to a specific embodiment, the trophectoderm-initiation cell expresses at least one pluripotency marker selected from the group consisting of Oct4, Tfap2c, Susd2, Sox2, SSEA1, SSEA3, SSEA4, TRA1-60 (positive for it). According to a specific embodiment, the trophectoderm-initiation cell expresses Oct4. According to a specific embodiment, the trophectoderm-initiation cell is negative for a pluripotency marker selected from the group consisting of Klf17, Klf4 and Nanog.

[0252] According to specific embodiments, the trophectoderm-initiating cells express trophectoderm markers and pluripotency markers.

[0253] According to specific embodiments, the marker is endogenous to the cell.

[0254] Thus, according to a specific embodiment, the trophectoderm-initiating cells express exogenous factors that induce differentiation into trophectoderm cells, endogenous trophectoderm markers, and endogenous pluripotency markers.

[0255] According to specific embodiments, the trophectoderm-initiated cells express trophectoderm markers when mixed (ie, at time 0 hours), in the mixture, or in the aggregates.

[0256] According to specific embodiments, the trophectoderm-primed cells express pluripotency markers at the time of mixing (ie, at time 0 hours), in the mixture, or in the aggregates.

[0257] According to specific embodiments, the trophectoderm-primed cells do not express Oct4 and Nanog when mixed (ie, at time 0 hours), in the mixture, or in the aggregates.

[0258] According to a specific embodiment, the trophectoderm-primed cell (e.g., when mixed, in a mixture, in an aggregate) is not at the differentiation stage of a trophoblast stem cell (TSC). In other words, it does not have the phenotypic characteristics of a TSC (derived from trophectoderm or induced TSC or obtained by dedifferentiation or reprogramming of cells).

[0259] According to specific embodiments, a TSC (eg, a human TSC) has CDX2 - TFAP2C + GATA3 + SIGLE6 + Phenotype.

[0260] In contrast, human trophectoderm-derived cells or some embodiments of the present invention have CDX2 + TFAP2c + GATA3 + SIGLEC6 - Phenotype.

[0261] According to a specific embodiment, a TSC (eg, a mouse TSC) has CDX2 + TFAP2C + MHC class1 + OCT4 - Phenotype.

[0262] In contrast, mouse trophectoderm-priming cells or some embodiments of the present invention have CDX2 + TFAP2C + MHC class 1–Oct4 +(低) Phenotype.

[0263] Factors expressed to induce differentiation of naive PSCs of some embodiments of the invention may be endogenous and / or exogenous to the cells.

[0264] According to a specific embodiment, the method comprises inducing the expression of an exogenous factor that induces differentiation into trophectoderm cells.

[0265] As used herein, the term "exogenous" refers to a heterologous polynucleotide or polypeptide that is not naturally expressed in a cell or is expected to be overexpressed in a cell. It should be noted that the exogenous polynucleotide and / or polypeptide may contain a nucleic acid sequence and / or an amino acid sequence that is identical or partially homologous to an endogenous nucleic acid sequence and / or an endogenous amino acid sequence of the cell, respectively.

[0266] According to another or alternative embodiment, the method includes inducing expression of endogenous factors that induce differentiation into trophectoderm cells. Therefore, according to a specific embodiment, cells are cultured under conditions that enable expression of endogenous factors that induce differentiation into trophectoderm-primed cells. Such conditions include, for example, appropriate temperature (e.g., 37° C.), atmosphere (e.g., 0 2 %、CO 2%), pressure, pH, light, culture medium, supplements (e.g., differentiation factors disclosed herein), etc. Further description of culture conditions is provided below. Therefore, according to a specific embodiment, the primitive PSC cells or trophectoderm-initiated cells are contacted with the factor. In this culture situation, the cells may also contain or lack exogenous polynucleotides suitable for inducing differentiation into factors for trophectoderm cells. According to a specific embodiment, the cells do not contain exogenous polynucleotides suitable for inducing differentiation into factors for trophectoderm cells. In this case, inducing the expression of the endogenous factor, culturing or contacting is usually performed before mixing the cell subpopulations (e.g., starting from 14 days to 0 hours before mixing, starting from 13 days to 0 hours before mixing, starting from 12 days to 0 hours before mixing, starting from 11 days to 0 hours before mixing, starting from 10 days to 0 hours before mixing, starting from 9 days to 0 hours before mixing, starting from 8 days to 0 hours before mixing, starting from 7 days to 0 hours before mixing, starting from 6 days to 0 hours before mixing, starting from 5 days to 0 hours before mixing, starting from 120 hours to 0 hours before mixing, Start 100 hours to 0 hours before mixing, Start 80 hours to 0 hours before mixing, Start 60 hours to 0 hours before mixing, Start 48 hours to 0 hours before mixing, Start 36 hours to 0 hours before mixing, Start 24 hours to 0 hours before mixing, Start 12 hours to 0 hours before mixing, Start 14 days to 1 day before mixing, Start 13 days to 1 day before mixing, Start 12 days to 1 day before mixing, Start 11 days to 1 day before mixing, Start 10 days to 1 day before mixing, Start 9 days to 1 day before mixing, Start 8 days before mixing - Start within 1 day, Start within 7 days to 1 day before mixing, Start within 6 days to 1 day before mixing, Start within 5 days to 1 day before mixing, Start within 120 hours to 20 hours before mixing, Start within 100 hours to 20 hours before mixing, Start within 80 hours to 20 hours before mixing, Start within 60 hours to 20 hours before mixing, Start within 48 hours to 20 hours before mixing, Start within 14 days to 12 hours before mixing, Start within 13 days to 12 hours before mixing, Start within 12 days to 12 hours before mixing, Start within 11 days to 12 hours before mixing, 10 days before mixing Start within 9 days to 12 hours before mixing, Start within 8 days to 12 hours before mixing, Start within 7 days to 12 hours before mixing, Start within 6 days to 12 hours before mixing, Start within 5 days to 12 hours before mixing, Start within 120 hours to 12 hours before mixing, Start within 100 hours to 12 hours before mixing, Start within 80 hours to 12 hours before mixing, Start within 60 hours to 12 hours before mixing, Start within 48 hours to 12 hours before mixing, Start within 14 days to 6 hours before mixing, Start within 13 days to 6 hours before mixing,Starting within 12 days to 6 hours before mixing, starting within 11 days to 6 hours before mixing, starting within 10 days to 6 hours before mixing, starting within 9 days to 6 hours before mixing, starting within 8 days to 6 hours before mixing, starting within 7 days to 6 hours before mixing, starting within 6 days to 6 hours before mixing, starting within 5 days to 6 hours before mixing, starting within 120 hours to 6 hours before mixing, starting within 100 hours to 6 hours before mixing, starting within 80 hours to 6 hours before mixing, starting within 60 hours to 6 hours before mixing, starting within 48 hours to 6 hours before mixing, starting within 36 hours to 6 hours before mixing, starting within 24 hours to 6 hours before mixing, or within 12 hours to 6 hours before mixing, each possibility representing a separate embodiment of the invention).

[0267] According to specific embodiments, the culturing or contacting begins at least 6 hours, at least 10 hours, at least 12 hours, at least 16 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 72 hours, or at least 96 hours before the mixing.

[0268] According to a specific embodiment, the culturing or contacting begins no more than 3 days, no more than 4 days, no more than 5 days, no more than 6 days, no more than 7 days, no more than 8 days, no more than 9 days, no more than 10 days, no more than 14 days, no more than 16 days or no more than 20 days before mixing.

[0269] According to a specific embodiment, the culturing or contacting begins about 6 to 3 days prior to mixing.

[0270] According to a specific embodiment, the culturing or contacting begins about 3 days prior to mixing.

[0271] Factors inducing differentiation into trophectoderm cells are well known in the art, including factors expressed in cells and factors in contact with cells. Non-limiting examples of such factors include Cdx2, Gata3, Gata2, TGFR inhibitors, FGFR inhibitors, MEK / ERK inhibitors, BMP4, JAK inhibitors, FGF4, FGF2, heparin, SUMOylation inhibitors, histone deacetylase inhibitors, HIPPO signaling pathway inhibitors, and factors that induce YAP nuclear translocation.

[0272] According to a specific embodiment, the factor that induces differentiation into trophectoderm cells is Cdx2.

[0273] As used herein, the term "Cdx2" refers to the polynucleotides and expression products, such as polypeptides, of the CDX2 gene (corresponding to human gene ID NO: 1045) or its homologs or orthologs. According to a specific embodiment, Cdx2 refers to human Cdx2, such as provided in the following GeneBank numbers NP_001256, NP_001341629, NM_001265, NM_001354700 (SEQ ID NO: 68-70). According to a specific embodiment, Cdx2 refers to mouse Cdx2, such as provided in the following GeneBank numbers NP_031699 and NM_007673 and (SEQ ID NO: 72-73). Homologs (as further defined below) refer to functional expression products of Cdx2 that are capable of inducing differentiation of primitive PSCs into trophectoderm cells.

[0274] Thus, as described herein, any polynucleotides and expression products described herein (e.g., Cdx2, Gata4, etc.) are also referred to as homologs that exhibit the desired activity defined herein. Such homologs can, for example, be at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to a polypeptide or polynucleotide sequence provided herein.

[0275] Homologs may also refer to orthologs, deletion, insertion or substitution variants, including amino acid substitutions, so long as they retain activity.

[0276] Sequence identity or homology can be determined using any protein or nucleic acid sequence alignment algorithm (eg, Blast, ClustalW, and MUSCLE).

[0277] According to a specific embodiment, the factor that induces differentiation into trophectoderm cells is Gata3.

[0278] As used herein, the term "Gata3", also known as GATA binding protein 3 and HDRS, refers to the GATA3 gene (corresponding to human gene ID NO: 2625) or a polynucleotide and expression product, such as a polypeptide, of a homolog or ortholog thereof. According to a specific embodiment, Gata3 refers to human Gata3, such as provided in the following GeneBank numbers NP_001002295 and NM_001002295 (SEQ ID NO: 74). According to a specific embodiment, Gata3 refers to mouse Gata3, such as provided in the following GeneBank numbers NP_032117, NP_001342039, NP_001342040, NP_001342041, NM_008091, NM_001355110, NM_001355111, and NM_001355112 (SEQ ID NO: 76-83). A homologue (as further defined above) refers to a functional expression product of Gata3 that is capable of inducing differentiation of naive PSCs into trophectoderm cells.

[0279] According to a specific embodiment, the factor that induces differentiation into trophectoderm cells is Gata2.

[0280] As used herein, the term "Gata2", also known as GATA binding protein 2, refers to the GATA2 gene (corresponding to human gene ID NO: 2624) or a polynucleotide and expression product, such as a polypeptide, of a homolog or ortholog thereof. According to a specific embodiment, Gata2 refers to human Gata2, such as provided in the following GeneBank numbers NP_001139133, NP_001139134, NP_116027, NM_032638, NM_001145661, and NM_001145662 (SEQ ID NOs: 84-89). According to a specific embodiment, Gata2 refers to mouse Gata2, such as provided in the following GeneBank numbers NP_032116, NP_001342182, NM_008090, and NM_001355253 (SEQ ID NOs: 90-93). A homologue (as further defined above) refers to a functional expression product of Gata2 that is capable of inducing differentiation of naive PSCs into trophectoderm cells.

[0281] According to a specific embodiment, the factor that induces differentiation into trophectoderm cells is a TGFR inhibitor.

[0282] As used herein, the term "transforming growth factor receptor (TGFR)" (also referred to as "TGFR") refers to TGF-β type I receptor ALK5, type I activin / node receptor ALK4, and type I node receptor ALK7.

[0283] As used herein, the term "TGFR inhibitor (or TGFRi)" refers to a molecule capable of inhibiting TGFR expression and / or activity levels, which are determined by phosphorylated ALK4, 5, and 7. Non-limiting examples of TGFR inhibitors include SB431542 and A 83-01 small molecule compounds.

[0284] According to a specific embodiment, the factor that induces differentiation into trophectoderm cells is a FGFR inhibitor.

[0285] As used herein, the term "fibroblast growth factor receptor (FGFR)" refers to FGFR1, FGFR2, and FGFR3.

[0286] The term "FGFR inhibitor (or FGFRi)" as used herein refers to a molecule capable of inhibiting FGFR expression and / or activity levels, which are determined by the levels of phosphorylated FGFR1, 2, and 3. Non-limiting examples of FGFR inhibitors include PD173074, SU5401, and PD0325901.

[0287] According to a specific embodiment, the factor inducing differentiation into trophectoderm cells is a ROCK inhibitor.

[0288] The term "ROCK" as used herein is also known as Rho-associated protein kinase, including ROCK1 and ROCK2 having serine / threonine kinase activity.

[0289] As used herein, the term "ROCK inhibitor" refers to any molecule capable of inhibiting ROCK activity as determined by inhibition of ROCK phosphorylation levels (eg, as detected by western blot analysis).

[0290] Non-limiting examples of ROCK inhibitors include Y27632 (TOCRIS, catalog number 1254), Blebbistatin (TOCRIS catalog number 1760) and Thiazovivin (Axon Medchem-Axon 1535). Blebbistatin is a selective inhibitor of myosin II ATpase, a downstream effector of the ROCK pathway, and can therefore effectively inhibit the ROCK pathway (Chen G1, Hou Z et al. Actin-myosin contractility is responsible for the induced viability of dissociated human embryonic stem cells. Cell Stem Cell. 2010; 7(2): 240-8, which is incorporated herein by reference in its entirety).

[0291] According to a specific embodiment, the factor inducing differentiation into trophectoderm cells is a MEK / ERK inhibitor (as further defined below).

[0292] According to a specific embodiment, the factor inducing differentiation into trophectoderm cells is BMP4.

[0293] As used herein, the term "BMP4", also known as bone morphogenetic protein 4, refers to the polynucleotides and expression products, such as polypeptides, of the BMP4 gene (corresponding to human gene ID NO: 652) or its homologs or orthologs. According to a specific embodiment, BMP4 refers to human BMP4, such as provided in the following UniProt number P12644 (SEQ ID NO: 195). According to a specific embodiment, BMP4 refers to mouse BMP4, such as provided in the following UniProt number P21275 (SEQ ID NO: 196). A homolog (as further defined above) refers to a functional expression product of BMP4 that is capable of inducing the differentiation of primitive PSCs into trophectoderm cells.

[0294] According to a specific embodiment, the factor that induces differentiation into trophectoderm cells is a JAK inhibitor.

[0295] As used herein, the term "JAK" refers to Janus kinases, including JAK1, JAK2, JAK3, and TYK2.

[0296] The term "JAK inhibitor (or JAKi)" as used herein refers to a molecule capable of inhibiting JAK expression and / or activity levels, which are determined by the level of phosphorylated STAT (signal transducer and activator of transcription). Non-limiting examples of JAK inhibitors include Calbiochem 420099, Tofacitinib, Baricitinib, Ruxolitinib, Fedratinib, Upadacitinib, Cedulatinib, Gandotinib, Lesraurtinib, Momelotinib, Pacritinib, Cureubitacin I, CHZ868.

[0297] According to a specific embodiment, the factor that induces differentiation into trophectoderm cells is FGF4.

[0298] As used herein, the term "FGF4", also known as fibroblast growth factor 4, refers to the FGF4 gene (corresponding to human gene ID NO: 2249) or its homologues or orthologues polynucleotides and expression products, such as polypeptides. According to a specific embodiment, FGF4 refers to human FGF4, such as provided in the following GeneBank numbers NP_001998 and NM_002007 (SEQ ID NO: 94-95). According to a specific embodiment, FGF4 refers to mouse FGF4, such as provided in the following GeneBank numbers NP_034332 and NM_010202 (SEQ ID NO: 96-97). Homologues (as further defined above) refer to functional expression products of FGF4 that can induce primitive PSCs to differentiate into trophectoderm cells and / or extraembryonic primitive endoderm cells.

[0299] According to a specific embodiment, the factor that induces differentiation into trophectoderm cells is FGF2.

[0300] As used herein, the term "FGF2", also known as basic fibroblast growth factor (bFGF) and FGF-β, refers to the polynucleotides and expression products, such as polypeptides, of the FGF2 gene (corresponding to human gene ID NO: 2247) or its homologs or orthologs. According to a specific embodiment, FGF2 refers to human FGF2, such as provided in the following GeneBank numbers NP_001997, NP_001348594, NM_002006, and NM_001361665 (SEQ ID NO: 98-101). According to a specific embodiment, FGF2 refers to mouse FGF2, such as provided in the following GeneBank numbers NP_032032 and NM_008006 (SEQ ID NO: 102-103). Homologs (as further defined above) refer to functional expression products of FGF2 that are capable of inducing differentiation of primitive PSCs into trophectoderm cells and / or extraembryonic primitive endoderm cells.

[0301] According to a specific embodiment, the factor inducing differentiation into trophectoderm cells is a SUMOylation inhibitor, such as but not limited to DC 2-D08 (2',3',4'-trihydroxyflavone).

[0302] According to a specific embodiment, the factor inducing differentiation into trophectoderm cells is a histone deacetylase inhibitor (HDACi), such as but not limited to VPA (valproic acid), trichostatin A, sodium butyrate or UF010 small molecule inhibitor.

[0303] According to a specific embodiment, the factor inducing differentiation into trophectoderm cells is a HIPPO signaling pathway inhibitor or a factor inducing YAP nuclear translocation.

[0304] The HIPPO signaling pathway, also known as the Salvador / Warts / Hippo (SWH) pathway, contains a complex cascade of serine / threonine protein kinases that ultimately regulate the phosphorylation of Yap / Taz. Specifically, when the Hippo pathway is in the "off" state, phosphorylated YAP / TAZ remain in the cytoplasm and may also undergo proteolytic degradation. When the Hippo pathway is in the "on" state, unphosphorylated YAP / TAZ enter the nucleus and bind to transcription factors called TEA DNA-binding proteins (TEAD1–4). Non-limiting examples of components of the HIPPO signaling pathway include Hpo, serine threonine kinase 3 (STK3) and STK4 (also known as MST1 and MST2), salvador homolog 1 (SAV1), large tumor suppressor 1 / 2 (LATS1 / 2), MAP4K, TAOK, MOB kinase activator 1A / B (MOB1A / B), yes-associated protein (YAP1), transcriptional coactivator with PDZ binding motif (TAZ or WWTR1), and neurofibromin 2 (NF2).

[0305] The HIPPO signaling pathway inhibitors disclosed herein bind to components of the HIPPO signaling pathway and inhibit their expression and / or activity. Such inhibitors are known in the art and include, but are not limited to, LPA and XMU-MP-1.

[0306] The term "extraembryonic primitive endoderm (PRE)-initiated cells" as used herein refers to stem cells derived from naive PSCs comprising exogenous nucleic acid sequences encoding factors that induce differentiation into extraembryonic primitive endoderm cells and / or cells derived from naive PSCs committed to the extraembryonic primitive endoderm lineage (e.g., extraembryonic primitive endoderm cells).

[0307] It should be understood that before inducing the expression of exogenous factors (i.e., protein products expressed by exogenous nucleic acid sequences or endogenous factors), the cells are in a primitive and undifferentiated state (i.e., primitive PSC), and after inducing the expression of exogenous factors, the cells acquire the characteristics of extraembryonic primitive endoderm cells.

[0308] According to specific embodiments, the extraembryonic primitive endoderm initiating cells comprise an exogenous polynucleotide suitable for transiently expressing factors that induce differentiation into extraembryonic primitive endoderm cells, as further described below.

[0309] According to a specific embodiment, the extraembryonic primitive endoderm initiating cells comprise a protein product expressed by an exogenous nucleic acid sequence encoding the factor.

[0310] According to other specific embodiments, the extraembryonic primitive endoderm initiating cells do not contain the protein product expressed by the exogenous nucleic acid sequence encoding the modified factor.

[0311] As used herein, "extraembryonic primitive endoderm cell" refers to a cell that has the restricted potential to give rise to all primitive endoderm lineages but no other cell lineages.

[0312] Non-limiting examples of extraembryonic primitive endoderm cell markers include Foxa2, Gata4, Gata6, PDGFRA, and Sox17.

[0313] According to a specific embodiment, the extraembryonic primitive endoderm cells express Gata4, ie are positive for Gata4.

[0314] According to a specific embodiment, the extraembryonic primitive endoderm initiating cell expresses an extraembryonic primitive endoderm marker. According to a specific embodiment, the extraembryonic primitive endoderm initiating cell expresses at least one extraembryonic primitive endoderm marker selected from the group consisting of PDGFRA, GATA4, SOX17, NID2 and GATA6.

[0315] According to a specific embodiment, the extraembryonic primitive endoderm initial state cell expresses pluripotency markers. Such markers are known in the art and are further described above and below. According to a specific embodiment, the extraembryonic primitive endoderm initial state cell expresses at least one pluripotency marker selected from the group consisting of OCT4, SSEA1 and SSEA4 (positive for it). According to a specific embodiment, the extraembryonic primitive endoderm initial state cell is negative for the pluripotency marker selected from the group consisting of NANOG, KLF17, NANOG-NB and TFCP2L1.

[0316] According to a specific embodiment, the extraembryonic primitive endoderm initiating state cells express extraembryonic primitive endoderm markers and pluripotency markers.

[0317] According to specific embodiments, the marker is endogenous to the cell.

[0318] Therefore, according to a specific embodiment, the extraembryonic primitive endoderm initiating state cells express exogenous factors that induce differentiation into extraembryonic primitive endoderm cells, endogenous extraembryonic primitive endoderm markers, and endogenous pluripotency markers.

[0319] According to a specific embodiment, the extraembryonic primitive endoderm initiating cells express extraembryonic primitive endoderm markers when mixed (ie at time 0 hours), in the mixture or in the aggregate.

[0320] According to specific embodiments, the extraembryonic primitive endoderm-initiating cells express pluripotency markers when mixed (ie, at time 0 hours), in a mixture, or in aggregates.

[0321] According to a specific embodiment, the extraembryonic primitive endoderm initiating cells express Oct4 when mixed (ie, at time 0 hours), in a mixture, or in an aggregate.

[0322] According to other specific embodiments, the extraembryonic primitive endoderm initiating cells do not express Oct4 when mixed (ie, at time 0 hours), in the mixture, or in the aggregate.

[0323] According to a specific embodiment, the extraembryonic primitive endoderm initiation state cell (e.g., when mixed, in a mixture, in an aggregate) is not at the differentiation stage of a XEN cell. In other words, it does not have the phenotypic characteristics of a XEN (which can be obtained from a blastocyst, an early post-implantation embryo, or an induced XEN obtained by cell dedifferentiation or reprogramming).

[0324] According to a specific embodiment, XEN has OCT4 - GATA6 + GATA4 + SOX17 + PDGFRa + Phenotype.

[0325] In contrast, the extraembryonic primitive endoderm initiating cells of some embodiments of the present invention have OCT4 + GATA6 + GATA4 + SOX17 + PDGFRa + Phenotype.

[0326] As noted above, factors expressed to induce differentiation of naive PSCs according to some embodiments of the invention may be endogenous and / or exogenous to the cells.

[0327] According to a specific embodiment, the method comprises inducing expression of an exogenous factor that induces differentiation into extraembryonic primitive endoderm cells.

[0328] According to another or alternative embodiment, the method includes inducing expression of endogenous factors that induce differentiation into extraembryonic primitive endoderm cells (differentiation into extraembryonic primitive endoderm cells). Therefore, according to a specific embodiment, cells are cultured under conditions that enable expression of endogenous factors that induce differentiation into extraembryonic primitive endoderm initial state cells. Such conditions include, for example, appropriate temperature (e.g., 37° C.), atmosphere (e.g., 0 2 %、CO 2%), pressure, pH, light, culture medium, supplements (e.g., differentiation factors disclosed herein), etc. Further description of culture conditions is provided below. Therefore, according to a specific embodiment, the primitive PSC cells or the extraembryonic primitive endoderm-derived cells are contacted with factors. In this culture situation, the cells may also contain or lack exogenous polynucleotides suitable for expressing factors that induce differentiation into extraembryonic primitive endoderm cells. According to a specific embodiment, the cells do not contain exogenous polynucleotides suitable for expressing factors that induce differentiation into extraembryonic primitive endoderm. In this case, inducing the expression of the endogenous factor, culturing or contacting is usually performed before mixing the cell subpopulations (e.g., starting from 14 days to 0 hours before mixing, starting from 13 days to 0 hours before mixing, starting from 12 days to 0 hours before mixing, starting from 11 days to 0 hours before mixing, starting from 10 days to 0 hours before mixing, starting from 9 days to 0 hours before mixing, starting from 8 days to 0 hours before mixing, starting from 7 days to 0 hours before mixing, starting from 6 days to 0 hours before mixing, starting from 5 days to 0 hours before mixing, starting from 120 hours to 0 hours before mixing , Start 100 hours to 0 hours before mixing, Start 80 hours to 0 hours before mixing, Start 60 hours to 0 hours before mixing, Start 48 hours to 0 hours before mixing, Start 36 hours to 0 hours before mixing, Start 24 hours to 0 hours before mixing, Start 12 hours to 0 hours before mixing, Start 14 days - 1 day before mixing, Start 13 days to 1 day before mixing, Start 12 days to 1 day before mixing, Start 11 days to 1 day before mixing, Start 10 days to 1 day before mixing, Start 9 days to 1 day before mixing, Start 8 days before mixing Start within 1 to 1 day before mixing, Start within 7 days to 1 day before mixing, Start within 6 days to 1 day before mixing, Start within 5 days to 1 day before mixing, Start within 120 hours to 20 hours before mixing, Start within 100 hours to 20 hours before mixing, Start within 80 hours to 20 hours before mixing, Start within 60 hours to 20 hours before mixing, Start within 48 hours to 20 hours before mixing, Start within 14 days to 12 hours before mixing, Start within 13 days to 12 hours before mixing, Start within 12 days to 12 hours before mixing, Start within 11 days to 12 hours before mixing, Start within 12 hours before mixing Start within 0 days to 12 hours before mixing, Start within 9 days to 12 hours before mixing, Start within 8 days to 12 hours before mixing, Start within 7 days to 12 hours before mixing, Start within 6 days to 12 hours before mixing, Start within 5 days to 12 hours before mixing, Start within 120 hours to 12 hours before mixing, Start within 10 hours 0 to 12 hours before mixing, Start within 80 hours to 12 hours before mixing, Start within 60 to 12 hours before mixing, Start within 48 hours to 12 hours before mixing, Start within 14 days to 6 hours before mixing, Start within 13 days to 6 hours before mixing,Starting within 12 days to 6 hours before mixing, starting within 11 days to 6 hours before mixing, starting within 10 days to 6 hours before mixing, starting within 9 days to 6 hours before mixing, starting within 8 days to 6 hours before mixing, starting within 7 days to 6 hours before mixing, starting within 6 days to 6 hours before mixing, starting within 5 days to 6 hours before mixing, starting within 120 hours to 6 hours before mixing, starting within 100 hours to 6 hours before mixing, starting within 80 hours to 6 hours before mixing, starting within 60 hours to 6 hours before mixing, starting within 48 hours to 6 hours before mixing, starting within 36 hours to 6 hours before mixing, starting within 24 hours to 6 hours before mixing, or within 12 hours to 6 hours before mixing, each possibility representing a separate embodiment of the invention).

[0329] According to specific embodiments, the culturing or contacting begins at least 6 hours, at least 10 hours, at least 12 hours, at least 16 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 72 hours, or at least 96 hours before the mixing.

[0330] According to a specific embodiment, the culturing or contacting begins no more than 3 days, no more than 4 days, no more than 5 days, no more than 6 days, no more than 7 days, no more than 8 days, no more than 9 days, no more than 10 days, no more than 14 days, no more than 16 days or no more than 20 days before mixing.

[0331] According to a specific embodiment, the culturing or contacting begins about 6 days to 3 days prior to mixing.

[0332] According to a specific embodiment, the culturing or contacting begins about 3 days prior to mixing.

[0333] Factors that induce differentiation into extraembryonic primitive endoderm cells are well known in the art, including factors expressed in cells and factors contacted with cells. Non-limiting examples of such factors include Gata4, Gata6, GSK-3 inhibitors, WNT ligands, heparin, FGF2, FGF4, PDGFRA, leukemia inhibitory factor (LIF) and insulin.

[0334] According to a specific embodiment, the factor that induces differentiation into extraembryonic primitive endoderm cells is Gata4.

[0335] As used herein, the term "Gata4", also known as GATA binding protein 4 and transcription factor Gata4, refers to the GATA4 gene (corresponding to human gene ID NO: 2626) or a polynucleotide and expression product thereof, such as a polypeptide. According to a specific embodiment, Gata4 refers to human Gata4, such as provided in the following GeneBank numbers NP_001295022, NP_001295023, NP_002043, NP_001361202, NP_001361203, NM_001308093, NM_001308094, NM_002052, NM_001374273 and NM_001374274 (SEQ ID NO: 104-113). According to a specific embodiment, Gata4 refers to mouse Gata4, such as provided in the following GeneBank Nos. NP_001297539, NP_032118, NM_008092 and NM_001310610 (SEQ ID NOs: 114-117). Homologs (as further defined above) refer to functional expression products of Gata4 that are capable of inducing naive PSC differentiation into extraembryonic primitive endoderm cells.

[0336] According to a specific embodiment, the factor that induces differentiation into extraembryonic primitive endoderm cells is Gata6.

[0337] As used herein, the term "Gata6", also known as GATA binding protein 6 and transcription factor Gata6, refers to the GATA6 gene (corresponding to human gene ID NO: 2627) or a polynucleotide and expression product, such as a polypeptide, of a homolog or ortholog thereof. According to a specific embodiment, Gata6 refers to human Gata6, such as provided in the following GeneBank numbers NP_005248 and NP_005257 (SEQ ID NO: 118-119). According to a specific embodiment, Gata6 refers to mouse Gata6, such as provided in the following GeneBank numbers NP_034388 and NM_010258 (SEQ ID NO: 120-121). A homolog (as further defined above) refers to a functional expression product of Gata6 that is capable of inducing differentiation of primitive PSCs into extraembryonic primitive endoderm cells.

[0338] According to a specific embodiment, the factor inducing differentiation into extraembryonic primitive endoderm cells is SOX17.

[0339] As used herein, the term "SOX17", also known as SRY-box 17, refers to the SOX17 gene (corresponding to human gene IDNO: 64321) or its homolog or ortholog polynucleotides and expression products, such as polypeptides. According to a specific embodiment, SOX17 refers to human SOX17, such as provided in the following GeneBank numbers NP_071899 and NM_022454 (SEQ ID NO: 197-198). According to a specific embodiment, SOX17 refers to mouse SOX17, such as provided in the following UniProt number Q61473 (SEQ ID NO: 199). Homologs (as further defined above) refer to functional expression products of SOX17 that can induce primitive PSCs to differentiate into extraembryonic primitive endoderm cells.

[0340] According to a specific embodiment, the factor that induces differentiation into extraembryonic primitive endoderm cells is a GSK-3 inhibitor.

[0341] The term "GSK-3" as used herein refers to the glycogen synthase kinase 3β protein shown in GenBank Accession No. NP_002084 (SEQ ID NO: 122) and / or NP_001139628 (SEQ ID NO: 123), which has WNT signaling regulatory activity through its kinase activity.

[0342] As used herein, the term "GSK-3 inhibitor" refers to any molecule capable of inhibiting the activity of GSK-3 as determined by specifically inhibiting the level of phosphorylated GSK3b (out of the total GSK3b present in the cell).

[0343] Non-limiting examples of GSK-3 inhibitors include CHIR99021 (AXON MEDCHEM - AXON 1386), BIO (AXON MEDCHEM - Axon 1693), and Kenpaullone (TOCRIS - Catalog No. 1398).

[0344] According to a specific embodiment, the factor that induces differentiation into extraembryonic primitive endoderm cells is a WNT ligand.

[0345] Wnt ligands are a large family of secreted glycoproteins that are rich in cysteine ​​and highly hydrophobic. Non-limiting examples of Wnt ligands that can be used with specific embodiments of the invention include Wnt-1, Wnt-2, Wnt-2b, Wnt-3a, Wnt-4, Wnt-5a, Wnt-5b, Wnt-6, Wnt-7a, Wnt-7b, Wnt8a, Wnt-8b, Wnt-9a, Wnt-9b, Wnt-10a, Wnt-10b, Wnt-11, and Wnt16b.

[0346] According to a specific embodiment, the factor that induces differentiation into extraembryonic primitive endoderm cells is FGF2.

[0347] According to a specific embodiment, the factor that induces differentiation into extraembryonic primitive endoderm cells is FGF4.

[0348] According to a specific embodiment, the factor that induces differentiation into extraembryonic primitive endoderm cells is PDGF.

[0349] The term "PDGF" as used herein refers to platelet-derived growth factor, including various isoforms of PDGF, including PDGF-B (e.g., GenBank Accession Nos. X02811 and CAA26579), PDGF-A (e.g., GenBank Accession Nos. X06374 and CAA29677), PDGF-C (e.g., GenBank Accession Nos. NM 016205 and NP 057289), PDGF-D variants 1 and 2 (e.g., GenBank Accession Nos. NM 025208, NP 079484, NM 033135, NP 149126), and dimerized forms thereof, including PDGF-AA, PDGF-AB, PDGF-BB, PDGF-CC, and PDGF-DD. Typically, platelet-derived growth factor includes homodimers or heterodimers of A and B chains, which act by binding to and dimerizing with two related receptor tyrosine kinases, platelet-derived growth factor cell surface receptors PDGFR-α (also known as PDGFRA, e.g., GenBank Accession Nos. NM 006206 and NP 006197) and PDGFR-β (e.g., GenBank Accession Nos. NM 002609 and NP 002600). For PDGF sequences, see also PCT Application Publication No. WO2010 / 127029 and U.S. Application Publication No. US20150182623, the entire contents of which are incorporated herein. According to a specific embodiment, PDGF is capable of inducing the differentiation of primitive PSCs into extraembryonic primitive endoderm cells.

[0350] According to a specific embodiment, the factor inducing differentiation into extraembryonic primitive endoderm cells is LIF (as further defined below).

[0351] According to a specific embodiment, the factor that induces differentiation into extraembryonic primitive endoderm cells is insulin.

[0352] Since the inventors have developed culture conditions capable of generating extraembryonic primitive endoderm-derived cells from naive PSCs, which cells can be used, for example, to generate synthetic embryos (Examples 10 and 14 of the Examples section below), embodiments of the present invention also contemplate methods of obtaining these cells.

[0353] Therefore, according to one aspect of the present invention, there is provided a method for obtaining extraembryonic primitive endoderm-initiation cells, the method comprising allowing the primitive PSC to differentiate into GATA4 + GATA6 + OCT4 + Nanog - Under the conditions of extraembryonic primitive endoderm-initiation cells, the primitive PSCs are cultured in a basic culture medium without activin A, thereby obtaining extraembryonic primitive endoderm-initiation cells.

[0354] According to a specific embodiment, GATA4 + GATA6 + OCT4 + Nanog - The cells were also positive for PDGFRA and NID2.

[0355] According to a specific embodiment of this aspect of the present invention, the method further comprises inducing expression (eg, transient expression) of an exogenous factor that induces differentiation into extraembryonic primitive endoderm cells.

[0356] According to other specific embodiments of this aspect of the present invention, the method does not include inducing expression (eg, transient expression) of exogenous factors that induce differentiation into extraembryonic primitive endoderm cells.

[0357] According to specific embodiments, the culturing is performed for at least 6 hours, at least 12 hours, at least 16 hours, at least 1 day (or at least 24 hours), at least 2 days or at least 3 days.

[0358] According to a specific embodiment, the culturing is carried out for up to 14 days, up to 13 days, up to 12 days, up to 11 days, up to 10 days, up to 9 days, up to 8 days, up to 7 days or up to 6 days.

[0359] According to a specific embodiment, the cultivation is carried out for 1 to 10 days.

[0360] According to a specific embodiment, the culturing is carried out for about 3 to 6 days.

[0361] According to a specific embodiment, the culturing is carried out for about 3 days.

[0362] According to a specific embodiment, the obtained cells maintain the phenotype of extraembryonic primitive endoderm-derived cells (e.g., GATA4 + GATA6 + OCT4 + Nanog -Thus, according to specific embodiments, the cells can be expanded in culture for at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, or at least 30 generations while maintaining the phenotype of the extraembryonic primitive endoderm-initiation cell (e.g., GATA4 + GATA6 + OCT4 + Nanog - phenotype).

[0363] The exogenous factors of some embodiments of the invention are transiently expressed in cells.

[0364] Methods for expressing exogenous nucleic acid sequences and / or amino acid sequences are known in the art, including, for example, those described in the Materials and Methods in the Examples section that follows and in: Mansour et al. 2012; Warren et al. 2010 and Hongyan Zhou al. Cell Stem Cell (2009) 4(6):581; Rabinovich and Weissman (2013) Methods Mol Biol. 969:3-28; International Application Publication No. WO 2013049389 and U.S. Patent No. US 8557972, the entire contents of which are incorporated herein by reference.

[0365] Furthermore, methods of transient expression are well known in the art and include, but are not limited to, expression under the control of an inducible promoter, by introducing mRNA into a cell where it is translated and degraded after a relatively short period of time, or by transfection with a protein, as further described below.

[0366] Differentiating cells expressing exogenous polynucleotides and / or polypeptides from cells not expressing exogenous polynucleotides and / or polypeptides can be achieved, for example, by determining the level and / or distribution of RNA and / or protein molecules in the cell, the location of DNA integration in the cell genome, and / or the gene copy number. Methods for determining the presence of exogenous polynucleotides and / or polypeptides in cells are well known in the art and include, for example, PCR, DNA and RNA sequencing, Southern blotting, Western blotting, immunoprecipitation, immunocytochemistry, flow cytometry, and imaging.

[0367] According to a specific embodiment, expression is achieved by introducing into the cell a polynucleotide encoding the factor.

[0368] According to specific embodiments, expression is not in the native location (ie, locus) and / or expression level (eg, copy number and / or cellular localization) of the native gene for the factor.

[0369] Alternatively or additionally, exogenous expression of factors may be promoted by activating the endogenous loci of these genes such that the factors are overexpressed in the cell. Methods for activating and overexpressing endogenous genes are well known in the art [see, e.g., Menke D. Genesis (2013) 51:-618; Capecchi, Science (1989) 244:1288-1292; Santiago et al. Proc Natl Acad Sci USA (2008) 105:5809-5814; International Patent Application Nos. WO 2014085593, WO2009071334, and WO 2011146121; U.S. Patent Nos. 8771945, 8586526, 6774279, and UP Patent Application Publication Nos. 20030232410, 20050026157, US20060014264; the contents of which are incorporated by reference in their entirety] and include, but are not limited to, targeted homologous recombination (e.g., "hit and escape"). run), "double replacement", site-specific recombinases (e.g., Cre recombinase and Flp recombinase), PB transposases (e.g., Sleeping Beauty, piggyBac, Tol2, or FrogPrince), genome editing by engineered nucleases (e.g., meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas systems), and genome editing using recombinant adeno-associated virus (rAAV) platforms and small molecules. Reagents for introducing nucleic acid changes into target genes can be designed from publicly available sources or commercially available from Transposagen, Addgene, and Sangamo Biosciences.

[0370] The term "polynucleotide" as used herein refers to an RNA sequence (e.g., mRNA), a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence (e.g., a sequence isolated from a chromosome), a composite polynucleotide sequence (e.g., a combination of the above), or a single-stranded or double-stranded nucleic acid sequence in the form of a mimetic or analog thereof. The term includes polynucleotides and / or oligonucleotides derived from naturally occurring nucleic acid molecules (e.g., RNA or DNA), synthetic polynucleotides and / or oligonucleotide molecules composed of naturally occurring bases, sugars, and covalent internucleoside bonds (e.g., backbones), and synthetic polynucleotides and / or oligonucleotides having non-naturally occurring portions that function similarly to corresponding naturally occurring portions.

[0371] According to specific embodiments, the polynucleotide is a modified polynucleotide, such as a modified RNA.

[0372] The polynucleotide of such modification can include the modification of backbone, internucleoside bond or base.The polynucleotide of modification can include natural modified nucleotide or synthetic nucleoside analog.According to specific embodiments, the polynucleotide of modification may be superior to native form, because it has desired characteristics, for example, enhanced cellular uptake, enhanced affinity to nucleic acid target, stability increased in the presence of nuclease and the immunogenicity reduced.

[0373] Such modifications include, but are not limited to, 5-methoxyuridine, pseudouridine, 5-methylcytidine, N6-methyladenosine, 2'-O-methyl, 2'-O-methyl 3' phosphorothioate, 2'-O-methyl 3' phosphothioate acetate, locked nucleic acid (LNA).

[0374] Methods for stabilizing mRNA are known in the art, including regulating the length of the polyadenine tail present at the 3' end of the mRNA transcript. Alternatively or in addition, the RNA cap present at the 5' end of the molecule can be modified. The typical naturally occurring cap structure in mammalian cells tends to be mistakenly incorporated into the RNA synthesized in vitro, thereby reducing its effectiveness. Synthetic "anti-reverse cap analogs" (e.g., analogs commercially available from Thermo Fisher Scientific) can prevent this misincorporation, thereby producing more stable RNA and improving translation efficiency. In order to reduce immunogenicity, specific nucleotides can be replaced with chemically modified substitutes, such as 5-methylcytosine or pseudouridine. Such replacement can suppress immune response while also enhancing the stability and translation efficiency of mRNA. Other exemplary chemically modified nucleotides are described above.

[0375] Alternatively or additionally, the mRNA can be encapsulated in lipid-based particles to enhance fusion with lipid cell membranes.

[0376] The polynucleotides designed according to the teachings of some embodiments of the present invention can be produced according to any polynucleotide synthesis method known in the art (e.g., enzymatic synthesis or solid phase synthesis). Equipment and reagents for performing solid phase synthesis can be commercially available from, for example, Applied Biosystems. Any other method for such synthesis may also be employed; the actual synthesis of the polynucleotides is well within the capabilities of those skilled in the art and may be accomplished by established methods, see, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, RM, ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988) and "Oligonucleotide Synthesis" Gait, MJ, ed. (1984), which utilizes solid phase chemistry, such as cyanoethylphosphoramidite, followed by deprotection, desalting and purification by, for example, automated tritylation or HPLC.

[0377] The term "polypeptide" or "protein" as used herein encompasses natural peptides (degradation products, synthetic peptides or recombinant peptides) and peptide mimetics (generally synthetic peptides), as well as peptoids and hemi-peptoids that are peptide analogs, which may have modifications that, for example, make the peptide more stable in vivo or more permeable to cells. Such modifications include, but are not limited to, N-terminal modifications, C-terminal modifications, peptide bond modifications, backbone modifications, and residue modifications. Methods for preparing peptide mimetics are well known in the art and are described in detail, for example, in Quantitative Drug Design, CA Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated herein as if fully set forth herein.

[0378] The peptide bonds (-CO-NH-) within the peptide can be substituted, for example, by N-methylated amide bonds (-N(CH3)-CO-), ester bonds (-C(=O)-O-), ketomethylene bonds (-CO-CH2-), sulfenylmethylene bonds (-S(=O)-CH2-), α-aza bonds Wherein R is any alkyl group (e.g., methyl), an amine bond (-CH2-NH-), a sulfide bond (-CH2-S-), an ethylene bond (-CH2-CH2-), a hydroxyethylene bond (-CH(OH)-CH2-), a thioamide bond (-CS-NH-), an olefinic double bond (-CH=CH-), a fluorinated olefinic double bond (-CF=CH-), a reverse amide bond (-NH-CO-), a peptide derivative wherein R is a "normal" side chain naturally occurring on a carbon atom.

[0379] These modifications can occur at any bond in the polypeptide chain, or even at several (2-3) bonds simultaneously.

[0380] The natural aromatic amino acids Trp, Tyr and Phe may be replaced by non-natural aromatic amino acids such as 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (Tic), naphthylalanine, ring-methylated derivatives of Phe, halogenated derivatives of Phe or O-methyl-Tyr.

[0381] The polypeptides of some embodiments of the present invention may also include one or more modified amino acids or one or more non-amino acid monomers (eg, fatty acids, complex carbohydrates, etc.).

[0382] The term "amino acid" should be understood to include the 20 naturally occurring amino acids; those amino acids that are commonly post-translationally modified in vivo, including, for example, hydroxyproline, phosphoserine, and phosphothreonine; and other less common amino acids, including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, norvaline, norleucine, and ornithine. In addition, the term "amino acid" includes D amino acids and L amino acids.

[0383] The polypeptides of some embodiments of the present invention can be synthesized by any technique known to those skilled in the art of peptide synthesis, such as, but not limited to, recombinant DNA technology or solid phase peptide synthesis.

[0384] The following is a non-limiting description of expression vectors that can be used to express a polypeptide of interest (eg, any of the factors described above and below, such as Cdx2, Gata4) in cells and the manner in which they are administered to the cells.

[0385] According to specific embodiments, expressing comprises introducing a polynucleotide encoding a polypeptide of interest (eg, a factor) into a cell.

[0386] According to a specific embodiment, the polynucleotide is DNA.

[0387] According to a specific embodiment, the polynucleotide is RNA. Generally, the mRNA introduced into the cell is present only in the cytoplasm, does not cause genomic perturbations and is essentially transient. Unless the expression of the mRNA changes the cell epigenetically, transient transfection is limited by the time that the mRNA and homologous protein persist in the cell and will not continue after the homologous protein is degraded.

[0388] In order to express foreign proteins in mammalian cells, the polynucleotide sequence encoding the polypeptide of interest is preferably linked to a nucleic acid construct suitable for mammalian cell expression.

[0389] It will be appreciated that knock-in and / or knock-out constructs may be used to achieve overexpression of a gene [see, e.g., Fukushige, S. and Ikeda, JE: Trapping of mammalian promoters by Cre-lox site-specific recombination. DNA Res 3 (1996) 73-50; Bedell, MA, Jerkins, NA and Copeland, NG: Mouse models of human disease. Part I: Techniques and resources for genetic analysis in mice. Genes and Development 11 (1997) 1-11; Bermingham, JJ, Scherer, SS, O'Connell, S., Arroyo, E., Kalla, KA, Powell, FL and Rosenfeld, MG: Tst-1 / Oct-6 / SCIP regulates a unique step in peripheral myelination and is required for normal respiration. Genes Dev 10 (1996) 1751-62].

[0390] Such a nucleic acid construct or system includes at least one cis-acting regulatory element for directing the expression of a nucleic acid sequence. Cis-acting regulatory sequences include those that direct constitutive expression of a nucleotide sequence and those that direct inducible expression of a nucleotide sequence only under certain conditions.

[0391] According to a specific embodiment, the nucleic acid construct includes an inducible promoter sequence for directing transcription of a polynucleotide sequence in a cell in an inducible manner. Inducible mammalian promoters are known to those skilled in the art (see, for example, Bitter et al. (1987) Methods in Enzymology 153: 516-544). Inducible promoters can be activated by external signals or agents (i.e., inducers). Inducers can directly activate the promoter or inactivate the repressor of the promoter. For example, inducible systems endogenous to mammalian cells include promoters induced by heavy metals (Brinster et al. Nature (1982) 296:39-42; Mayo et al. Cell (1982) 29:99-108; and Searle et al. Molecular and Cellular Biology (1985) 5:1480-1489), steroid hormones (Hynes et al. Proc. Natl. Acad. Sci. USA (1981) 78:2038-2042; Lee et al. Nature (1981) 294:228-232; and Klock et al. Nature (1987) 329:734-736), heat shock (Nouer, Heat Shock Response. Boca Raton, FL, Ed. CRC, 1991) (in Mullick, A. and B. Massie Encyclopedia of Cell Technology pp.1 140-1 164, 2000) has been well characterized. PCT Publication WO2002 / 088346 discloses a cumate inducible promoter. Other inducible promoters are known in the art, including but not limited to inflammation and hypoxia inducible promoters. Prokaryotic and insect inducible promoter systems have been adapted for regulated expression in mammalian cells. See, for example, Gossen et al. (1993) TIBS 18:471-475 and No et al. (1996) Proc. Natl. Acad. Sci. USA 93:3346-3351). The insect ecdysone inducible promoter is tightly regulated and has no detectable background expression in the absence of inducer. Ecdysone is suitable for use in vivo because it is a naturally occurring lipophilic steroid that can penetrate tissues, is inert in mammals, and exhibits rapid clearance kinetics (No et al.).Gupta et al. (PNAS (2004) 101: 1927-1932) disclosed retroviral delivery of an ecdysone-inducible gene expression system under the control of a modified RNA polymerase III-specific U6 promoter.

[0392] Prokaryotic repressors from the lac and tet operons have been incorporated into eukaryotic inducible expression systems. In the absence of an inducer, the repressor binds to an operator site downstream of the minimal promoter, thereby mediating expression repression, which is relieved by the addition of an inducer (Brown et al. (1987) Cell 49:603-612; Hu and Davidson (1987) Cell 48:555-566; Blau and Rossi, Proc. Natl. Acad. Sci. USA (1999) 96:797-799; and Gossen et al. (1995) Science 268:1766-1769).

[0393] According to a specific embodiment, the inducible promoter is a Tet-on promoter inducible by tetracycline or doxycycline.

[0394] Methods for constructing nucleic acid constructs or systems comprising an inducible promoter operably linked to a coding sequence for any polypeptide, as well as methods for introducing system constructs and vectors comprising such expression cassettes into cells are known to those skilled in the art.

[0395] In the case of mRNA, since gene expression from an RNA source does not require transcription, a promoter sequence or the additional sequences described below that are involved in transcription are not required.

[0396] The nucleic acid constructs or systems (also referred to herein as "expression vectors") of some embodiments of the invention include additional sequences that make the vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors). In addition, typical cloning vectors may also include transcription and / or translation initiation sequences, transcription and / or translation terminators, and polyadenylation signals. For example, such constructs typically include a 5'LTR, a tRNA binding site, a packaging signal, an origin of second strand DNA synthesis, and a 3'LTR or a portion thereof.

[0397] Eukaryotic promoters usually contain two types of recognition sequences, the TATA box and the upstream promoter element. The TATA box located 25-30 base pairs upstream of the transcription start site is believed to be involved in directing RNA polymerase to start RNA synthesis. Other upstream promoter elements determine the rate of transcription initiation.

[0398] Enhancer elements can stimulate the transcription of connected homologous or heterologous promoters up to 1,000 times. Enhancers are active when located downstream or upstream of the transcription start site. Many enhancer elements derived from viruses have a wide host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for a variety of cell types. Other enhancer / promoter combinations suitable for some embodiments of the present invention include those derived from polyomavirus, human or mouse cytomegalovirus (CMV), and long terminal repeats from a variety of retroviruses (e.g., murine leukemia virus, mouse or Rous sarcoma virus, and HIV). See Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, NY 1983, which is incorporated herein by reference.

[0399] In the construction of the expression vector, preferably, the distance between the promoter and the heterologous transcription start site is approximately the same as the distance between the promoter and the transcription start site in its natural environment. However, as known in the art, some changes in this distance can be accommodated without loss of promoter function.

[0400] In order to improve the efficiency of mRNA translation, polyadenylation sequences can also be added to the expression vector. Accurate and efficient polyadenylation requires two different sequence elements: a GU or U-rich sequence located downstream of the polyadenylation site and a highly conserved hexanucleotide sequence AAUAAA located 11-30 nucleotides upstream. Termination and polyadenylation signals suitable for use in some embodiments of the present invention include those derived from SV40.

[0401] In addition to the elements already described, the expression vectors of some embodiments of the present invention may generally contain other specialized elements intended to increase the expression level of cloned nucleic acids or to promote recognition of cells carrying recombinant DNA. For example, many animal viruses contain DNA sequences that promote extrachromosomal replication of the viral genome in permissive cell types. Plasmids carrying these viral replicons will replicate episomally as long as the genes carried on the plasmid or the host cell genome provide appropriate factors.

[0402] The vector may include or not include a eukaryotic replicon. If there is a eukaryotic replicon, the vector can be amplified in a eukaryotic cell using an appropriate selection marker. If the vector does not include a eukaryotic replicon, free amplification (episomal amplification) is not possible. On the contrary, the recombinant DNA is integrated into the genome of the engineered cell, wherein the promoter directs the expression of the desired nucleic acid.

[0403] The expression vectors of some embodiments of the invention may also include additional polynucleotide sequences, for example, to allow translation of multiple proteins from a single mRNA, such as an internal ribosome entry site (IRES) and sequences for genomic integration of promoter chimeric polypeptides.

[0404] It should be understood that the various elements contained in the expression vector can be arranged in a variety of configurations. For example, enhancer elements, promoters, etc., and even the polynucleotide sequence encoding the target protein can be arranged in a "head-to-tail" configuration, can exist as an inverted complementary sequence, or in a complementary configuration, as an antiparallel strand. Although such configuration diversity is more likely to occur in the non-coding elements of the expression vector, alternative configurations of the coding sequence within the expression vector can also be envisioned.

[0405] According to specific embodiments, the expression construct includes a tag for imaging in cells, such as a fluorescent tag.

[0406] Examples of mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1 (+ / -), pGL3, pZeoSV2 (+ / -), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41, pNMT81 (available from Invitrogen), pCI (available from Promega), pMbac, pPbac, pBK-RSV and pBK-CMV (available from Strategene), pTRES (available from Clontech), and derivatives thereof.

[0407] Expression vectors containing regulatory elements from eukaryotic viruses (e.g., retroviruses) can also be used. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pBV-1MTHA, and vectors derived from Epstein Bar virus include pHEBO and p2O5. Other exemplary vectors include pMSG, pAV009 / A + 、pMTO10 / A + , pMAMneo-5, baculovirus pDSVE and any other vector that allows expression of proteins under the direction of the SV-40 early promoter, the SV-40 late promoter, the metallothionein promoter, the mouse mammary tumor virus promoter, the Rous sarcoma virus promoter, the polyhedrin promoter or other promoters that are effectively expressed in eukaryotic cells.

[0408] As mentioned above, viruses are very special infectious pathogens, and in many cases, they have evolved to evade the host's defense mechanisms. Typically, viruses infect and propagate in specific cell types. The targeting specificity of viral vectors utilizes their natural specificity to specifically target a predetermined cell type, thereby introducing recombinant genes into infected cells. Therefore, the type of vector used in some embodiments of the present invention will depend on the cell type being transformed. The ability to select a suitable vector according to the cell type being transformed is fully within the capabilities of ordinary technicians, so a general description of selection considerations is not provided herein.

[0409] A variety of methods can be used to introduce the polynucleotides or polypeptides of some embodiments of the invention into cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4(6):504-512, 1986], and include, for example, stable or transient transfection, lipofection, electroporation, nucleofection, microinjection, and infection with recombinant viral vectors. Additionally, see US Pat. Nos. 5,464,764 and 5,487,992 for positive and negative selection methods. Currently preferred in vivo nucleic acid transfer techniques include transfection with viral or non-viral constructs, such as adenovirus, lentivirus, herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.

[0410] According to a specific embodiment, the introduction is performed by transient transfection.

[0411] Naked DNA or RNA, cell penetrating peptides or viral and non-viral vectors (such as but not limited to liposomes, nanoparticles, mammalian vectors, etc.) can be used as delivery vehicles to deliver polynucleotides or polypeptides, as known in the art. According to a specific embodiment of the present invention, the delivery system used is biocompatible and non-toxic.

[0412] The following are exemplary embodiments suitable for enhancing penetration of exogenous polynucleotides or polypeptides into cells.

[0413] According to an exemplary embodiment, naked DNA or RNA [e.g., naked plasmid DNA (pDNA)] is a non-viral vector that can be produced in bacteria and manipulated using standard recombinant DNA techniques. It does not induce an antibody response against itself (i.e., does not produce anti-DNA or RNA antibodies), and can achieve long-term gene expression even without chromosomal integration. Naked DNA or RNA can be introduced in a variety of ways, such as, but not limited to, intravascular and electroporation techniques [Wolff JA, Budker V, 2005, Adv. Genet. 54: 3-20], or by jet injection [Walther W, et al., 2004, Mol. Biotechnol. 28: 121-8].

[0414] According to another exemplary embodiment, a mammalian vector is used, as further described above.

[0415] According to a specific embodiment, the polynucleotide is included in a viral vector. Introducing nucleic acid by viral infection has multiple advantages over other methods such as lipofection and electroporation, because due to the infectious nature of the virus, a higher transfection efficiency can be obtained. The viral vector can be a virus with a DNA-based genome or a virus with an RNA-based genome (i.e., positive single-stranded and negative single-stranded RNA virus). The example of a viral vector includes but is not limited to slow virus, adenovirus and retrovirus.

[0416] Viral constructs (e.g., retroviral constructs) include at least one transcriptional promoter / enhancer or locus definition element, or other elements that control gene expression by other means (e.g., alternative splicing, nuclear RNA export, or post-translational modification of messenger). Such vector constructs also include packaging signals, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites suitable for the virus used, unless they are already present in the viral construct. Schemes for producing recombinant retroviruses and infecting cells with such viruses in vitro or in vivo can be found in, for example, Ausubel et al., [eds, Current Protocols in Molecular Biology, Greene Publishing Associates, (1989)]. Other suitable expression vectors can be adenovirus, slow virus, herpes simplex I virus, or adeno-associated virus (AAV).

[0417] Regulatory elements that restrict expression to specific cell types may also be included. Such features include, for example, promoters and regulatory elements that are specific for the desired cell type.

[0418] According to specific embodiments, expressing comprises introducing the polypeptide of interest (eg, factor) into a cell.

[0419] According to specific embodiments, the polypeptide is provided in a formulation suitable for cell penetration, thereby enhancing intracellular delivery of the polypeptide, as further described below.

[0420] Cell penetrating peptides (CPPs) are short peptides (≤40 amino acids) that can enter the interior of almost any cell. They are highly cationic and are generally rich in arginine and lysine amino acids. They have the special property of bringing a variety of covalently and non-covalently bound substances (e.g., proteins, oligonucleotides, and even 200 nm liposomes) into cells. Therefore, according to another exemplary embodiment, CPPs can be used to transport polynucleotides or polypeptides to the interior of cells.

[0421] TAT (transcription activator from HIV-1), pAntp (also known as penetratin, Drosophila Antennapedia homeodomain transcription factor) and VP22 (from herpes simplex virus) are examples of CPPs that can enter cells in a non-toxic and efficient manner and may be suitable for use in some embodiments of the present invention. Protocols for producing CPP-cargo conjugates and infecting cells with such conjugates can be found, for example, L Theodore et al. [The Journal of Neuroscience, (1995) 15 (11): 7158-7167], Fawell S, et al. [Proc Natl Acad Sci USA, (1994) 91: 664–668], and Jing Bian et al. [Circulation Research. (2007) 100: 1626-1633].

[0422] The expression level and / or activity level of the exogenous polynucleotides and / or polypeptides expressed in the cells of some embodiments of the present invention can be determined using methods known in the art, such as but not limited to Northern blot analysis, PCR analysis, Western blot analysis, immunohistochemistry and fluorescence activated cell sorting (FACS).

[0423] As previously mentioned, according to specific embodiments, the expression of the exogenous factor is transient.

[0424] According to a specific embodiment, induction of transient expression begins within 14 days to 0 hours prior to mixing.

[0425] According to a specific embodiment, induction of transient expression begins within 13 days - 0 hours before mixing, within 12 days - 0 hours before mixing, within 11 days - 0 hours before mixing, within 10 days - 0 hours before mixing, within 9 days - 0 hours before mixing, within 8 days - 0 hours before mixing, within 7 days - 0 hours before mixing, within 6 days - 0 hours before mixing, within 5 days - 0 hours before mixing, within 120 hours - 0 hours before mixing, within 100 hours - 0 hours before mixing, within 80 hours - 0 hours before mixing, within 60 hours - 0 hours before mixing, within 48 hours - 0 hours before mixing, within 36 hours - 0 hours before mixing, within 24 hours - 0 hours before mixing, or within 12 hours - 0 hours before mixing, and each possibility represents a separate embodiment of the present invention.

[0426] According to a specific embodiment, induction of transient expression begins within 120 hours to 0 hours before mixing.

[0427] According to a specific embodiment, induction of transient expression begins within 48 hours to 0 hours before mixing.

[0428] According to a specific embodiment, induction of transient expression begins within 42 hours to 0 hours before mixing.

[0429] According to a specific embodiment, induction of transient expression begins no later than 48, 24 or 12 hours before mixing.

[0430] According to specific embodiments, induction of transient expression begins within 14 days to 1 day before mixing, within 13 days to 1 day before mixing, within 12 days to 1 day before mixing, within 11 days to 1 day before mixing, within 10 days to 1 day before mixing, within 9 days to 1 day before mixing, within 8 days to 1 day before mixing, within 7 days to 1 day before mixing, within 6 days to 1 day before mixing, within 5 days to 1 day before mixing, within 120 hours to 20 hours before mixing, within 100 hours to 20 hours before mixing, within 80 hours to 20 hours before mixing, within 60 hours to 1 hour before mixing, or within 48 hours to 20 hours before mixing, each possibility representing a separate embodiment of the present invention.

[0431] According to a specific embodiment, induction of transient expression begins within 14 days to 12 hours before mixing, within 13 days to 12 hours before mixing, within 12 days to 12 hours before mixing, within 11 days to 12 hours before mixing, within 10 days to 12 hours before mixing, within 9 days to 12 hours before mixing, within 8 days to 12 hours before mixing, within 7 days to 12 hours before mixing, within 6 days to 12 hours before mixing, within 5 days to 12 hours before mixing, within 120 hours to 12 hours before mixing, within 100 hours to 12 hours before mixing, within 80 hours to 12 hours before mixing, within 60 hours to 12 hours before mixing, or within 48 hours to 12 hours before mixing, each possibility representing a separate embodiment of the present invention.

[0432] According to a specific embodiment, induction of transient expression begins within 48 hours to 12 hours prior to mixing.

[0433] According to a specific embodiment, induction of transient expression ends no later than 120 hours after mixing.

[0434] According to specific embodiments, induction of transient expression ends no later than 110 hours, 100 hours, 90 hours, 80 hours, 70 hours, 60 hours, 50 hours, 48 ​​hours, 36 hours, 24 hours, 20 hours or 12 hours after mixing, each possibility representing a separate embodiment of the present invention.

[0435] According to a specific embodiment, induction of transient expression ends no later than 48 hours after mixing.

[0436] According to a specific embodiment, transient expression is induced for no longer than 19 days.

[0437] According to specific embodiments, transient expression is induced for no more than 18 days, 17 days, 16 days, 15 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6 days, or 5 days.

[0438] According to a specific embodiment, transient expression is induced for no longer than 16 days.

[0439] According to a specific embodiment, transient expression is induced for no longer than 96 hours.

[0440] According to a specific embodiment, induction of transient expression begins 24 hours before mixing and continues for 96 hours (ie ends 48 hours after mixing).

[0441] It should be understood that, before mixing, culture conditions suitable for maintaining primitive PSCs and trophectoderm and extraembryonic primitive endoderm initiated cells include various tissue culture medium compositions, feeder cells, oxygen concentrations, culture vessels, etc., and determining which conditions to apply is within the capabilities of those skilled in the art. Such non-limiting examples are described in the following Examples section and in the following documents, which are incorporated herein by reference: Choi, J., Huebner, A., Clement, K. et al. Nature 548, 219–223 (2017); Yang et al. Cell (2017) 169(2): 243-257, www(dot)cell(dot)com / fulltext / S0092-8674%2817%2930183-6; www(dot)doi(dot)org / 10.1038 / nature23274; www(dot)doi(dot)org / 10.1242 / dev.180620; DOI: 10.1126 / science.aay3325; DOI: 10.1016 / j.stem.2017.11.004; Shingo Io et al. al. (2021) Cell Stem Cell, 28(6): 1023-1039 and Mitsuyoshi Amita et al. (2013) PNAS E1212-1221; and international patent application publication numbers WO2016 / 016894 and WO2014 / 174470, the contents of which are incorporated herein by reference in their entirety.

[0442] According to a specific embodiment, the culture medium comprises a STAT3 activator.

[0443] The term "STAT3" used herein refers to signal transduction and transcription activator 3 gene product (acute phase response factor) (gene ID 6774). In response to cytokines and growth factors, STAT family members are phosphorylated by receptor-associated kinases, then form homodimers or heterodimers, and transfer to the nucleus, where they act as transcription activators. Known STAT3 activators include but are not limited to interferon (IFN), epidermal growth factor (EGF), interleukin 5 (IL5), interleukin 6 (IL6), hepatocyte growth factor (HGF), leukemia inhibitory factor (LIF) and bone morphogenetic protein 2 (BMP2).

[0444] According to some embodiments of the invention, the STAT3 activating factor used in the culture medium of some embodiments of the invention is selected from the group consisting of LIF, IL6 and EGF.

[0445] According to some embodiments of the invention, the STAT3 activating factor used in the culture medium of some embodiments of the invention is selected from the group consisting of LIF and IL6.

[0446] According to some embodiments of the invention, the STAT3 activating factor used in the culture medium of some embodiments of the invention is LIF.

[0447] The term "leukemia inhibitory factor (LIF)" as used herein refers to polynucleotides and expression products, such as polypeptides, of the LIF gene (e.g., human gene ID NO: 3976). The following GenBank accession number NP_001244064 (SEQ ID NO: 124) provides a non-limiting example of a human LIF polypeptide. Preferably, the LIF used in the method according to some embodiments of the present invention is capable of supporting the undifferentiated growth of naive PSCs together with other factors while maintaining their pluripotency. LIF is available from multiple manufacturers, such as Millipore, Peprotech, and R&D systems. According to a specific embodiment, the culture medium comprises a GSK-3 inhibitor.

[0448] According to a specific embodiment, the culture medium comprises an ERK1 / 2 inhibitor.

[0449] The term "ERK1" as used herein refers to mitogen-activated protein kinase 3 (MAPK3) isoform 1 having MAPK signaling activity, such as that shown in GenBank Accession No. NP_002737 (SEQ ID NO: 125), MAPK3 isoform 2, such as that shown in GenBank Accession No. NP_001035145 (SEQ ID NO: 126), MAPK3 isoform 3, such as that shown in GenBank Accession No. NP_001103361 (SEQ ID NO: 127), and / or ERK1 shown in GenBank Accession No. M84490 (SEQ ID NO: 128) and having MAPK signaling activity.

[0450] As used herein, the term "ERK2" refers to mitogen-activated protein kinase 1 (MAPK1) having MAPK signaling activity, such as that shown in GenBank Accession No. NP_002736 (SEQ ID NO: 129) and / or that shown in GenBank Accession No. NP_620407 (SEQ ID NO: 130).

[0451] As used herein, the term "ERK1 / 2 inhibitor" refers to any molecule capable of inhibiting ERK1 / 2 activity as determined by Western blot detection of phosphorylated ERK1 / 2 protein.

[0452] Non-limiting examples of ERK1 / 2 inhibitors (also known as MEK1 / 2 inhibitors) include PD0325901 (AXONMEDCHEM - AXON 1408), PD98059 (AXONMEDCHEM - Axon 1223), and PD184352 (AXONMEDCHEM - AXON 1368).

[0453] According to specific embodiments, the culture medium comprises at least one of a GSK-3 inhibitor, a WNT ligand, heparin, FGF2, FGF4, PDGF, leukemia inhibitory factor (LIF), and insulin.

[0454] According to a specific embodiment, the culture medium comprises at least one of a GSK-3 inhibitor, leukemia inhibitory factor (LIF) and insulin.

[0455] According to specific embodiments, the culture medium comprises at least one of a GSK-3 inhibitor, heparin, FGF4, PDGF and BSA.

[0456] According to a specific embodiment, the culture medium does not contain activin A [also known as inhibin beta A, which is a polynucleotide and expression product, such as a polypeptide, of the INHBA gene (corresponding to human gene ID: 3624) or a homolog or ortholog thereof].

[0457] According to a specific embodiment, the culture medium does not contain REPROCELL.

[0458] According to a specific embodiment, the culture medium contains at least one of a TGFR inhibitor, a FGFR inhibitor, a MEK / ERK inhibitor, BMP4, a JAK inhibitor, FGF4, FGF2, heparin, a SUMOylation inhibitor, a histone deacetylase inhibitor, a HIPPO signaling pathway inhibitor, and a factor that induces YAP nuclear translocation.

[0459] According to a specific embodiment, for pre-induction of TSC-primed cells, the following components can be used together or alone as useful supplements: TGFRi A-83, LIF, HIPPO inhibitor LPA, ROCK inhibitor Y27632, MEK / ERK inhibitor PD0325901, EGF, JAKi.

[0460] Additional descriptions of culture media and supplements useful in specific embodiments of the invention are provided below.

[0461] According to specific embodiments, subpopulations of cells are mixed together under conditions that allow for the formation of aggregated cells.

[0462] These conditions may include culture time, culture container, medium composition, oxygen concentration, cell amount and ratio, etc. It is entirely within the capabilities of the skilled person to determine such conditions. Non-limiting examples of aggregation schemes that can be used for specific embodiments of the present invention are described in the following Examples section, which is an integral part of this specification.

[0463] According to a specific embodiment, naive PSCs, trophectoderm-initiating cells, and extraembryonic primitive endoderm-initiating cells are mixed simultaneously.

[0464] According to other specific embodiments, naive PSCs, trophectoderm-initiating cells, and extraembryonic primitive endoderm-initiating cells are sequentially mixed.

[0465] Thus, for example, according to a specific embodiment, naive PSCs and extraembryonic primitive endoderm-initiating cells are mixed prior to mixing with trophectoderm-initiating cells. According to a specific embodiment, naive PSCs and trophectoderm-initiating cells are mixed prior to mixing with extraembryonic primitive endoderm-initiating cells.

[0466] According to a specific embodiment, trophectoderm-initiating cells and extraembryonic primitive endoderm-initiating cells are mixed before mixing with naive PSCs.

[0467] Depending on the specific embodiment, the difference in mixing time can be up to 48 hours, up to 40 hours, up to 35 hours, up to 30 hours, up to 24 hours, up to 16 hours or up to 12 hours, each possibility representing a separate embodiment of the present invention.

[0468] According to a specific embodiment, the ratio between naive PSCs and trophectoderm-derived cells is between 1:1 and 1:5.

[0469] According to a specific embodiment, the ratio between naive PSCs and trophectoderm-initiated cells is between 1:3 and 1:4.

[0470] According to a specific embodiment, the ratio between naive PSCs and trophectoderm-initiated cells is about 1:3.3.

[0471] According to specific embodiments, the ratio between naive PSCs and primitive endoderm-derived cells is between 1:1 and 2:1.

[0472] According to specific embodiments, the ratio between naive PSCs and primitive endoderm-derived cells is about 1:1.

[0473] According to a specific embodiment, the aggregation is performed in an aggregation plate. Such plates are known to the person skilled in the art and are commercially available from, for example, STEMCELL Technologies.

[0474] The Examples section below provides non-limiting examples of protocols for culturing naive PSCs, inducing trophectoderm- and primitive endoderm-primed cells, and aggregating the three cell types.

[0475] Thus, for example, naive KH2 ESCs containing a nucleic acid sequence encoding Gata4 under the control of a TetOn promoter can be cultured in 2iLif medium and treated with DOX (e.g., 2 μg / ml-Sigma D9891) in 2i / Lif for 24 hours before starting the experiment. Gata4 can also be similarly induced in N2B27 medium, MEF medium, TSC medium, or aggregation medium. Naive KH2 ESCs containing a nucleic acid sequence encoding Cdx2 under the control of a TetOn promoter can be cultured in 2i / Lif and treated with DOX (2 μg / ml-Sigma D9891) at different time points (-1 day to -14 days, e.g., 24 hours) in TSC medium (25 ng / ml FGF4 (Peprotech), 1 μg / ml heparin (Sigma)) supplemented or not with 0.5-1 μM of the Hippo pathway inhibitor lysophosphatidic acid (LPA). In this pre-induction step, TGFR and / or ERK inhibitors may also be optionally added. The non-induced ESC fraction undergoes no special pretreatment and is maintained in 2i / Lif conditions or serum LIF conditions. Other naive conditions that can replace 2i / LIF conditions include a2i conditions: using N2B27-supplemented basal medium with GSK3 inhibitor CHIR99021 (final concentration of 3 μM), Lif (final concentration of 20 ng / ml) and SRCI CGP77675 (final concentration of 1 microM). Subsequently, aggregation is performed in AggreWell 24-well plates 400 (STEMCELL Technologies 34415) or AggreWell 24-well plates 800 (STEMCELL Technologies 34815). Non-adherent 96-well shape wells (NUNC or THERMo) can also be used. Preparation of AggreWell plates can be performed according to the manufacturer's instructions; for example: add 500 μl of anti-adhesion wash solution (STEMCELL Technologies 07010) to each well. The plate was centrifuged at 2,000 g for 5 minutes and incubated at room temperature for 30 minutes. After incubation, the rinse solution was removed and the plate was washed twice with PBS. Then, 500 μl of aggregation medium (AM) supplemented with DOX (final concentration of 2 μg / ml-Sigma D9891) and ROCKi Y27632 (final concentration of 5 nM-10 μM-Axon Medchem1683) was added to each well. On the day of aggregation (day 0), the three cell populations can be trypsinized with 0.05% trypsin-EDTA solution (Biological Industries-Sartorius 03-053-1B) at 37°C for 4-6 minutes.The trypsin enzymatic reaction is stopped by adding aggregation medium (AM). TrypleE or Accutase can also be used instead of trypsin. The cells are centrifuged at 1200rpm for 3 minutes and then resuspended in AM containing DOX (2μg / ml-Sigma D9891) and ROCKi Y27632 (final concentration of 5nM-10μM-Axon Medchem 1683). The cells can be seeded on gelatinized tissue culture plates and cultured at 37°C for 20 minutes to consume mouse embryonic fibroblasts. The supernatant is then collected, centrifuged and the cells are resuspended. Three cell fractions are counted and resuspended in AM containing DOX (2μg / ml-Sigma D9891) and ROCKi Y27632 (5nM-Axon Medchem 1683). An exemplary ratio of (1 naive ESC: 1 iGata4 ESC: 3.33 iCdx2 ESC) was maintained in the aggregation experiments, with the following exact cell numbers depending on the aggregation plate used, for example: A) AggreWell 800: number of microwells per well in a 24-well plate = 300; number of cells added per well in a 24-well plate = iCdx2: 5000 cells + iGata4: 1500 cells + naive ESC 1500 cells; number of cells per microwell = ~27 cells. B) AggreWell 400: number of microwells per well in a 24-well plate = 1200; number of cells added per well in a 24-well plate = iCdx2: 20000 cells + iGata4: 6000 cells + naive ESC 6000 cells; number of cells per microwell = ~27 cells.

[0476] As another example, naive PSCs are used to generate the following three cell populations: 1) Naive WT PSC cells cultured in HENSM medium. 2) For the primitive endoderm compartment - Naive WT cells were plated on HENSM supplemented with ROCKi under mouse embryonic fibroblast conditions and then replaced with RCL medium the next day and cultured for 72 hours. 3) For trophectoderm lineage - Naive WT cells were plated on HENSM supplemented with ROCKi under feeder-free conditions and replaced with (B) AP medium the next day for 24 hours, then replaced with AP (J) for another 48 hours.

[0477] All three cell types were supplemented with ROCKi before harvesting so that they could be used for coaggregation the next day. On the day of aggregation (day 0), a 24-well Aggrewell plate 400 (Stemcell technologies) was prepared and pre-filled with 500 μL N2B27 culture medium and kept at 37 ° C to reach culture medium balance. The three cell groups were disaggregated with TrypLE (Thermo Fisher 12604054) at 37 ° C for 3 minutes for WT and primitive endoderm cells and 5 minutes for trophectoderm cells, then the enzyme was removed and the cells were incubated at room temperature for two minutes, and then the cells were collected with PBS. The cells were centrifuged at 1300 rpm for 3 minutes and resuspended in N2B27 ROCKi. Next, the primitive endoderm cells were seeded onto a gelatinized tissue culture plate for 30 minutes of mouse embryonic fibroblast depletion at 37 ° C. The supernatant was collected, all three components were centrifuged separately, and the cells were resuspended in N2B27 culture medium. The three cell fractions were counted and resuspended in N2B27 supplemented with ROCKi. A 1:1:3 (WT:PRE:TE) ratio was maintained in the coaggregates.

[0478] The present invention also contemplates compositions and articles of manufacture comprising the cells and aggregates disclosed herein.

[0479] Therefore, according to one aspect of the present invention, there is provided an article comprising: (i) trophectoderm-initiation cells, wherein the trophectoderm-initiation cells include naive pluripotent stem cells (PSCs), and the naive pluripotent stem cells contain exogenous polynucleotides suitable for transiently expressing factors that induce differentiation into trophectoderm cells; and (ii) Original PSC.

[0480] According to a specific embodiment, the preparation further comprises: (iii) extraembryonic primitive endoderm-initiation cells, wherein the extraembryonic primitive endoderm-initiation cells include primitive pluripotent stem cells (PSCs), and the primitive pluripotent stem cells contain exogenous polynucleotides suitable for transiently expressing factors that induce differentiation into extraembryonic primitive endoderm cells.

[0481] According to an additional or alternative aspect of the present invention, there is provided an article comprising: (i) trophectoderm-initiation cells, wherein the trophectoderm-initiation cells include naive pluripotent stem cells (PSCs), and the naive pluripotent stem cells contain exogenous polynucleotides suitable for transiently expressing factors that induce differentiation into trophectoderm cells; and (ii) extraembryonic primitive endoderm-initiation cells, wherein the extraembryonic primitive endoderm-initiation cells include primitive pluripotent stem cells (PSCs), and the primitive pluripotent stem cells contain exogenous polynucleotides suitable for transiently expressing factors that induce differentiation into extraembryonic primitive endoderm cells.

[0482] According to a specific embodiment, the different cell subpopulations are located in a single container.

[0483] According to other specific embodiments, different cell subpopulations are located in separate containers.

[0484] According to an additional or alternative aspect of the present invention, there is provided a method for culturing synthetic embryos extrauterine, the method comprising mixing cells of the preparation disclosed herein under conditions that allow the formation of aggregated cells, wherein the method comprises inducing transient expression of the factors beginning between 14 days and 0 hours prior to said mixing and ending no later than 120 hours after said mixing, thereby producing synthetic embryos.

[0485] According to an additional or alternative aspect of the present invention, there is provided a mixture or aggregate produced according to or obtainable by a method disclosed herein.

[0486] According to specific embodiments, the mixture or aggregate is not structurally organized as a natural or naturally occurring embryo at any stage of development. According to specific embodiments, the different cells in the mixture or aggregate are randomly dispersed in the aggregate mixture in an unorganized manner. According to specific embodiments, the mixture or aggregate does not form a blastocyst at any stage. According to specific embodiments, the mixture or aggregate does not include a cavity.

[0487] According to specific embodiments, the mixture or aggregate comprises at least 12, at least 16, at least 32, at least 40, at least 50 cells, or at least 64 cells.

[0488] According to specific embodiments, the mixture or aggregate comprises more than 64 cells.

[0489] According to specific embodiments, the mixture or aggregate comprises up to 500 cells, up to 450 cells, up to 400 cells, up to 350 cells, up to 300 cells, up to 250 cells, up to 200 cells, up to 150 cells or up to 100 cells.

[0490] It is understood that during the culture of the mixture or aggregate of unorganized cells, there is a process by which the cells reorganize to form a synthetic embryo having the structure or organization of a natural embryo.

[0491] According to specific embodiments, the mixture or aggregate is capable of forming a synthetic embryo that is structurally organized as a natural embryo at at least the post-implantation egg cylinder or bilayer disc stage of development.

[0492] Thus, according to an additional or alternative aspect of the present invention, there is provided a mixture or aggregate comprising: (i) Naive pluripotent stem cells (PSC); (ii) trophectoderm-initiated cells, wherein the trophectoderm-initiated cells include stem cells expressing endogenous trophectoderm markers and endogenous pluripotency markers; and (iii) extraembryonic primitive endoderm-initiation cells, wherein the extraembryonic primitive endoderm-initiation cells include stem cells expressing endogenous extraembryonic primitive endoderm markers and endogenous pluripotency markers, wherein the mixture or aggregate is not structurally organized as a natural embryo at any stage of development; and Therein, the mixture or aggregate is capable of forming a synthetic embryo that is structurally organized as a natural embryo at at least the post-implantation egg cylinder stage or the bilayer disc stage of development.

[0493] According to a further or alternative aspect of the present invention, there is provided a mixture or aggregate comprising: (i) trophectoderm-initiation cells, wherein the trophectoderm-initiation cells include stem cells expressing exogenous factors inducing differentiation into trophectoderm cells, endogenous trophectoderm markers, and endogenous pluripotency markers; and (ii) Naive pluripotent stem cells (PSCs).

[0494] According to a specific embodiment, the mixture or aggregate further comprises: (iii) extraembryonic primitive endoderm-initiation cells, wherein the extraembryonic primitive endoderm-initiation cells include stem cells expressing exogenous factors inducing differentiation into extraembryonic primitive endoderm cells, endogenous extraembryonic primitive endoderm markers and endogenous pluripotency markers.

[0495] It is to be understood that the mixture or aggregate of some embodiments of the invention comprises a distinct population of stem cells all derived from naive pluripotent stem cells (PSCs).

[0496] According to some embodiments of the invention, the method further comprises allowing the synthetic embryo to grow in vitro (extrauterine) or in vivo (intrauterine).

[0497] Therefore, according to one aspect of the present invention, there is provided a method for ex utero culturing a synthetic embryo, the method comprising ex utero culturing the mixture or aggregate disclosed herein.

[0498] As described in the Examples section that follows, the inventors were able to generate synthetic embryos after gastrulation by utilizing a controlled ex utero embryo culture platform and growth conditions that were previously able to capture gastrulation and ex utero organogenesis in natural mouse embryos (Aguilera-Castrejon et al., 2021a), suggesting that these platforms and growth conditions can be used for ex utero culture of synthetic embryos generated by the methods disclosed herein, as well as any other methods.

[0499] Therefore, according to one aspect of the present invention, a method for extrauterine culture of synthetic embryos is provided, the method comprising extrauterine culture of synthetic embryos in an aggregation stage in a static culture followed by a dynamic culture, wherein the static culture is carried out until the embryos reach at least the early post-implantation egg cylinder or double-layer disc development stage; and the dynamic culture begins at the latest when the embryos reach the early somite stage.

[0500] According to specific embodiments, the method further comprises determining the development of the embryo before, during and / or after the culture.Methods for assessing development are well known in the art and are described in further detail herein.

[0501] As used herein, the term "culturing a synthetic embryo" refers to at least one synthetic embryo and culture medium in an in vitro or ex vivo (outside the womb) environment. The culture is maintained under conditions (or a set of conditions) that can induce the development and growth of the synthetic embryo. Such conditions include, for example, an appropriate temperature (e.g., 37° C.), an atmosphere (e.g., 0 2 %、CO 2 %), pressure, pH, light, culture medium, supplements, etc.

[0502] The culture can be in glass, plastic or metal containers, which can provide a sterile environment for the culture. According to a specific embodiment, the culture container includes a culture dish, a culture plate, a flask, a bottle, a vial, a bag, a bioreactor or any device that can be used to culture cells.

[0503] According to a specific embodiment, the culture is maintained under sterile conditions.

[0504] According to a specific embodiment, the culture is maintained at 37°C-38°C.

[0505] According to a specific embodiment, the culture is maintained at 38°C.

[0506] According to a specific embodiment, the culture is maintained at 37°C.

[0507] Since temperature changes can affect embryonic development, according to a specific embodiment, care should be taken not to keep the embryos at temperatures above 38° C. and below 35° C. for a long time. Thus, for example, opening the incubator or keeping the embryos at room temperature for a long time should be avoided.

[0508] According to a specific embodiment, the cultivation is a static cultivation.

[0509] According to other specific embodiments, the culture is a dynamic culture.

[0510] According to a specific embodiment, the culturing is a static culturing and then a dynamic culturing.

[0511] As used herein, the term "static culture" refers to cell culture performed without agitation of the culture.

[0512] According to a specific embodiment, static culture is performed for 3-4 days.

[0513] According to a specific embodiment, the static culture is performed for about 3 days.

[0514] Embryonic stage and development can be assessed by a variety of methods well known in the art, including but not limited to morphology, length, weight, expression of developmental marker genes using specific antibodies or primers, transcriptional analysis, etc., compared to in vivo embryonic counterparts at the same developmental stage, as further described in the subsequent Examples section which is part of this specification.

[0515] As used herein, the terms "embryonic day (E)", "post-fertilization day (PFD)" or "gestational day (GD)" refer to an embryo having the developmental characteristics of its in vivo (intra-fallopian tube or intra-uterine, depending on the date) embryo counterpart on a specific day after fertilization or mating, where E0 / PFD0 / GD0 is considered a fertilized egg.

[0516] According to a specific embodiment, static culturing is performed for 2 to 5 days.

[0517] According to a specific embodiment, the static culture is performed for about 4 days.

[0518] According to a specific embodiment, static culture is performed for 10 to 20 days.

[0519] According to a specific embodiment, the static culture is carried out for about 12 days.

[0520] According to a specific embodiment, the static culture ends at the latest when the synthetic embryo reaches the egg cylinder stage (eg, for mouse) or the two-layer disc stage (eg, for human).

[0521] As used herein, the term "egg cylinder stage" refers to the synthetic embryo after (not including) the blastula stage and before the post-gastrulation stage, which is characterized by the expansion of the yolk sac around the embryo, the completion of gastrulation, and the emergence of somites.

[0522] According to a specific embodiment, the egg cylinder stage refers to a synthetic embryo having characteristics of an intrauterine natural mouse embryo E5-7.

[0523] As used herein, the term "double-layer disc stage" refers to the synthetic embryo after the blastocyst stage (excluding the blastocyst stage) and before the 15th day stage (Carnegie stage 6), which is characterized by two cell discs that bulge dorsally, one disc formed by a thick pseudostratified columnar cell layer (called epiblast), and the other disc formed by a thin cuboidal cell layer (called hypoblast). The disc-shaped epiblast is slightly bulged dorsally and is separated from the amnion by the amniotic cavity in the middle of the embryonic disc.

[0524] According to a specific embodiment, the two-layer disc stage refers to a synthetic embryo having the PFD8-14 characteristics of an intrauterine natural human embryo.

[0525] According to a specific embodiment, to prevent the embryonic epiblast and yolk sac from adhering to the culture vessel during static culture, the culture is checked to ensure that only the outer placental cone remains attached to the surface of the culture plate. According to a specific embodiment, when necessary, the embryo is carefully pushed off the surface of the culture plate using, for example, forceps.

[0526] As used herein, the term "dynamic culture" refers to cell culture performed while the culture is agitated (e.g., rolled, shaken, inverted). To reiterate, in dynamic culture, the entire culture (including the embryo) is agitated. Non-limiting examples of dynamic culture include roller culture (culture on a rolling device), shaker culture (culture on a shaker, such as an orbital shaker).

[0527] According to a specific embodiment, the dynamic culture is a roller culture.

[0528] According to a specific embodiment, the roller culture is rolled at 30 rpm.

[0529] Rotating culture apparatus are commercially available from, for example, BTC Engineering, - Cullum Starr Precision Engineering Ltd - UK, but can be further modified and adapted.

[0530] According to other specific embodiments, the dynamic culture is a shaking culture.

[0531] According to specific embodiments, the shaker rotates at 30 to 80 rpm, 40 to 70 rpm, 50 to 70 rpm, or 55 to 65 rpm.

[0532] According to a specific embodiment, the shaker rotates at about 60 rpm.

[0533] According to a specific embodiment, the dynamic culture comprises shaking culture, roller culture or a sequential combination thereof.

[0534] According to a specific embodiment, dynamic culture begins when the embryos reach the pre-gastrulation stage.

[0535] The term "pre-gastrulation" as used herein refers to the synthetic embryo after the egg cylinder stage or the two-layer disc stage and before the early gastrulation stage, which is characterized by the presence of OCT4 and OTX2+ epiblast, pre-amniotic cavity formation and ectodermal extraembryony (ExE).

[0536] According to a specific embodiment, the pre-gastrulation stage refers to a synthetic embryo having characteristics of E5-6 of an intrauterine natural mouse embryo or PFD8-14 of an intrauterine natural human embryo.

[0537] According to a specific embodiment, the dynamic culture starts with shaking culture (eg, 1-4 days) followed by roller culture.

[0538] According to a specific embodiment, roller culture is initiated when the embryos reach at least the early gastrulation stage.

[0539] The term "early gastrulation" as used herein refers to the synthetic embryo after the pre-gastrusion stage and before the late gastrulation stage, which is characterized by, for example, an oval cylinder shape with the primitive streak located on the posterior side in mice and a double-layered disc cylinder shape with the primitive streak located on the posterior side in humans.

[0540] According to a specific embodiment, the early gastrulation stage refers to a synthetic embryo having characteristics of E6-7 of an intrauterine natural mouse embryo or PFD12-18 of an intrauterine natural human embryo.

[0541] According to a specific embodiment, roller culture is started at the latest when the embryos reach the early somite stage.

[0542] According to a specific embodiment, dynamic culturing begins at the latest when the embryos reach the early somite stage.

[0543] As used herein, the term "early somite" refers to the synthetic embryo after the late gastrulation stage and before the neural tube closure stage, which is characterized by the appearance of somites and the formation of the first organs.

[0544] According to a specific embodiment, the early somite stage refers to a synthetic embryo having the characteristics of E8-9 of an intrauterine natural mouse embryo or PFD18-24 of an intrauterine natural human embryo.

[0545] As used herein, the phrase "basal medium" refers to a liquid substance used to support the growth / survival of stem cells and / or synthetic embryos and optionally induce their development.

[0546] The culture medium (cell or embryo culture medium, aggregation medium, etc.) used according to some embodiments of the present invention can be an aqueous-based culture medium that contains a combination of substances such as salts, nutrients, minerals, vitamins, amino acids, nucleic acids and / or proteins (e.g., cytokines, growth factors and hormones), all of which are necessary for cell growth and embryonic development.

[0547] Preferably, all components contained in the culture medium of the present invention are substantially pure, ie, tissue culture grade.

[0548] For example, the culture medium may include a basal medium, such as a synthetic tissue culture medium, such as DMEM, DMEM / F12, or Advanced DMEM / F12 (which may be obtained from, e.g., or Biological Industries), Neurobasal (Invitrogen 21103-049 or ThermoFisher 21103049); KO-DMEM (available from, e.g. Commercially available), CMRL (available from e.g. commercially available), TCM199 (commercially available from, for example, Sigma), (commercially available from, for example, ThermoFisher Scientific), RPMI (commercially available from, for example, Biological Industries), or combinations thereof supplemented with necessary additives, as further described herein.

[0549] Non-limiting examples of culture media that can be used for specific embodiments and specific stages of the disclosed methods are described in detail in the Examples section that follows, and in, for example, International Patent Application Publication Nos. WO2016 / 016894 and WO2014 / 174470, the contents of which are incorporated herein by reference in their entireties.

[0550] In addition, since the inventors have identified a novel culture medium containing specific factors that can be used for the production of trophectoderm and extraembryonic primitive endoderm initiating cells and the development of synthetic embryos (see the subsequent Examples section), the present invention also contemplates aspects related to the culture medium described in the subsequent Examples section, wherein the components of the culture medium are provided at concentrations of ±20%.

[0551] According to a specific embodiment, the basal medium does not contain phenol red.

[0552] According to a specific embodiment, the basal medium comprises DMEM with the same composition as Cat.No.11880.

[0553] According to a specific embodiment, the basal medium comprises DMEM / F12 with the same composition as Cat.No.12634-010.

[0554] According to a specific embodiment, the basal medium comprises CMRL of Cat.No.11530037. CMRL of the same composition.

[0555] According to a specific embodiment, the basal medium comprises TCM199 having the same composition as TCM199 of Sigma Cat. No. M4530.

[0556] According to a specific embodiment, the culture medium comprises serum or a serum replacement.

[0557] According to specific embodiments, the culture medium comprises 10-80%, 15-80%, 20-80%, 15-75% or 20-75% [volume / volume (v / v)] serum or serum replacement.

[0558] According to specific embodiments, the culture medium comprises 15%-60%, 15%-40% or 15%-30% (v / v) serum or serum replacement.

[0559] According to specific embodiments, the culture medium comprises 20%-40% or 20%-30% (v / v) serum or serum replacement.

[0560] According to other specific embodiments, the culture medium comprises at least 20% (v / v) serum or serum replacement.

[0561] According to specific embodiments, the culture medium comprises about 20% (v / v) serum or serum replacement.

[0562] According to specific embodiments, the culture medium comprises about 30% (v / v) serum or serum replacement.

[0563] According to other specific embodiments, the culture medium comprises at least 30% (v / v) serum or serum replacement.

[0564] According to other specific embodiments, the culture medium comprises at least 35% (v / v), at least 40% (v / v), at least 45% (v / v), at least 50% (v / v), at least 55% (v / v), at least 60% (v / v), at least 65% (v / v), at least 70% (v / v) serum or serum replacement.

[0565] According to other specific embodiments, the culture medium comprises 40%-80%, 50%-80%, 60%-80%, 70%-80% (v / v) serum or serum replacement.

[0566] According to other specific embodiments, the culture medium comprises 70%-80% (v / v) serum or serum replacement.

[0567] According to specific embodiments, the culture medium comprises about 75% (v / v) serum or serum replacement.

[0568] According to a specific embodiment, the culture medium comprises increasing concentrations of serum or serum replacement throughout the embryo culture process.

[0569] According to specific embodiments, the culture medium comprises at least 15% serum or serum replacement from the beginning until the embryo reaches the early post-implantation egg cylinder stage or the bilayer disc stage, and at least 30% serum or serum replacement thereafter.

[0570] Serum can be obtained from rodents (eg, rats, mice) or mammals (eg, cows, humans).

[0571] According to a specific embodiment, care is taken that the serum (eg, human serum) does not contain any traces of hemolysis.

[0572] According to a specific embodiment, the serum is obtained from an adult animal.

[0573] According to other specific embodiments, the serum is obtained from a fetal animal.

[0574] According to a specific embodiment, the serum comprises cord blood serum.Methods for obtaining cord blood serum (eg, human cord blood serum) are well known in the art and are further described in the Examples section that follows.

[0575] According to specific embodiments, the serum comprises calf serum (eg, FCS).

[0576] According to specific embodiments, the serum comprises rat serum.

[0577] According to specific embodiments, the serum comprises human serum.

[0578] According to a specific embodiment, the serum comprises at least in part cultured human serum.

[0579] According to specific embodiments, the human serum comprises umbilical cord serum (HCS).

[0580] According to other specific embodiments, the human serum comprises human adult serum (HBS).

[0581] According to specific embodiments, the serum includes rat serum and human serum.

[0582] According to a specific embodiment, the ratio of rat serum to human serum in the culture medium is between 1:1-5:1 (v / v).

[0583] According to a specific embodiment, the ratio of rat serum to human serum in the culture medium is between 1:1-3:1 (v / v).

[0584] According to a specific embodiment, the ratio of rat serum to human serum in the culture medium is about 2:1 (v / v).

[0585] According to a specific embodiment, the ratio of rat serum to human serum in the culture medium is 2:1 (v / v).

[0586] In some embodiments, optionally, the culture medium contains knockout serum replacement (KSR) instead of animal serum.

[0587] In some embodiments, optionally, the culture medium contains a knockout serum replacement (KSR), such as rat serum and human serum, in addition to animal serum.

[0588] In some embodiments, optionally, KSR partially replaces the amount of one of human serum, rat serum, or both.

[0589] According to specific embodiments, the ratio between serum and basal medium in the culture medium is 1:0.5-10:1, 1:1-10:1 or 1:1-8:1 (v / v).

[0590] According to a specific embodiment, the ratio between serum and basal medium in the culture medium is 1:1-5:1 (v / v).

[0591] According to a specific embodiment, the ratio between serum and basal medium in the culture medium is about 3:1 (v / v).

[0592] According to a specific embodiment, the ratio of serum to basal medium in the culture medium is 3:1 (v / v).

[0593] According to a specific embodiment, the culture medium comprises 20%-30% basal medium, 40%-60% rat serum and 20%-30% human serum (v / v).

[0594] According to a specific embodiment, the culture medium comprises 25% basal medium, 50% rat serum and 25% human serum (v / v).

[0595] According to a specific embodiment, the serum is heat inactivated (eg, at 55°C for 30-45 minutes).

[0596] According to a specific embodiment, serum is added to the culture medium before use.

[0597] According to some embodiments of the present invention, the culture medium may also include additional supplements, including but not limited to antibiotics (e.g., PEN-STREP), L-glutamine (e.g., GlutaMAX TM ), sodium pyruvate, non-essential amino acids (NEAA), insulin-transferrin-seleno-ethanolamine (ITS-X), β-estradiol, progesterone, N-acetyl L-cysteine, 3,3',5-triiodo-L-thyronine sodium salt (T3), sodium lactate, glucose, serum replacement, and / or HEPES.

[0598] According to some embodiments of the invention, the culture medium comprises N2 and B27.

[0599] According to a specific embodiment, the culture medium comprises glucose.

[0600] According to specific embodiments, the culture medium comprises at least 1 mg / ml, at least 2 mg / ml, at least 3 mg / ml or at least 4 mg / ml glucose.

[0601] According to specific embodiments, the culture medium comprises at least 4 mg / ml, at least 5 mg / ml, at least 6 mg / ml, at least 7 mg / ml or at least 8 mg / ml glucose.

[0602] According to specific embodiments, the culture medium comprises 2 mg / ml-12 mg / ml glucose, 3 mg / ml-12 mg / ml glucose, 4 mg / ml-12 mg / ml glucose or 4 mg / ml-8 mg / ml glucose.

[0603] According to a specific embodiment, glucose is provided in the culture medium at a constant or increasing concentration throughout the cultivation process.

[0604] Thus, according to specific embodiments, the concentration of glucose provided in the culture medium does not decrease throughout the culturing process (eg, when transitioning from one set of conditions to the next set of conditions).

[0605] According to a specific embodiment, the culture medium does not contain

[0606] According to specific embodiments, the conditions include replacing at least half of the culture medium every 1-2 days of culture (eg, in static culture).

[0607] According to a specific embodiment, the conditions include replacement of all culture medium every 1-2 days of culture (eg, in a dynamic culture).

[0608] According to a specific embodiment, the culture is maintained under high pressure.

[0609] According to a specific embodiment, the dynamic culture is maintained under high pressure.

[0610] According to a specific embodiment, the roller culture is maintained under high pressure.

[0611] As used herein, the term "high pressure" refers to pressure greater than atmospheric pressure, where atmospheric pressure is generally considered to be 14.7 pounds per square inch (psi). Therefore, when a specific high pressure is indicated herein, it refers to the indicated pressure above atmospheric pressure, not the indicated value itself. For example, a high pressure of 5 psi refers to a pressure of 19.7 psi, a high pressure of 6.5 psi refers to a pressure of 21.2 psi, and a high pressure of 10.2 psi refers to a pressure of 24.7 psi.

[0612] According to specific embodiments, the high pressure is greater than 2.5 psi, greater than 4 psi, greater than 5 psi, greater than 6 psi.

[0613] According to specific embodiments, the high pressure is greater than 5 psi.

[0614] According to specific embodiments, the high pressure is less than 10.2 psi, less than 9 psi, less than 8 psi, less than 7 psi.

[0615] According to specific embodiments, the high pressure is less than 10.2 psi.

[0616] According to a specific embodiment, the high pressure is greater than 5 psi and less than 10.2 psi.

[0617] According to a specific embodiment, the high pressure is between 6 psi and 7 psi.

[0618] According to a specific embodiment, the high pressure is 6.5 psi.

[0619] According to a specific embodiment, the high pressure is between 0.1 psi and 0.5 psi.

[0620] According to other specific embodiments, the culture is maintained at atmospheric pressure.

[0621] According to a specific embodiment, the static culture is maintained at atmospheric pressure.

[0622] According to a specific embodiment, in a solution comprising a controlled level of O 2 、N 2 and / or CO 2 The cultures were maintained in an atmosphere of .

[0623] According to a specific embodiment, the culture medium contains 5% CO 2 atmosphere.

[0624] According to a specific embodiment, the cultivation is carried out in an atmosphere comprising 5% to 40% oxygen.

[0625] According to a specific embodiment, the culturing is carried out in an atmosphere comprising 5% to 30%, 5% to 25% or 5% to 21% oxygen.

[0626] According to a specific embodiment, the culturing is carried out in an atmosphere comprising 10% to 40%, 10% to 30% or 15% to 30% oxygen.

[0627] According to a specific embodiment, the cultivation is carried out in an atmosphere comprising 15% to 30% oxygen.

[0628] According to a specific embodiment, the cultivation is carried out in an atmosphere comprising 18% to 23% oxygen.

[0629] According to a specific embodiment, the cultivation is performed in an atmosphere comprising a constant or increasing oxygen concentration during the cultivation.

[0630] Thus, according to specific embodiments, oxygen concentration does not decrease throughout the culturing process (eg, when transitioning from one set of conditions to the next).

[0631] According to a specific embodiment, in order to control the pressure and oxygen level in culture, the following fetal incubation system is used, which includes gas and pressure controllers and static and / or rotating incubators. Exemplary Fetal Incubation System

[0632] Reference now Fig.44A , which shows a schematic diagram of a fetal incubation system according to some embodiments of the present invention. In some embodiments, the system includes a gas and pressure controller 502, one or more gas sources 504, 505 and 506 (in Fig.44A The carbon dioxide (CO 2 )506, oxygen (O 2 )505 and nitrogen (N 2 ) 504 tank), gas mixing box 508 and incubator 510. In some embodiments, the gas from gas sources 504, 505, 506 is delivered to the gas and pressure controller 502, which delivers the gas to the gas mixing box 508. In some embodiments, once the gas mixture reaches the desired concentration, the gas returns to the gas and pressure controller 502 and is then controlled to be delivered to the incubator 510. In some embodiments, the incubator 510 optionally includes an internal rotating incubator module configured to accommodate one or more vials for storing embryos. In some embodiments, the mixed gas is delivered to the internal rotating incubator module, where the gas is evenly delivered to each vial (see below for more information).

[0633] Fig.44BAn image of an exemplary fetal incubation system is shown, the system including a gas and pressure controller 502, a gas mixing box 508, and an incubator 510, according to some embodiments of the present invention.

[0634] Fig.44C Schematic general representation of an exemplary configuration of the principles of the electronic module for gas (gas and pressure controller 502 and gas mixing box 508) and pressure regulation. 2 , O 2 and / or CO 2 The gas is then injected into a water bottle inside the incubator, optionally via a pump that allows control of the gas pressure, thereby allowing high pressure conditions. In some embodiments, the system includes one or more sampling ports (e.g., for O 2 and / or CO 2 ), which allows additional monitoring of gas levels in the system. Exemplary Gas and Pressure Controllers

[0635] Reference now Fig.44D , which shows a schematic diagram of an exemplary gas and pressure controller 502 according to some embodiments of the present invention. In some embodiments, as previously described, one or more gas sources 504, 505, 506 are connected to the gas and pressure controller 502. In some embodiments, each gas source is connected to a dedicated electric valve 512, 513 and 514 in the gas and pressure controller 502. For example, from CO 2 506 A gas source (e.g., a storage tank) is connected to a dedicated CO 2 Electric valve 514, from N 2 A gas source 504 (e.g., a tank) is connected to a dedicated N 2 Electric valve 512, and from O 2 505 A gas source (e.g., a storage tank) is connected to a dedicated O 2 Electric valve 513. In some embodiments, the gas and pressure controller 502 includes a dedicated 'single gas controller 516 / 518' for manipulating and monitoring the gas (hereinafter referred to as CO 2 Controller 518 or O 2 Controllers 516 - These are different from the main gas and pressure controllers 502 of the fetal incubation system. For example, when it is necessary to manipulate the CO 2 When the user accesses CO 2 Controller 518 to set the required CO in the system 2 level, and, for example, when it is necessary to manipulate the O2 When the user accesses O 2 The controller 516 can be controlled by adding or not adding N to the system. 2 gas and / or by adding or not adding O to the system 2 Gas to set the required O 2 It should be noted that there is about 21% oxygen in normal air, and when a lower level of oxygen is needed in the fetal incubation system, such as 5% or 10%, nitrogen is introduced to reduce the oxygen level in the system. In some embodiments, when a higher concentration of oxygen is needed, the nitrogen is stopped. 2 gas, and provide pure O 2 , for example, to provide 95% / 5% O in a vial 2 / CO 2 In some embodiments, the system is configured to provide any combination of gas mixtures, such as from 0% O 2 The gas mixture provided 100% O 2 ; or for example O 2 / CO 2 Any combination of ratios, such as from about a 1% / 99% ratio to a 99% / 1% ratio. In some embodiments, the gas and pressure controller 502 provides and ensures that the margin of error for any gas provided to the fetal incubation system is about 0.2%. In some embodiments, the CO 2 The margin of error for gases is about 0.1% to about 1%, O 2 The margin of error for gas is about 0.1% to about 2%, and N 2 The margin of error for the gas is about 0.1% to about 2%. In some embodiments, CO 2 The margin of error does not exceed 2%. In some embodiments, N 2 The margin of error does not exceed 5%. In some embodiments, 2The margin of error does not exceed 5%. In some embodiments, each specific gas controller 516 / 518 controls the opening and closing of specific electric valves 512, 513 and 514 as needed. In some embodiments, the requirements set by the user using each gas controller 516 / 518 are monitored by a dedicated sensor in the gas mixing box 508 (see below for information about the gas mixing box 508). Therefore, in some embodiments, information from the gas sensor in the gas mixing box 508 is transmitted to the dedicated gas controller 516 / 518. In some embodiments, the dedicated gas controller 516 / 518 uses information from the gas sensor in the gas mixing box 508 to open or close specific electric valves 512, 513, 514, also according to the predetermined requirements set by the user. In some embodiments, the gas and pressure controller 502 includes a vacuum pump 520 and a pressure pump 522. In some embodiments, after the gas is mixed in the gas mixing box 508 (see below for information about the gas mixing box 508), the vacuum pump 520 is started to squeeze the mixed gas out of the gas mixing box 508. In some embodiments, the gas is then accumulated in the pressure pump 522 until a predetermined pressure level is reached before it is delivered to the incubator 510. In some embodiments, the pressure pump is configured to provide a mixed gas at a pressure of about 1 psi to about 6 psi, optionally about 0.5 psi to about 8 psi, optionally about 0.05 psi to about 12 psi. When necessary, preferably 6.5 psi. In some embodiments, the user manually sets the pressure level at which the pressure pump 522 delivers the mixed gas. In some embodiments, the gas and pressure controller 502 includes a power supply unit 524, which is configured to provide dedicated power to different parts of the gas and pressure controller 502. In some embodiments, the gas and pressure controller 502 optionally includes a pressure transmitter 526, which is configured to monitor the pressure in the system / gas and pressure controller 502. In some embodiments, the gas and pressure controller 502 optionally includes a check valve 528, which is configured to ensure that the mixed gas leaving the gas and pressure controller 502 does not return (backflow) to the gas and pressure controller 502. In some embodiments, the gas and pressure controller 502 optionally includes a gas adapter control 530 configured to control the flow rate in the system. In some embodiments, the gas and pressure controller 502 includes one or more filters (e.g., Fig.44E (531)) (e.g., a 1μ filter) to ensure the purity of the gas and potentially avoid contamination.

[0636] Fig.44E , 44F 44G show different images of an exemplary gas and pressure controller 502 according to some embodiments of the present invention. Specifically, Fig.44EA perspective view of the gas and pressure controller 502 is shown, showing the gas lines entering the gas and pressure controller 502 and the gas lines exiting the gas and pressure controller 502. Additionally, the gas controller 516 / 518 and optional filter 531 are shown. Fig.44F The internal arrangement of a gas and pressure controller 502 is shown showing exemplary electric valves 512, 513, 514 according to some embodiments of the present invention. Figure 44G An exemplary gas and pressure controller 502 is shown, configured to monitor and deliver only CO, according to some embodiments of the present invention. 2 and / or N 2 . Exemplary Gas Mixing Box

[0637] Reference now Figure 44H , which shows a schematic diagram of an exemplary gas mixing box 508 according to some embodiments of the present invention. In some embodiments, the gas mixing box 508 is used to ensure a complete and uniform mixing of the different gases that are necessary to provide the necessary environment for the vials in the incubator. In some embodiments, the gas mixing box 508 includes about 250,000 cm 3 to about 260,000cm 3 In some embodiments, different sizes can be used to provide different amounts of mixed gases as needed. In some embodiments, the gas mixing box 508 is made of plastic (e.g., Perspex). In some embodiments, the gas mixing box 508 is made of a material other than plastic. In some embodiments, the gas mixing box 508 includes dedicated gas sensors 532 / 534, which are configured to monitor the percentage of those gases inside the gas mixing box 508. Figure 44H Two sensors are shown, namely O 2 Sensor 532 and CO 2Sensor 534. In some embodiments, the sensitivity of the sensor is about 95% accuracy to about 100% accuracy. In some embodiments, the gas mixing box 508 includes a mixing blower 536, which is configured to thoroughly mix the gas from the gas and pressure controller 502. In some embodiments, once the gas level inside the gas mixing box 508 detected by the sensor 532 / 534 reaches the desired level, the mixed gas is sucked away by the vacuum pump 520 in the gas and pressure controller 502. In some embodiments, the gas and pressure controller 502 optionally includes a flow restriction 538, which is configured to maintain a uniform flow rate in the system, thereby possibly avoiding the possibility of changes in the flow rate. In some embodiments, the gas mixing box 508 includes one or more filters (not shown) (e.g., 1μ filters) installed on the pipeline of the flowing gas to ensure the purity of the gas and potentially avoid contamination.

[0638] Fig.44I An image of an exemplary gas mixing box 508 is shown, according to some embodiments of the present invention. Exemplary Incubator

[0639] In some embodiments, the incubator is a static incubator. In some embodiments, the incubator is a rotating incubator. In some embodiments, the incubator is a static incubator containing a rotating module inside it. In some embodiments, the static incubator includes one or more temperature regulators configured to maintain the temperature inside the static incubator (including the rotating module assigned inside it). In some embodiments, the temperature inside the incubator is adjusted from 4 ° C to about 60 ° C. In some embodiments, the incubator is, for example, a "precision" incubator system (BTC01 model, with bubble kit-manufactured by BTCEngineering,-Cullum Starr Precision Engineering Ltd-UK).

[0640] Reference now Fig.44J, which shows a schematic diagram of an exemplary incubator 510 according to some embodiments of the present invention. In some embodiments, the mixed gas is delivered to the incubator 510 from the gas and pressure controller 502. In some embodiments, the incubator includes a one-way valve 540 connected to a pipeline through which the mixed gas is delivered from the gas and pressure controller 502 to the incubator 510. In some embodiments, the one-way valve 540 is a manual one-way valve that is manually opened and closed by a user. In some embodiments, the one-way valve 540 is an automatic one-way valve controlled by a main controller (see below). In some embodiments, the mixed gas is optionally delivered to a bubbler bottle 542. In some embodiments, the bubbler bottle 542 is partially filled with a liquid. In some embodiments, the liquid is water. In some embodiments, the gas is delivered to the liquid in the bubbler bottle 542, thereby generating bubbles in the liquid. In some embodiments, the bubbler bottle 542 allows the user to see that the system is delivering the mixed gas by visually evaluating the following items: 1. Whether there are bubbles; and 2. The speed at which the bubbles are generated. In some embodiments, in addition, the bubbler bottle 542 serves as a humidifier for the gas (see below). In some embodiments, the bubbler bottle 542 provides a safeguard from the pressure of the mixed gas delivered to the incubator 510, for example, in the event of a malfunction, if the mixed gas is delivered at a pressure higher than the desired pressure, the additional pressure will be contained in the bubbler bottle 542 and dissipated. In some embodiments, the mixed gas is then optionally delivered to an additional humidifier 544. In some embodiments, the inventors have found that in some cases, dry mixed gas may be harmful to the samples in the incubator, so the addition of a humidifier 544 overcomes this problem. In some embodiments, an additional humidifier can reduce the excess humidity brought by the gas from the bubbler bottle 542. In some embodiments, the mixed gas is delivered from the humidifier 544 to a rotating drum 546 of a rotating module, which includes all containers (vials) containing samples located in the incubator. In some embodiments, the rotating drum 546 is configured to evenly deliver the mixed gas between the containers, optionally while rotating the samples. In some embodiments, the container (vial) in the rotating drum 546 includes the culture medium required for embryo growth and / or maintenance. In some embodiments, the gas is delivered to the container (vial) and absorbed / used by the culture medium. It should be noted that in some embodiments, since the embryo is suspended in the culture medium, it is problematic to continuously deliver the new culture medium with mixed gas, because these types of mechanisms need to extract the old / used culture medium from the vial, and insert the new culture medium with the new mixed gas therein, which can increase the possibility of losing the embryo during the exchange. Therefore, the new gas is provided by delivering the mixed gas to the vial, without the need to replace the culture medium for it.In some embodiments, there is no need to provide continuous gas replacement, only by taking out each bottle and carefully changing the culture medium according to known techniques to change the culture medium. In some embodiments, the rotary drum 546 is configured to be positioned at an angle, which allows the bottle to have an angle relative to the base where the entire rotary module is located. In some embodiments, the angle is about 0 degrees (no angle-the bottle remains on the side, such as. Figure 44K In some embodiments, the incubator 510 includes a plurality of incubators 510, 510, 520, 530, 540, 560, 570, 580, 590, 600, 610, 620, 640, 660, 670, 680, 690, 700, 710, 720, 730, 740, 760, 770, 780, 790, 800, 810, 820, 830, 840, 860, 870, 880, 890, 900, 910, 920, 930, 940, 960, 970, 980, 990, 1010, 1100, 1110, 1120, 1130, 1140, 1150, 1160, 1170, 1180, 1190, 1210, 1220, 1230, 1240, 1250, 1260, 1270, 1280, 1290, 1300, 1310, 1320, 1330, 1340, 1350, 1360, 1370, 1380, 1390, 1410, 1420, 1430, 1440, 1450, 1460, 1470, 1480, 1490, 1510, 1520, 1530, 1540, 1550, 1560,

[0641] Figure 44K An image of an exemplary rotating incubator module 510 is shown, according to some embodiments of the present invention. Figure 44L An image of an exemplary container (vial or bottle) with a sample is shown according to some embodiments of the present invention. Exemplary Automated Fetal Incubation System

[0642] In some embodiments, the fetal incubation system as disclosed above is connected to a main controller, which is configured to perform automated operations according to a predetermined protocol provided by a user. For example, the user programs the main controller to change the incubation chamber within a certain period of time. In some embodiments, the system will include electric valves of the entire system, which will be activated / deactivated according to the protocol programmed. In some embodiments, the potential advantage of utilizing an automated system is that it reduces the possibility of human error in the embryonic development process. In some embodiments, optionally, the main controller provides regular updates of a PC or mobile electronic device to the user. Exemplary general information related to the system

[0643] Generally speaking, since the 1930s, many culture techniques have been proposed for many years by culturing embryos under conventional static conditions, in rotating bottles on rollers (called "roller culture systems") or on circulator platforms. These platforms are still very inefficient for embryo survival, and are limited to a short time, because embryos begin to have developmental abnormalities as early as 24 hours after the start of cultivation. Therefore, a stable and effective scheme for extending the culture of pre-gastrula mouse embryos until the late organogenesis stage has been developed, and is disclosed herein. In some embodiments, some newly established cell culture supplements or biomechanical principles in stem cell research have been tested to assess whether they help to keep embryos alive (e.g., hyperbaric oxygen chambers, synthetic serum). In some embodiments, a "roller culture system" on a roller is used, and it is integrated with a customized and internally developed electronic gas regulation module 502, which not only allows precise control of N with high sensitivity, but also allows the production of a variety of embryos. 2 , O 2 and CO 2 In some embodiments, the oxygen level is increased sequentially every 24 hours, starting from 5% O at E7.5. 2 Initially, 13% at E8.5, 18% at E9.5, and 21% at E10.5 O 2 End, and found that this is the most ideal for the robust results reported herein. In addition, when necessary, the oxygen level is increased to 95%. In addition, in some embodiments, it is found that maintaining a high pressure of about 6.5psi is also crucial for the normal and effective development of the embryo.

[0644] In some embodiments, the sample is maintained in a static incubator. In some embodiments, the sample is maintained in a dynamic incubator, such as a rotating incubator. In some embodiments, the sample is first maintained in a static incubator and then moved to a dynamic incubator, and vice versa. In some embodiments, the sample is maintained in a static incubator that includes, for example, a rotating incubator. In some embodiments, when maintained in a dynamic incubator, the sample is maintained in a rotating bottle on a roller (referred to as a "roller culture system") or on a circulation platform.

[0645] In some embodiments, throughout the culture process, the embryo is maintained on a rotary drum culture unit (e.g., BTC01 model with a bubble kit - manufactured by BTC Engineering, Cullum Starr Precision Engineering Ltd-UK) in a "precision" incubator system. In some embodiments, a 'rotator' culture method is used, which provides a continuous oxygen flow for the culture in the rotary bottle, and is disclosed elsewhere herein (e.g., BTC rotary drum culture unit BTC02 model, manufactured by BTC Engineering, Cullum Starr Precision Engineering Ltd-UK). In some embodiments, culture bottles (glass bottles (small) BTC 03 and glass bottles (large) BTC 04) are inserted into a hollow rotating drum. In some embodiments, gas flows along the axis and is distributed to the culture bottle by the baffle in the drum. In some embodiments, compared with other systems with sealed culture bottles, the system maintains a stable pH. In some embodiments, the manufacturer provides a rotator with a gas filter, a bubbler, and a wire. In some embodiments, the BTC precision incubator uses thyristor controlled heaters and high flow fans to provide highly stable and uniform temperatures throughout the easily accessible workspace. In some embodiments, the workspace of the incubator is 370 x 350 x 200 mm high and is accessible through a hinged top. In some embodiments, the heater element is rated at 750 watts. In some embodiments, Bung (Hole) BTC 06 is used to seal the bottles and Bung (Solid) BTC 07 is used to seal the drums (BTC Engineering, - Cullum Starr Precision Engineering Ltd-UK).

[0646] In some embodiments, to achieve a constant O in the culture medium throughout the culture period, 2 and CO 2 The incubator module is connected to a gas and pressure control unit 502 (Model #-HannaLab1; assembled and sold by Arad Technologies LTD, Ashdod, Israel). In some embodiments, the carbon dioxide and oxygen concentrations are regulated by specific controllers located on the gas and pressure control unit 502. In some embodiments, the pressure controller allows the gas pressure to be controlled between 5 and 10 psi (positive pressure above the ambient external atmospheric pressure). In some embodiments, nitrogen, O, and nitrogen are then added at a pressure of 6.5 psi. 2 and / or CO 2Injected into the gas mixing box, the pressure is considered to be the optimal level. In some embodiments, the gas mix in the gas box is uniform and mixed by a centrifugal mixer blower. In some embodiments, the gas is injected into the incubator by a pump, and the pump establishes pressure and adequacy according to the number of bubbles generated in the water bottle, and the pump is controlled by a one-way flow meter. In some embodiments, the bubble rate (which indicates the speed at which the gas flows into the bottle) can be adjusted by the user as needed. In some embodiments, the gas flows into the water bottle through the inlet, and the speed at which the gas flows into the bottle is controlled by a valve. In some embodiments, the humidified gas circulates to a glass test tube and then circulates to the inside of the bottle in the rotating spherical. In some embodiments, the gas flow rate is monitored by the bubble rate generated in the test tube filled with water at the outlet. In some embodiments, the bottle containing the sample is placed on a rotary drum culture system, rotated at 30 revolutions per minute at 37°C, and continuously ventilated with the following atmosphere, for example 5% O at 6.5 pounds per square inch (psi). 2 , 5% CO 2 , or 5% O at 0.1 pounds per square inch (psi) 2 , 5% CO 2 , or for example 13% O 2 , 5% CO 2 A mixed gas, such as 18% O 2 and 5% CO 2 atmosphere, or for example 21% O 2 and 5% CO 2 In some embodiments, to replace the culture medium, the culture medium is preheated for at least one hour by placing it in a glass bottle in a rotary culture, passing through a sufficient atmosphere according to the stage of the cultured embryos. Exemplary methods related to fetal incubation systems

[0647] Reference now Figure 44M , which shows a flow chart of an exemplary method associated with a fetal incubation system according to some embodiments of the present invention. In some embodiments, the user sets the desired gas and pressure levels within the incubator 550. For example, 5% CO at a pressure of 6.1 psi 2 and 10% O 2. In some embodiments, the gas and pressure controller activates a sensor in the gas mixing box to receive information about the actual level of gas in the gas mixing box 552. In some embodiments, an electric valve is opened to allow gas to flow from the gas source through the gas and pressure controller into the gas mixing box 554. In some embodiments, the gases are mixed in the gas mixing box by activating the mixer blower 556. In some embodiments, sensors in the gas mixing box are activated to monitor the levels of internal gases until they reach the desired level 558. In some embodiments, the mixed gas is extracted from the gas mixing box by activating the vacuum pump 560. In some embodiments, the pressure of the extracted mixed gas is increased to the desired level by activating the pressure pump 562. In some embodiments, a one-way valve in the incubator is opened to allow the pressurized mixed gas to flow into the incubator 564. In some embodiments, the pressurized mixed gas passes through a humidifier 566. In some embodiments, the humidified pressurized mixed gas is delivered to individual tubes containing samples 568. In some embodiments, the exhausted gas passes through an outlet tube before leaving the incubator 570.

[0648] According to a specific embodiment, the method further comprises isolating cells, tissues or organs from the embryo after culturing.

[0649] Non-limiting examples of such cells include stem cells [such as but not limited to embryonic stem cells, mesenchymal stem cells, neural stem cells, hematopoietic stem cells], blood cells, liver cells, insulin-secreting pancreatic beta cells, muscle cells, lung epithelial cells, endothelial cells, glial cells.

[0650] These cells, tissues or organs can be used, for example, as cell-based therapies, tissue replacements, organ or tissue implants or for research purposes.

[0651] According to other specific embodiments, the method further comprises transferring the synthetic embryo into the uterus.

[0652] The established methods described herein for producing synthetic embryos and methods and systems for culturing them ex utero can be further combined with, for example, genetic modification, chemical screening, tissue manipulation, and microscopy methods, and can constitute a powerful tool in basic research, for example as a framework for studying the emergence of cellular diversity, cell fate determination, and how tissues and organs emerge from single totipotent cells; and as a source of cells, tissues, and organs for transplantation, generating chimeric embryos, testing the effects of drugs on embryonic development (e.g., teratogenic effects), etc. Such methods are known in the art.

[0653] Thus, according to specific embodiments, the method comprises manipulating a synthetic embryo or a subpopulation of cells as described herein.

[0654] According to a specific embodiment, the manipulation comprises the introduction of a gene of interest into the cell or embryo.

[0655] According to specific embodiments, the manipulation comprises introducing a polynucleotide of interest into the cell or embryo.

[0656] According to specific embodiments, the manipulation comprises introducing a genome editing or RNA silencing agent into the cell or embryo.

[0657] According to a specific embodiment, the manipulation includes producing an embryo that is incompatible with life. Thus, for example, the manipulation may include knocking out selected genes to selectively disrupt an organ, thereby rendering the embryo limited in developmental potential and unable to maintain viability, such as headless (e.g., lacking Mesp1 or NKX2-5) or heartless (e.g., lacking Lim1), as further described in the Examples section below.

[0658] Thus, according to a specific embodiment, the manipulation comprises introducing into the embryo a polynucleotide that renders the embryo incompatible with life.

[0659] Methods for designing, expressing and introducing a polynucleotide of interest so that it is expressed in a cell of interest are well known in the art and are further described above and below.

[0660] According to a specific embodiment, the manipulation comprises microinjecting cells into embryos, thereby obtaining chimeric embryos.

[0661] As used herein, the phrase "chimeric embryo" refers to an animal that contains cells from at least two genetically different individuals.

[0662] It is worth noting that chimeric embryos can be made up of cells belonging to two different species or two different individuals of the same species.

[0663] According to some embodiments of the invention, the cells are embryonic in nature.

[0664] According to some embodiments of the invention, the cell is xenogeneic.

[0665] As used herein, the term "heterospecific" refers to individuals of at least two different species.

[0666] According to a specific embodiment, the cell is a stem cell [such as, but not limited to, embryonic stem cells, mesenchymal stem cells, neural stem cells, hematopoietic stem cells, induced pluripotent stem cells (iPS)].

[0667] According to some embodiments of the invention, introducing the cells is performed ex vivo by direct injection or aggregation with a developing embryo.

[0668] According to specific embodiments, the manipulation comprises introducing a drug of interest into the cell or embryo.

[0669] According to specific embodiments, the method further comprises determining the effect of the manipulation on embryonic development.

[0670] According to specific embodiments, any gene, polynucleotide, protein, polypeptide and / or protein portion described herein may have the sequence of a human gene, polynucleotide, protein, polypeptide and / or protein portion that exhibits the desired activity as described herein, or a functional fragment or homolog thereof.

[0671] According to specific embodiments, the genes, polynucleotides, proteins, polypeptides and / or protein portions are of human origin.

[0672] According to other specific embodiments, the gene, polynucleotide, protein, polypeptide and / or protein portion is a homologue of a human gene, polynucleotide, protein, polypeptide and / or protein portion. Such a homologue can be, for example, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical or homologous to the human sequence.

[0673] As used herein, the term "about" refers to ± 10%

[0674] The terms "includes," "comprising," "containing," "having" and variations thereof mean "including but not limited to."

[0675] The term "consisting of" means "including and limited to."

[0676] The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and / or components, but only if the additional ingredients, steps and / or components do not materially change the basic and novel characteristics of the claimed composition, method or structure.

[0677] As used herein, the singular forms "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.

[0678] Throughout this application, various embodiments of the present invention may be presented in range format. It should be understood that the description in range format is only for convenience and brevity and should not be interpreted as an unchangeable limitation on the scope of the present invention. Therefore, the description of the range should be regarded as having clearly disclosed all possible sub-ranges and each numerical value within the range. For example, a range description of 1 to 6 should be regarded as having clearly disclosed sub-ranges, such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as single numbers within the range, such as 1, 2, 3, 4, 5 and 6. This applies no matter how wide the range is.

[0679] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integer) within the indicated range. The phrases "range" between a first indicated numeral and a second indicated numeral and "range" from a first indicated numeral to a second indicated numeral are used interchangeably herein and are meant to include the first and second indicated numerals and all fractions and integers between them.

[0680] The term "method" as used herein refers to manners, means, techniques and procedures for accomplishing a given task, including but not limited to manners, means, techniques and procedures known to practitioners in the fields of chemistry, pharmacology, biology, biochemistry and medicine or readily developable from known manners, means, techniques and procedures.

[0681] When reference is made to a particular sequence listing, such reference should be understood to also cover sequences that substantially correspond to the complementary sequence thereof, including minor sequence variations caused by, for example, sequencing errors, cloning errors, or other changes resulting in base substitutions, base deletions, or base additions, provided that the frequency of such variations is less than 1 in 50 nucleotides, or less than 1 in 100 nucleotides, or less than 1 in 200 nucleotides, or less than 1 in 500 nucleotides, or less than 1 in 1000 nucleotides, or less than 1 in 5,000 nucleotides, or less than 1 in 10,000 nucleotides.

[0682] It should be understood that, for the sake of clarity, certain features of the invention described in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, for the sake of brevity, various features of the invention described in the context of a single embodiment may also be provided separately or in any suitable sub-combination or in any other described embodiment of the invention in a suitable manner. Certain features described in the context of various embodiments should not be considered essential features of those embodiments, unless the embodiments do not function without those elements.

[0683] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples. Example

[0684] Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion. Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Example 1. Aggregation of naive PSCs, TSCs, and XENs in mice does not produce organized embryos Materials and methods

[0685] Embryonic-derived mouse TSC line #1 (mTSC#1) - established according to a classical protocol described previously (doi: 10.1126 / science.282.5396.2072.) Briefly, TSCs were derived from E3.5 blastocysts flushed from the uteri of 5-week-old female CD1 mice. Blastocysts were cultured on mitotically inactivated mouse MEF cells (feeder cells) using TSC medium: Advanced RPMI 1640 (11875-093, Thermo Fisher Scientific or RPMI (Invitrogen), supplemented with 15-20 (v / v) FBS (Gibco, ES cell qualified; or Biological Industries), 1X GlutaMAX (35050061, Thermo Fisher Scientific; or Invitrogen), 0.1 mM β-mercaptoethanol (21985-023, ThermoFisher Scientific; or Sigma), 1 mM sodium pyruvate (11360070, Thermo Fisher Scientific), 1% (v / v) penicillin-streptomycin (15140122, Thermo Fisher Scientific), 1% (v / v) penicillin-streptomycin (15140122, Thermo Fisher Scientific), 1% (v / v) FBS (Gibco, ES cell qualified; or Biological Industries), 1X GlutaMAX (35050061, Thermo Fisher Scientific; or Invitrogen), 0.1 mM β-mercaptoethanol (21985-023, ThermoFisher Scientific; or Sigma), 1 mM sodium pyruvate (11360070, Thermo Fisher Scientific), 1% (v / v) penicillin-streptomycin (15140122, Thermo Fisher Scientific), 1% (v / v) FBS (Gibco, ES cell qualified; or Biological Industries ...X Gluta Scientific; or BiologicalIndustries), 25ng / ml recombinant human FGF4 (235-F4-025, R&D; or Peprotech), 1μg / ml heparin (07980, Stem Cell; or Sigma) and 1X non-essential amino acids (Biological Industries). Optionally, 25 ng / ml FGF2 (Peprotech) was added. DMEM may also be used instead of RPMI, as is commonly practiced in the art of preparing stable TSC lines. Growth was allowed to form on day 4, after which the cells were incubated in an incubator with 0.1% trypsin-EDTA for 5 minutes to detach them. Mouse 70% embryonic fibroblast conditioned medium containing FGF4 and heparin was added to terminate the reaction, and the cells were returned to the incubator. The medium was changed every other day until TS cell colonies were observed (no earlier than day 14 - passage 3), after which the medium was switched to TSC medium to maintain the cells. Immunostaining for the TSC markers Cdx2, Gata3, TBR2, and TFAP2C and the absence of the pluripotency markers Oct4 and Nanog confirmed the TSC identity of this representative TSC line ( Figure 1-2 ). Cells can be passaged more than 50 times while maintaining their morphology and markers.

[0686] Mouse ES derived mouse TSC line #2 (mTSC#2) - obtained by inhibiting Oct4 and transferring cells to TSC medium in mTSC#1 as previously established (PMID: 10742100). In brief, the ZHBTC4 mouse ES line in which DOX induced Oct4 inhibition was turned off (Tet-off) was used and passaged in TSC medium with DOX (PMID: 10742100). Immunostaining showed that although the parental ESC line was positive for Oct4 pluripotency markers and negative for Cdx2 and Gata3 TSC markers ( Figure 3A ); however, the established mTSC#2 line lacks Oct4 and Nanog pluripotency markers and stably expresses TSC markers Cdx2, TBR2, Gata3, and TFAP2C ( Figure 3B and 4 ), thus confirming the TSC identity of this representative TSC line. In addition, mTSC#2 line was maintained on MEFs and had a typical TSC colony morphology (doi:10.1126 / science.282.5396.2072.).

[0687] Mouse ES-derived mouse TSC line #3 (mTSC#3) - was derived as previously established (www(dot)doi(dot)org / 10(dot)1016 / j(dot)cell(dot)2005(dot)08(dot)040) by transiently overexpressing Cdx2 in mouse ESCs expanded under semi-primed FBS / LIF conditions and transferring the cells to TSC medium in mTSC#1 above. Specifically, a previously described ICR mouse ES line (PMID: 19427283) in which Cdx2 was transiently transfected was used and passaged in TSC medium. Subsequently, TSC colonies were picked, passaged and verified. Immunostaining for the TSC markers Cdx2 and Gata3 confirmed the TSC identity of this representative TSC line ( Figure 5 ). In addition, mTSC#3 line was maintained on MEFs and had the classic TSC colony morphology.

[0688] Mouse XEN line #7 (XEN-ICR clone #7) - established according to the classical protocol described previously (doi:10.1071 / rd06125). Briefly, XEN cells were derived from E3.5 blastocysts flushed from the uterus of 5-week-old female ICR mice using modified XEN conditions. Mouse blastocysts were cultured on feeder cells until they formed outgrowths on day 4 and were subsequently detached by incubation with 0.1% trypsin-EDTA for 5 minutes in an incubator. Fresh mouse ES (based on FBS-LIF) was added to stop the trypsin reaction, and the medium was changed every other day until XEN cell colonies could be observed. Next, XEN cell colonies were picked and maintained with standard XEN medium: Advanced RPMI 1640 (11875-093, Thermo Fisher Scientific) or RPMI 1640 (Gibco 11875085), supplemented with 15% (v / v) FBS (Gibco or Biological Industries) and 0.1 mM β-mercaptoethanol (21985-023, Thermo Fisher Scientific or Sigma), 1x Glutamax (Invitrogen), 1% penicillin-streptomycin (15140122, Thermo Fisher Scientific; or Biological Industries), 1x non-essential amino acids (Biological Industries) and 1 mM sodium pyruvate (BI 03-042-1B). As previously described (doi:10.1071 / rd06125), at least 15 days and 3 passages were required to establish individual early passage mouse XEN lines. Immunostaining of early passage mouse XEN line clone 7 at passage 5 confirmed the loss of pluripotency markers Oct4 and Nanog (as expected), and the expression of XEN markers Foxa2 and Gata4 ( Fig. 6A In addition, real-time PCR analysis showed upregulation of the XEN markers Gata6, PDGFRA, Sox17, and Gata4 ( Figure 6B ), their identities were further confirmed (10.1371 / journal.pone.0009794). Mouse naive V6.5 naive ESCs expanded under 2i-LIF conditions were used as reference controls (values ​​set to 1).

[0689] Mouse XEN line XEN-Prep1 - established as described for XEN line #7 (side by side). Real-time PCR analysis showed upregulated expression of XEN markers Gata6, PDGFRA, Sox17, and Gata4 ( Figure 6B), their identities were confirmed (10.1371 / journal.pone.0009794). Mouse naive V6.5 naive ESCs expanded under 2i-LIF conditions were used as reference controls (values ​​set to 1).

[0690] Mouse naive pluripotent stem cell (naive PSC) line - pluripotent V6.5 GFP-labeled mouse ES line (PMID: 19427283) was maintained and expanded in serum-free chemically defined N2B27-based medium: 240 ml Neurobasal (ThermoFisher 21103049) and 240 ml DMEM-F12 (SIGMA D6421) containing HEPES, 5 ml N2 supplement (Invitrogen; 17502048), 5 ml-10 ml B27 supplement (Invitrogen; 17504044), 2 mM glutamine or 1 mM GLutamax (Invitrogen), 1% non-essential amino acids (Invitrogen), 0.1 mM β-mercaptoethanol (Sigma), 1% penicillin-streptomycin (Invitrogen). Optionally, the medium also contains 5 mg / ml BSA (Sigma). Naive 2i / LIF conditions for mouse PSCs included 20 ng / ml recombinant human LIF (prepared in-house). 2i: small molecule inhibitors CHIR99021 (CH, 3 μM - Axon Medchem) and PD0325901 (PD, 1 μM - Axon Medchem 1408) were added where indicated.

[0691] Figure 8 Real-time PCR analysis and immunostaining confirmed that clones showed DOX-inducible overexpression of Gata4 inserts ( Figure 9-10 ).

[0692] Aggregation medium (AM) - 240 ml Neurobasal (ThermoFisher 21103049) and 240 ml DMEM-F12 (Thermo 21331-020 or SIGMAD6421), 5 ml N2 supplement (Invitrogen; 17502048), 10 ml B27 supplement (Invitrogen; 17504044), 2 mM glutamine or 1x GLutamax (Invitrogen), 1x non-essential amino acids (NEAA) (Invitrogen), 0.1 mM β-mercaptoethanol (GIBCO 31350-010), 1x penicillin-streptomycin (Invitrogen), 0.45% BSA (Sigma A7979), 1% sodium pyruvate (BI 03-042-1B). When indicated, serum was added to the aggregation medium at the indicated percentages and sources.

[0693] IVC1 medium - Advanced DMEM / F12 (Gibco 12634010) supplemented with Glutamax 1x, Pen / Strep 1x, ITS-X 1x (Gibco 51500056), β-estradiol 8 nM, progesterone 20 ng / ml, N-acetyl-L-cysteine ​​25 μM, and FBS or HSA as indicated.

[0694] EUCM medium (also called EUCM1) - 25% DMEM (GIBCO 11880) or Advanced DMEM / F12 (Thermo12634010), 25% HAS (adult serum or human umbilical cord serum), 50% rat serum (RAS), Glutamax 1X (GIBCO35050038), HEPES11mM (GIBCO 15630056), Pen / Strep 1x. When indicated, the medium was further supplemented with 4–12mg / ml D-glucose, 1mM sodium pyruvate and / or non-essential amino acids (NEAA 1x). DMEM aliquots were stored at 4°C and used within 2 months. Rat serum was stored at -80°C and heat-inactivated at 56°C for half an hour before use and then filtered through a 0.22μm PVDF filter (Millipore; SLGV033RS). HAS should be freshly thawed before experiments and used immediately. Rat serum and HSA can be thawed / frozen once.

[0695] Aggregation Plate Preparation - To prepare a 24-well AggreWell 400 plate (STEMCELL Technologies 34415) or AggreWell 800 plate (STEMCELL Technologies), add 500 ml of Anti-Adhesion Wash Solution (STEMCELL Technologies 07010) to each well. The plate was then centrifuged at 2,000 x g for 5 minutes and incubated at room temperature for 30 minutes. The Anti-Adhesion Wash Solution (Stem Cell Technologies-#07010) was then aspirated from the wells and 1 ml of PBS- / - was added to wash each well, and this PBS wash was repeated twice. After aspirating the PBS, 500 ml of Aggregation Medium (AM) was added to each well.

[0696] Coaggregation and culture ( Fig. 7A )-Coaggregation was defined as time point 0 of the protocol and was performed with three starting stem cell types: 1) V6.5-GFP (produces embryo proper); 2) Mouse XEN line #7 cells (predicted to give rise to the extraembryonic endoderm lineage); and 3) Mouse TSC line #1 cells (expected to give rise to the entire trophectoderm lineage).

[0697] The cells were trypsinized with 0.05% trypsin-EDTA for 3-5 minutes, and then the feeder layer was consumed on a gel plate at 37°C for 20 minutes (when using MEF). Subsequently, the cells were resuspended in an aggregation medium (AM) supplemented with doxycycline (2 μg / ml final concentration). After cell counting, a total of 18,000 TSCs, 6,000 XENs, and 6,000 v6.5-GFP WT cells were added to each well of an AggreWell 400 microwell 24-well plate. In an 800 microwell plate, a total of 4,500 TSCs, 1,500 XENs, and 1,500 V6.5 GFP cells were added to each well of an AggreWell 24-well plate. 1 ml of cell mixture was added to each well (the final volume of each well of the 24-well plate was 1.5 ml), 25 cells / well. - Day 0 - Centrifuge the plate at 100 x g for 3 minutes and label it as Day 0, then place in a 37°C, 5% CO 2 and 20% O 2 in a static incubator. - On day 1, gently aspirate 1 ml of medium from each well and replace with 1 ml of pre-warmed fresh AM + 20% PBS + DOX, as Fig. 7A shown. - On the second day, gently aspirate 1 ml of medium from each well and replace with 1 ml of pre-warmed fresh AM + 20% PBS, as Fig. 7A shown. - On day 3, gently aspirate 1 ml of medium from each well and replace with 1 ml of pre-warmed IVC1 medium containing 20% ​​FBS, as Fig. 7A shown. - On day 4, transfer the embryos to a 15 ml falcon tube using a 3 ml plastic Pasteur pipette, let stand for 5 minutes, gently remove most of the medium, leaving the embryo in about 1 ml of medium. Then use a pipette to gently transfer the embryos to a culture dish (35 mm Corning 430588 plate) or (6-well Costar 3736 plate) or iBidi plate with 4 ml of IVC1 medium containing 30% FBS and place in a static incubator (37°C, 20% O 2 and 5% CO 2 ) and incubated on a rotary shaker at 60 rpm. - On day 5, 2-3 ml of the medium was gently aspirated with a manual pipette and replaced with fresh IVC1 medium containing 30% HSA (to restore the total volume to 4 ml) and kept in a static incubator (37°C, 20% O 2 and 5% CO 2 ) and incubated on a shaker (60 rpm). - Starting from days 6 and 7, 2-3 ml of medium was gently aspirated daily with a manual pipette and replaced with fresh EUCM medium supplemented with 4 mg / ml D-glucose and 1 mM sodium pyruvate, as Fig. 7A as shown (restore total volume to 4 ml). - Starting from day 8, high-quality embryos were selected and transferred to a previously described extrauterine roller culture system (Alejandro-Castrjon et al. Nature 2021) in fresh EUCM medium supplemented with 4 mg / ml D-glucose and 1 mM sodium pyruvate and cultured at 20% O 2 , 5% CO 2 and incubated at 6.5 Psi.

[0698] Coaggregation and culture ( Fig.7D ) - KH2-Gata4 Dox-inducible cells expanded in 2i / LIF were used instead of XEN cells. For this purpose, KH2-GATA4 cells were supplemented with DOX in 2i / LIf 12 h before aggregation. Coaggregation was defined as time point 0 of the protocol and was performed with three starting stem cell types: 1) V6.5-GFP WT naive ESC (produces embryoid bodies); 2) DOX-pretreated KH2 tetO-GATA4 naive ESCs (generating the extraembryonic endoderm lineage); and 3) TSCs (expected to give rise to the entire trophectoderm lineage).

[0699] The cells were trypsinized with 0.05% trypsin-EDTA for 3-5 minutes, and then the feeder layer was consumed on a gel plate at 37°C for 20 minutes (when using MEF). Subsequently, the cells were resuspended in an aggregation medium (AM) supplemented with doxycycline (2 μg / ml final concentration). After cell counting, a total of 18,000 TSCs, 6,000 KH2-GATA4s, and 6,000 V6.5-GFP naive ES cells were added to each well in an AggreWell 400 microwell 24-well plate. In an 800 microwell plate, a total of 4,500 TSCs, 1,500 KH2-GATA4s, and 1,500 V6.5 GFP WT cells were added to each well in an AggreWell 24-well plate. 1 ml of cell mixture was added to each well (the final volume of each well in the 24-well plate was 1.5 ml), 25 cells / well. - Day 0 - Centrifuge the plate at 100 x g for 3 minutes and label it as Day 0, then place in a 37°C, 5% CO 2 and 20% O 2 in a static incubator. - On day 1, gently aspirate 1 ml of medium from each well and replace with 1 ml of pre-warmed fresh AM + 20% FBS + DOX, as Fig.7D shown. - On day 2, gently aspirate 1 ml of medium from each well and replace with 1 ml of pre-warmed fresh AM + 20% FBS, as Fig.7D shown. - On day 3, gently aspirate 1 ml of medium from each well and replace with 1 ml of pre-warmed IVC1 medium containing 20% ​​FBS, as Fig.7D shown. - On day 4, transfer the embryos to a 15 ml falcon tube using a 3 ml plastic Pasteur pipette, let stand for 5 minutes, gently remove most of the medium, leaving the embryo in about 1 ml of medium. Then use a pipette to gently transfer the embryos to a culture dish (35 mm Corning 430588 plate) or (6-well Costar 3736 plate) or iBidi plate (such as Fig.7D ) and in a static incubator (37°C, 20% O 2 and 5% CO 2 ) and incubated on a shaker (60 rpm). - On day 5, 2-3 ml of medium was gently aspirated with a manual pipette and replaced with fresh IVC1 medium containing 30% KSR (Knockout Serum Replacement - Invitrogen, Fig.7D The total volume was restored to 4 ml) and kept in a static incubator (37°C, 20% O 2 and 5% CO 2 ) on a shaker rotating at 60 rpm. - Starting from Day 6 and Day 7 - Gently aspirate 2-3 ml of medium daily with a manual pipette and replace with fresh EUCM medium supplemented with 4 mg / ml D-glucose and 1 mM sodium pyruvate, as Fig.7D as shown (restore total volume to 4 ml). - Starting from day 8, high-quality embryos were selected and transferred to a previously described extrauterine roller culture system (Alejandro-Castrjon et al. Nature 2021) in fresh EUCM medium supplemented with 4 mg / ml D-glucose and 1 mM sodium pyruvate and cultured at 20% O 2 , 5% CO 2 and incubated at 6.5 Psi.

[0700] Whole-mount immunostaining of embryos - Ex utero grown embryos (yolk sac and amnion removed or not for E8.5 embryos) were dissected, washed once with 1×PBS, then transferred to ibidi glass bottom 8-well slides (iBidi) and fixed with EM grade 4% PFA (Electron microscopy sciences, 15710) in PBS overnight at 4° C. The embryos were then washed 3 times for 5 minutes in PBS, permeabilized in PBS containing 0.5% Triton X-100 / 0.1M glycine for 30 minutes, blocked with 10% normal donkey serum / 0.1% Triton X-100 in PBS for 1 hour at room temperature (RT), and incubated with primary antibodies diluted in blocking solution overnight at 4° C. Afterwards, the embryos were rinsed 3 times for 5 minutes in PBS / 0.2% TritonX-100, incubated for 2 hours at room temperature with secondary antibodies diluted 1:200 in blocking solution (all secondary antibodies were from Jackson ImmunoResearch), counterstained with DAPI (1 μg / ml in PBS) for 10 minutes, and washed 3 times with PBS for 5 minutes each. If necessary, the yolk sac isolated from the embryo was fixed and stained using this whole mount immunostaining protocol.The following primary antibodies were used: rabbit monoclonal anti-Brachyury (Cell Signaling, 81694) 1:100; rabbit polyclonal anti-Cdx2 (Cell Signaling, 3977) 1:100; mouse monoclonal anti-Cdx2 (Biogenex, AU392A-UC) 1:100; goat polyclonal anti-Gata4 (Santa Cruz, SC-1237) 1:100; rabbit polyclonal anti-Gata4 (Abcam, Ab84593) 1:100; rabbit polyclonal anti-Foxa2 (Abcam, Ab40874) 1:100; mouse monoclonal anti-myosin heavy chain II (MF-20) (R&D, MAB4470) 1:100; goat polyclonal anti-Otx2 (R&D, AF1979) 1:200; rabbit polyclonal anti-Pax6 (Covance, PBR-278P) 1:100 1:100; goat polyclonal anti-Sox2 (R&D, AF2018) 1:200; rabbit polyclonal anti-Sox9 (Millipore, AB5535) 1:100; goat polyclonal anti-Sox17 (R&D, AF1924) 1:100; mouse monoclonal anti-Tuj1 (C-10) (Covance, MMS-435P) 1:200; chicken polyclonal anti-GFP (Abcam, Ab13970) 1:250; mouse monoclonal anti-Oct4 (Santa Cruz, SC-5279) 1:100; goat polyclonal anti-Lefty 1 (R&D, AF746) 1:100, goat polyclonal anti-mCherry / Tomato (SiCGEN, AB0040-200) 1:200.

[0701] Clearing of E9.5 to E11.5 embryos was performed as follows: embryos were washed once with 1× PBS and fixed overnight with EM-grade 4% PFA diluted in PBS at 4°C. Samples were washed three times in PBS for 5 minutes each, followed by methanol-free sample pretreatment, i.e., washed twice in PBS / 0.2% TritonX-100 for 1 hour each, then incubated overnight at 37°C in PBS / 0.2% TritonX-100 / 20% DMSO, then incubated overnight at 37°C in PBS / 0.1% Tween-20 / 0.1% TritonX-100 / 0.1% deoxycholic acid / 0.1% NP40 / 20% DMSO, then washed twice in PBS / 0.2% TritonX-100 for 1 hour each. For immunostaining, embryos were permeabilized overnight in PBS / 0.2% TritonX-100 / 20% DMSO / 0.3M glycine at 37°C, then blocked overnight in PBS / 0.2% TritonX-100 / 10% DMSO / 6% donkey serum at 37°C. After blocking, embryos were incubated with primary antibodies diluted in PBS / 0.2% Tween-20 containing 10 μg / ml heparin (PTwH) / 5% DMSO / 3% donkey serum at 37°C [E9.5 / E10.5=24 hours; E11.5=48 hours (72 hours for Sox17 and Foxa2 antibodies)]. Subsequently, samples were washed in PTwH for 24 hours (15 min, 30 min, 1 h, 2 h and overnight washes) and incubated with adequate secondary antibody (1:200) diluted in PTwH / 3% donkey serum for 48 hours at 37°C.

[0702] For human cell-specific NUMA staining (when used), donkey anti-rabbit biotin and streptavidin-Cy3 (each incubated overnight) were used to enhance the signal. Afterwards, embryos were incubated with DAPI (1 μg / ml) diluted in PTwH for 30 min, washed in PTwH for one day (5 min, 15 min, 30 min, 1 h, 2 h, and overnight washes), and incubated in methanol / H2O at room temperature. 2O series (20%, 40%, 60%, 80%, 100%) were dehydrated for 1 hour each, and then incubated in 100% methanol overnight. Embryos were cultured in 66.6% DCM / 33.3% methanol for 3 hours at room temperature on a shaker, then incubated in 100% DCM (Sigma; 270997) for 5 minutes, and finally cleared and stored in benzyl ether (Sigma; 108014). The following primary antibodies were used: rabbit monoclonal anti-Brachyury (Cell Signaling, 81694) 1:100; rabbit polyclonal anti-Cdx2 (Cell Signaling, 3977) 1:100; mouse monoclonal anti-Cdx2 (Biogenex, AU392A-UC) 1:100; goat polyclonal anti-Gata4 (Santa Cruz, SC-1237) 1:100; rabbit polyclonal anti-Gata4 (Abcam, Ab84593) 1:100; rabbit polyclonal anti-Foxa2 (Abcam, Ab40874) 1:50; mouse monoclonal anti-myosin heavy chain II (MF-20) (R&D, MAB4470) 1:100; goat polyclonal anti-Otx2 (R&D, AF1979) 1:200; rabbit polyclonal anti-Pax6 (Covance, PBR-278P) 1:100; goat polyclonal anti-Sox2 (R&D, AF2018) 1:200; rabbit polyclonal anti-Sox9 (Millipo re, AB5535) 1:100; goat polyclonal anti-Sox17 (R&D, AF1924) 1:50; mouse monoclonal anti-Tuj1 (C-10) (Covance, MMS-435P) 1:200; chicken polyclonal anti-GFP (Abcam, Ab13970) 1:250, goat polyclonal anti-mCherry / Tomato (SiCGEN, AB0040-200) 1:200; rabbit polyclonal anti-human TEMEM119 (Invitrogen, PA562505) 1:100; rabbit anti-hNUMA (Abcam, ab84680) 1:100.

[0703] Confocal microscopy - Images were acquired using a Zeiss LSM700 inverted confocal microscope (Carl Zeiss) equipped with 405-nm, 488-nm, 555-nm, and 635-nm solid-state lasers, using a Plan-Apochromat 20× air objective (numerical aperture 0.8) for E5.5 / E6.5 embryos and an EC Plan Neofluar 10× air objective (numerical aperture 0.3) for E7.5 to E11.5 embryos. Images were acquired at 1024 × 1024 resolution. All images were acquired within the following parameter ranges: laser power: 405 nm: 10–20%; 488 nm: 5–20%; 555 nm 10–40%; 635 nm: 30–80%. Gain ranged from 350 to 600. The pixel size was 1.25 μm and the z-step size was 15 μm when using a 10× objective, or 0.5 μm and the z-step size was 5 μm when using a 20× objective. For confocal imaging, iDISCO-cleared embryos were mounted in 35 mm glass-bottom dishes (In Vitro Scientific, D35201.5N) using ethyl cinnamate (Sigma, 112372) as the imaging solution. For mosaic embryos, all parameters during image acquisition were compared to stained uninjected control embryos, imaged using the same parameters as injected embryos. Images and maximum intensity projections were processed using Zen 2 blue edition software 2011 (Carl Zeiss) and Adobe Photoshop CS4.

[0704] Immunostaining of ES, TSC and XEN cell lines - Cells were grown on glass coverslips (13 mm 1.5H; Marienfeld, 0117530), fixed with 4% paraformaldehyde / phosphate buffered saline for 10 min at room temperature, washed three times with PBS, and permeabilized in PBS / 0.1% Triton for 10 min. Cells were blocked with blocking solution (2% normal goat serum, 0.1% BSA in PBS / 0.05% Tween) for 1 h at room temperature and incubated overnight at 4°C with primary antibodies diluted in blocking solution (the antibodies used in this study have been validated in the literature and in our own experiments). The cells were then washed three times with PBS / 0.05% Tween, incubated with secondary antibodies for 1 hour at room temperature, washed in PBS / 0.05% Tween, counterstained with DAPI (1 μg / ml), washed three times with PBS / 0.05% Tween, and mounted with Shandon Immu-Mount (ThermoScientific, 9990412) before imaging. All comparative experiments were performed simultaneously. All secondary antibodies used were from Jackson ImmunoResearch.

[0705] Real-time PCR analysis - For RT-PCR, total RNA was isolated using Trizol (Ambion Life Technologies), and 1 μg of total RNA was reverse transcribed using the High-Capacity Reverse Transcription Kit (Applied Biosystems). TM Quantitative PCR analysis was performed on a Viia7 platform (Applied Biosystems) using 10 ng of cDNA per reaction using Green PCR Master Mix (Applied Biosystems). Fold changes were normalized to Gapdh and / or actin expression as indicated. The following primers were used: Mouse Gapdh-forward: AGTCAAGGCCGAGAATGGGAAG (SEQ ID NO: 2); Mouse Gapdh-reverse: AAGCAGTTGGTGGTGCAGGATG (SEQ ID NO: 3) Mouse Oct4-forward: AGAGGATCACCTTGGGGTACA (SEQ ID NO: 4); Mouse Oct4-reverse: CGAAGCGACAGATGGTGGTC (SEQ ID NO: 5); Mouse Nanog-forward: CTCAAGTCCTGAGGCTGACA (SEQ ID NO: 6); Mouse Nanog-reverse: TGAAACCTGTCCTTGAGTGC (SEQ ID NO: 7); Mouse Sox2-forward: TAGAGCTAGACTCCGGGCGATGA (SEQ ID NO: 8); Mouse Sox2-reverse: TTGCCTTAAACAAGACCACGAAA (SEQ ID NO: 9); Mouse Klf4-forward: GCAACCTGCGAACTCACAC (SEQ ID NO: 10); Mouse Klf4-reverse: CCGTCCCAGTCACAGTGGTAA (SEQ ID NO: 11); Mouse Cdx2-forward: GCGAAACCTGTGCGAGTGGATG (SEQ ID NO: 12); Mouse Cdx2-reverse: CGGTATTTGTCTTTTGTCCTGGTTTTCA (SEQ ID NO: 13); Mouse Gata4-forward: CACAAGATGAACGGCATCAACC (SEQ ID NO: 14); Mouse Gata4-reverse: CAGCGTGGTGGTAGTCTG (SEQ ID NO: 15); Mouse Gata6-forward: CTTGCGGGCTCTATATGAAACTCCAT (SEQ ID NO: 16); Mouse Gata6-reverse:TAGAAGAAGAGGAAGTAGGAGTCATAGGGACA ((SEQ ID NO: 17); Mouse Brachyury (T) - forward: CTGTGACTGCCTACCAGAATGAGGAG (SEQ ID NO: 18); Mouse Brachyury (T) - reverse: GGTCGTTTCTTTCTTTGGCATCAAG (SEQ ID NO: 19); Mouse Otx2-Forward: CTTCGGGTATGGACTTGCTG (SEQ ID NO: 20) Mouse Otx2-reverse: CCTCATGAAGATGTCTGGGTAC (SEQ ID NO: 21); Mouse Fgf5-forward: CAAAGTCAATGGCTCCCACGAAG (SEQ ID NO: 22); Mouse Fgf5-reverse: CTACAATCCCCTGAGACACAGCAAATA (SEQ ID NO: 23); Total (endogenous + exogenous) mouse Gata4 forward: CCAGTGCTGTCTGCTCTGAA (SEQ ID NO: 24); total (endogenous + exogenous) mouse Gata4 reverse: GCTGTTCCAAGAGTCCTGCT (SEQ ID NO: 25); total (endogenous + exogenous) mouse Cdx2 forward: GCGAAACCTGTGCGAGTGGATG (SEQ ID NO: 26); total (endogenous + exogenous) mouse Cdx2 reverse: CGGTATTTGTCTTTTGTCCTGGT (SEQ ID NO: 27); exogenous mouse Gata4 forward: AAATTCCTGCTCGGACTTGGGAC (SEQ ID NO: 28); Exogenous mouse Gata4 reverse: GTGGTTTGTCCAAACTCATCAATGTATCTT (SEQ ID NO: 29); exogenous mouse Cdx2 forward: GAGGGGTTTTAAACTCCACTGTCACC (SEQ ID NO: 30); Exogenous mouse Cdx2 reverse: GTGGTTTGTCCAAACTCATCAATGTATCTT (SEQ ID NO: 31); endogenous mouse Gata4 forward: CACTGGAAAAGCCTGCGTTCTTACA (SEQ ID NO: 32); Endogenous mouse Gata4 reverse: AGAATAAGGAAGGAAGAAGTCTCTTGCCTC (SEQ ID NO: 33); Endogenous mouse Cdx2 forward: AATTATGGACCTCAGGGGAAGACATG (SEQ ID NO: 34); Endogenous mouse Cdx2 reverse: GCTGGCAGGAAGAGTCGGAATG (SEQ ID NO: 35). result

[0706] Three starting cell types, namely naive mouse PSCs (V6.5-GFP), mouse XEN cells [mouse XEN line #7 cells or KH2-Gata4 Dox-inducible cells], and mouse TSCs (mouse TSC line #1 cells) were co-aggregated and then cultured ex utero ( Fig. 7A -F), does not result in the production of an organized embryo. Fig. 7A Day 4 of the indicated regimen and Fig.7D On days 5 and 6 of the protocol shown, trophoblast cells were abnormally distributed in all regions of the embryo and did not show the expected pattern of being concentrated in regions opposite to the GFP+ epiblast ( Figure 7B and 7E On days 8 and 9, structures lacking an organized embryo were detected in the yolk sac and showed no signs of the emergence of neural folds and heart regions ( Figure 7C and 7F ). Example 2. Aggregation of three mouse naive PSC subpopulations to generate organized embryos Materials and methods

[0707] Mouse Naive Pluripotent Stem Cell (Naive PSC) Line—As described in Example 1 above.

[0708] KH2-Gata4 Dox-induced naive pluripotent stem cells (KH2-GATA4) - as described in Example 1 above.

[0709] KH2-Cdx2 Dox-induced naive pluripotent stem cells (KH2-Cdx2) – As described above, the KH2-WT cell line is a v6.5 mouse ES line in which the Rosa26 locus is targeted to express M2Rtta and the Cola1 locus is modified to be receptive in a plasmid.The plasmid has a TetOn promoter (PMID: 16400644) and an insert (in this case, Cdx2: atgtacgtgagctaccttctggacaaggacgtgagcatgtatcctagctccgtgcgccactccggcggcctgaacctggctccgcagaactttgtcagtcctccgcagtacccggactacggtggttaccacgtggcggccgcggcggctgctacggcgaacttggacagcgctcagtccccagggccatcctggcccaccgcgtacggcgcccctctccgcgaggactggaatggctacgcacccgggggcgctgcggcagccaacgcggtagcccacggtctcaatggtggctccccggccgccgctatgggctacagcagccccgccgaataccacgcgcaccatcacccgcatcatcacccgcaccatccggccgcctcgccgtcctgcgcctccggcttgctgcagacgctcaacctcggccccccggggcccgcagccaccgccgccgccgaacagctgtcccccagcggccagcggcgaaacctgtgcgagtggatgcggaagcccgcgcagcagtccctaggaagccaagtgaaaaccaggacaaaagacaaataccgggtggtgtacacagaccatcagcggctggagctggagaaggagtttcactttagtcgatacatcaccatcaggaggaaaagtgagctggctgccacacttgggctctccgagaggcaggttaaaatttggtttcagaaccgcagagccaaggagaggaaaatcaagaagaagcagcagcagcaacagcagcagcagcaacaacagcctccacagccgccgccacaaccttcccagcctcagccgggtgccctgcggagcgtgcccgagcccttgagtcctgtgacctccttgcaaggctcagtgcctggttctgtccctggggttctggggccagctggaggggttttaaactccactgtcacccagtga; SEQ ID NO: 36),The target colonies were selected by hygromycin for 10 days, and single ES colonies were selected for further analysis to generate KH2-Cdx2 (, Fig.11 Real-time PCR analysis and immunostaining confirmed that clones exhibited DOX-inducible overexpression of the Cdx2 insert ( Figure 12-14 ).

[0710] Expansion and maintenance of naive mouse PSCs - Three different mouse ES lines were expanded and maintained separately in mouse naive N2B27 2iLIF conditions: KH2 ESCs, KH2-Gata4 Dox-inducible cells (KH2-GATA4), and KH2-Cdx2 Dox-inducible cells (KH2-CDX2). Cells were expanded in N2B27 2i / LIF medium on gelatin or MEF-coated plates for at least 3 passages (10-12 days) to become naive (PMID 33915080; PMID 26860365; PMID: 26291026; PMID: 26076835; PMID 24172903; PMID 25569111) and able to successfully perform the protocols described herein. 5% O 2 and 20% O 2 Conditions were applicable (37°C and 5% CO 2 ).

[0711] N2B27 2i / LIF medium - 240 ml Neurobasal (ThermoFisher 21103049) and 240 ml DMEM-F12 (Thermo 21331-020 or SIGMAD6421), 5 ml N2 supplement (Invitrogen; 17502048), 10 ml B27 supplement (Invitrogen; 17504044), 2 mM glutamine or 1 mM GLutamax (Invitrogen), 1% non-essential amino acids (Invitrogen), 0.1 mM β-mercaptoethanol (Sigma), 1% penicillin-streptomycin (Invitrogen), 3 μM CHIR99021 (GSK3i-CH, Axon Medchem), 1 μM PD0325901 (MEK / ERKi, PD, Axon Medchem 1408) and recombinant LIF 20 ng / ml.

[0712] Aggregation Medium (AM) - As described in Example 1 above.

[0713] EUCM medium (also referred to as EUCM1) - as described in Example 1 above.

[0714] EUCM2 medium - CMRL (Gibco 11530037) or a 1:1 mixture of CMRL and Advanced DMEM / F12 (Thermo 12634010), Glutamax 1...

Claims

1. A method for producing a synthetic embryo, the method comprising: (a) inducing the expression of factors that induce differentiation into trophectoderm cells in a subpopulation of primitive pluripotent stem cells (PSCs) to obtain trophectoderm-initiated cells; as well as (b) mixing the trophectoderm-derived cells with the naive PSCs under conditions that allow the formation of aggregated cells, Wherein, when the factor inducing differentiation into trophectoderm cells is an exogenous factor, the induced expression includes induced transient expression starting from 14 days to 0 hours before the mixing and ending no later than 120 hours after the mixing; and Wherein, when the factor inducing differentiation into trophectoderm cells is an endogenous factor, the induced expression comprises: culturing the primitive PSC subpopulation under conditions capable of achieving expression of the factor starting within 14 days to 6 hours before the mixing, Thereby producing a synthetic embryo.

2. The method according to claim 1, wherein: The method further comprises: inducing the expression of factors inducing differentiation into extraembryonic primitive endoderm cells in the second subpopulation of primitive PSCs in (a) to obtain extraembryonic primitive endoderm initial state cells; and mixing the extraembryonic primitive endoderm initial state cells with the cells in (b).

3. The method according to claim 2, wherein: When the factor inducing differentiation into extraembryonic primitive endoderm cells is an exogenous factor, the induced expression includes induced transient expression starting from 14 days to 0 hours before the mixing and ending no later than 120 hours after the mixing; and Wherein, when the factor inducing differentiation into extraembryonic primitive endoderm cells is an endogenous factor, the induced expression includes: culturing the primitive PSC subpopulation under conditions capable of achieving expression of the factor starting within 14 days to 6 hours before the mixing.

4. A method for producing a synthetic embryo, the method comprising: (a) transient expression of exogenous factors that induce differentiation into trophectoderm cells in a subpopulation of naive pluripotent stem cells (PSCs) to obtain trophectoderm-initiated cells; and (b) mixing the trophectoderm-initiated cells with naive PSCs under conditions that allow the formation of aggregated cells, wherein said inducing said transient expression starts within 14 days to 0 hours before said mixing and ends no later than 120 hours after said mixing, Thus creating a synthetic embryo.

5. The method according to claim 1, wherein: The method also includes: transiently expressing exogenous factors that induce differentiation into extraembryonic primitive endoderm cells in the second subpopulation of primitive PSCs induced in (a) to obtain extraembryonic primitive endoderm initial state cells; and mixing the extraembryonic primitive endoderm initial state cells with the cells in (b).

6. The method according to any one of claims 2 to 3 and 5, wherein: The mixing of the primitive PSCs, the trophectoderm-initiation cells and the extraembryonic primitive endoderm-initiation cells is performed simultaneously.

7. The method according to any one of claims 2 to 3 and 5, wherein: The mixing of the naive PSCs and the extraembryonic primitive endoderm-initiating cells is performed prior to the mixing with the trophectoderm-initiating cells.

8. The method according to any one of claims 1 to 7, wherein: The trophectoderm cells and / or the extraembryonic primitive endoderm-initiating cells express pluripotency markers when mixed.

9. The method according to any one of claims 1 to 8, wherein: The trophectoderm-initiating cells express trophectoderm markers upon said mixing.

10. The method according to any one of claims 2 to 3 and 5 to 9, wherein The extraembryonic endoderm initiating cells express extraembryonic primitive endoderm markers upon said mixing.

11. A mixture or aggregate obtainable by a process according to any one of claims 1 to 10.

12. A mixture or aggregate comprising: (i) Naive pluripotent stem cells (PSC); (ii) trophectoderm-derived cells, wherein: The trophectoderm-initiation cells include stem cells expressing endogenous trophectoderm markers and endogenous pluripotency markers; and (iii) extraembryonic primitive endoderm-initiation cells, wherein the extraembryonic primitive endoderm-initiation cells include stem cells expressing endogenous extraembryonic primitive endoderm markers and endogenous pluripotency markers, wherein the mixture or aggregate is not structurally organized as a natural embryo at any stage of development; and Therein, the mixture or aggregate is capable of forming a synthetic embryo that is structurally organized as a natural embryo at at least the post-implantation egg cylinder stage or the bilayer disc stage of development.

13. A mixture or aggregate comprising: (i) trophectoderm-derived cells, wherein: The trophectoderm-initiated cells include stem cells expressing exogenous factors inducing differentiation into trophectoderm cells, endogenous trophectoderm markers, and endogenous pluripotency markers; and (ii) Naive pluripotent stem cells (PSCs).

14. The mixture or aggregate according to claim 13, wherein The mixture or aggregate further comprises: (iii) extraembryonic primitive endoderm-initiation cells, wherein the extraembryonic primitive endoderm-initiation cells include stem cells expressing exogenous factors inducing differentiation into extraembryonic primitive endoderm cells, endogenous extraembryonic primitive endoderm markers and endogenous pluripotency markers.

15. The method according to any one of claims 2 to 3 and 5 to 10 or the mixture or aggregate according to any one of claims 11 and 14, wherein The factors inducing differentiation into extraembryonic primitive endoderm cells include Gata4, Gata6 and / or SOX17.

16. The method according to any one of claims 2 to 3, 5 to 10 and 15, wherein The induced expression of factors inducing differentiation into extraembryonic primitive endoderm cells comprises: starting from 14 days to 6 hours before the mixing, culturing the second subpopulation of primitive PSCs with factors inducing differentiation into extraembryonic primitive endoderm cells.

17. The method according to claim 16, wherein: The factor inducing differentiation into extraembryonic primitive endoderm cells is selected from the group consisting of a GSK-3 inhibitor, a WNT ligand, heparin, FGF2, FGF4, PDGF, leukemia inhibitory factor (LIF) and insulin.

18. The method, mixture or aggregate according to any one of claims 1 to 11 and 13 to 17, wherein The factor inducing differentiation into trophectoderm cells is selected from the group consisting of Cdx2, Gata3 and Gata2.

19. The method according to any one of claims 1 to 10 and 15 to 18, wherein The inducing expression of factors that induce differentiation into trophectoderm cells comprises: starting from 14 days to 6 hours before the mixing, culturing the subpopulation of primitive PSCs with factors that induce differentiation into trophectoderm cells.

20. The method according to claim 19, wherein: The factors inducing differentiation into trophectoderm cells are selected from the group consisting of TGFR inhibitors, FGFR inhibitors, MEK / ERK inhibitors, BMP4, JAK inhibitors, ROCK pathway inhibitors, FGF4, FGF2, heparin, SUMOylation inhibitors, histone deacetylase inhibitors, HIPPO signaling pathway inhibitors and factors inducing YAP nuclear translocation.

21. The method according to any one of claims 1 to 10 and 15 to 20, wherein The induction of the transient expression begins between 120 hours and 0 hours before the mixing.

22. The method according to any one of claims 1 to 10 and 15 to 20, wherein The induction of the transient expression begins within 48 hours to 0 hours before the mixing.

23. The method according to any one of claims 1 to 10 and 15 to 22, wherein The induction of the transient expression is completed no later than 48 hours after the mixing.

24. The method according to any one of claims 1 to 10 and 15 to 23, wherein The inducing the transient expression is performed for no longer than 96 hours.

25. The method according to any one of claims 1 to 3, 6 to 10 and 15 to 24, wherein The inducing the expression of the endogenous factor begins 10 days to 1 day before the mixing.

26. The method, mixture or aggregate according to any one of claims 1 to 24, wherein: The ratio between the naive PSCs and the trophectoderm-initiated cells is between 1:1 and 1:

5.

27. The method, mixture or aggregate according to any one of claims 2 to 3, 5 to 12 and 14 to 26, wherein The ratio between the naive PSCs and the primitive endoderm-initiating cells is between 1:1 and 2:

1.

28. The method according to any one of claims 1 to 10 and 15 to 27, wherein The method further comprises, after step (b), culturing the aggregated cells ex utero.

29. A method for culturing a synthetic embryo ex utero, the method comprising culturing a mixture or aggregate according to any one of claims 11 to 15, 18 and 26 to 27 ex utero.

30. The method according to any one of claims 28 to 29, wherein: The culture is performed in a static culture followed by a dynamic culture.

31. The method according to claim 30, wherein: The static culture is performed until the embryos reach at least the early post-implantation egg cylinder stage or the bilayer disc stage.

32. The method according to any one of claims 30 to 31, wherein: The dynamic culture starts at the latest when the embryos reach the early somite stage.

33. A method for culturing synthetic embryos outside the womb, the method comprising culturing synthetic embryos in a static culture and then a dynamic culture outside the womb at an aggregation stage, wherein: The static culture is performed until the embryo reaches at least the early post-implantation egg cylinder stage or the double-layer disc stage; and the dynamic culture is started at the latest when the embryo reaches the early somite stage.

34. The method according to any one of claims 30 to 33, wherein: The dynamic culture includes shaking culture, roller culture or a sequential combination thereof.

35. The method according to any one of claims 30 to 34, wherein: The dynamic culture is performed under a high pressure of greater than 0.1 and less than 10.2 pounds per square inch (psi).

36. A method according to any one of claims 28 to 35, wherein: The culturing is carried out in an atmosphere containing 10% to 40% oxygen.

37. The method according to any one of claims 1 to 10 and 15 to 36, wherein The method also includes transferring the synthetic embryo into a uterus.

38. A method or mixture or aggregate according to any one of claims 1 to 37, wherein The cells are mammalian cells.

39. The method, mixture or aggregate according to claim 38, wherein: The mammalian cell is a mouse cell.

40. The method, mixture or aggregate of claim 38, wherein: The mammalian cell is a human cell.

41. The method, mixture or aggregate of claim 38, wherein: The mammalian cell is a non-human primate cell.

42. A synthetic embryo obtainable by the method according to any one of claims 1 to 10, 15 to 36 and 38 to 41.

43. A method for obtaining extraembryonic primitive endoderm initiating cells, the method comprising: In a basal medium without activin A, the naive PSCs were allowed to differentiate into GATA4 + GATA6 + OCT4 + Nanog - Under the conditions of extraembryonic primitive endoderm-initiation cells, primitive PSCs are cultured to obtain extraembryonic primitive endoderm-initiation cells.

44. The method of claim 43, wherein: The culturing is performed for at least 1 day.

45. The method according to any one of claims 43 to 44, wherein: The culturing is performed for no longer than 10 days.

46. ​​The method according to any one of claims 43 to 44, wherein: The cells were able to expand in culture for at least five generations while maintaining the GATA4 + GATA6 + OCT4 + Nanog - Phenotype.

47. A method according to any one of claims 43 to 46, wherein: The basal medium is supplemented with at least one of a GSK-3 inhibitor, leukemia inhibitory factor (LIF), and insulin.

48. The method according to any one of claims 43 to 46, wherein: The basal medium is supplemented with at least one of a GSK-3 inhibitor, heparin, FGF4, PDGF, and BSA.

49. A method according to any one of claims 43 to 45 and 46 to 48, wherein The cells are human cells.

50. The method according to any one of claims 43 to 48, wherein: The cells are mouse cells.

Images