Lentinus edodes ABC transporter gene LeABC2 and application thereof in regulation and control of heat resistance of Lentinus edodes

Abstract

The invention belongs to the technical field of fungal gene engineering, and discloses a shiitake mushroom ABC transporter gene LeABC2 and application thereof in regulation and control of shiitake mushroom heat resistance. Whole genome association analysis is carried out based on heat resistance phenotype data of 133 shiitake mushroom strains, a candidate gene LeABC2 for regulating heat resistance is obtained, a LeABC2 gene RNA interference vector is constructed, the gene function is researched through an agrobacterium tumefaciens-mediated genetic transformation method, and the result shows that the LeABC2 gene negatively regulates the heat resistance of shiitake mushroom hyphae, the heat resistance of the hyphae can be improved by interfering the expression of the gene, and the gene has a good application prospect. A new solution thought is provided for breaking through the problem that the yield and quality are influenced by high temperature in the mushroom industry.

Description

Technical Field

[0001] The invention belongs to the technical field of fungal gene engineering, and particularly relates to a shiitake mushroom ABC transporter gene LeABC2 and an application thereof in regulating the heat resistance of shiitake mushrooms. Background Art

[0002] Shiitake mushrooms are one of the main cultivated edible fungi in my country, with high edible value, nutritional value and economic value. Temperature is one of the important conditions in the growth and development of organisms. When the temperature rises above the threshold level for a period of time, it will cause irreversible damage to the growth and development of organisms. This damage is called high temperature stress. When the temperature rises sharply to 10-15°C higher than the outside temperature, it can cause the active oxygen of various organisms, including edible fungi, to oxidize the biofilm, produce a variety of unsaturated aldehydes and ketones with harmful effects, cause protein denaturation, destroy the stability of cell membranes, and cause a series of physiological disorders.

[0003] According to the adaptability of the mycelium stage, the temperature requirements of edible fungi can be divided into three types: low temperature type, medium temperature type and high temperature type (Bian Yinbing. Edible Fungi Cultivation (3rd Edition). Beijing: Higher Education Press. 2017, 138-140). Different types of edible fungi have obvious differences in their optimum growth temperatures. In addition, some thermophilic edible fungi need a certain temperature difference to stimulate the development of fruiting bodies during their growth and development. Suitable temperature plays an important role in the growth and development of edible fungi. Agaricus bisporus is sensitive to high temperature during cultivation. When the temperature exceeds 32°C, the growth of mycelium is restricted, resulting in poor fruiting body quality, slender stipes, and easy opening of umbrellas (Chen R. et al. Identification of twothermotolerance-related genes in Agaricus bisporus. Food Technology and Biotechnology, 2003, 41 (4): 339-344.). Pleurotus ostreatus can accelerate the development of fruiting bodies under high temperature, but the hyphae are easily twisted and broken, the cap becomes thinner, and the weight decreases, resulting in a decrease in yield (Jue Chao. Research on the effects of high temperature stress on the physiological and biochemical characteristics of Pleurotus ostreatus [Master's degree thesis]. Henan Agricultural University. 2011; Yan Zhiyu. Core carbon metabolism response of Pleurotus ostreatus under high temperature stress [PhD thesis]. Chinese Academy of Agricultural Sciences. 2020.). When the temperature of Stropharia cap mushroom exceeds 19.4℃ during the fruiting period, the number of mushrooms produced per unit area of ​​Stropharia cap mushroom decreases rapidly, and there are significant differences in indicators such as the cap diameter and thickness of the fruiting body (Bao Rui. Research on key technologies for high-yield cultivation of Stropharia cap mushroom [Master's degree thesis]. Northwest A&F University. 2015.).

[0004] Shiitake mushrooms are low-temperature temperature-dependent mushrooms, and their growth and development process has high temperature requirements. The optimum temperature for spore germination of Shiitake mushrooms is 22-26°C, the optimum temperature for mycelium growth is 24-27°C, the optimum temperature for primordium differentiation is 10-12°C, and the optimum temperature for fruiting body development is 8-20°C (Zhang Baofen. Breeding of high-temperature resistant strains of Shiitake mushrooms. [Master's thesis]. Nanjing Agricultural University. 2014). At 24-27°C, the growth rate of Shiitake mycelium is the fastest, but due to the high enzyme activity in the mycelium, vigorous metabolism, fast material consumption, and easy aging of mycelium, in actual production, 20-24°C is usually used to cultivate strong mycelium (Jiang Yu et al. Analysis of temperature requirements and control measures for Shiitake mushroom growth. Henan Agriculture, 2018(26):14-16).

[0005] High temperature environment will have a significant impact on the growth and development of shiitake mushrooms. Shiitake mushroom mycelium has poor tolerance to high temperatures. High temperatures above 34°C often lead to the stagnation of mycelium growth and development, and even cause mycelium damage and death (Li Wenwu et al. Temperature requirements and control measures for shiitake mushroom growth. Edible Fungi, 2013, 35(02): 51-52.). During the fruiting body growth stage, temperature control directly affects the yield and quality of shiitake mushrooms. Excessive temperature will lead to a decrease in enzyme activity in the fruiting body, weakened nutrient transport capacity, increased respiration intensity, and aggravated self-consumption (Jiang Yu et al. Analysis of temperature requirements and control measures for shiitake mushroom growth. Henan Agriculture, 2018(26): 14-16.).

[0006] Through long-term evolution, fungi have developed a self-protection mechanism to resist high temperatures. Reactive oxygen species (ROS) can act as signal substances to participate in the resistance to heat stress (Zhang Xue. Heat stress is mediated by intracellular Ca 2+and ROS regulate HSP expression, hyphal growth and secondary metabolism of Ganoderma lucidum [Master's thesis]. Nanjing Agricultural University. 2016.), high temperature stress can regulate the accumulation of ROS in hyphae. The increase of intracellular ROS will activate the ROS scavenging system and activate the antioxidant defense system to alleviate the oxidative damage caused by high temperature stress (Liu R. et al. Heat stress-induced reactive oxygen species participate in the regulation of HSPexpression, hyphal branching and ganoderic acid biosynthesis in Ganoderma lucidum. Microbiological Research, 2018, 209: 43-54; Chang Tingting et al. Research progress on high temperature stress response of edible and medicinal fungi. Journal of Edible Fungi. 2021, 28(1): 124-134.). Trehalose will continue to accumulate in edible fungi cells under high temperature. In Pleurotus ostreatus, trehalose can alleviate the accumulation of lactic acid, downregulate the expression of pyruvate kinase (PK) and phosphofructokinase (PFK) genes, and improve the glycolysis process of Pleurotus ostreatus under heat stress (Xu Ruiping. Analysis of auxin signal transduction pathway under heat stress of Lentinula edodes and preliminary exploration of CRISPR-Cas9 gene editing system [PhD dissertation]. Huazhong Agricultural University, 2023.). Under shock response, heat shock proteins (HSPs) can be rapidly and massively synthesized, acting as molecular chaperones. Heat shock proteins can be divided into six categories: small molecule sHSP family, HSP40 family, HSP60 family, HSP70 family, HSP90 family, and large molecule HSP family. These heat shock proteins can bind to intracellular denatured proteins, prevent irreversible denaturation of intracellular proteins, degrade misfolded proteins, help repair incorrect proteins, avoid protein denaturation, alleviate heat shock stress, and improve cell resistance (Singh A. et al. Plant Hsp100 / ClpB-like proteins: poorly-analyzed cousins ​​of yeast ClpB machine. Plant Molecular Biology, 2010, 74(4-5): 395-404.; Fu Qingxian et al. Research progress on the role of heat shock protein 60 in nervous system diseases. International Journal of Neurology and Neurosurgery. 2019, 46(3): 341-345.).By using soluble sugars to regulate mitochondrial activity and antioxidant processes, and calmodulin (CDPK) to regulate calcium signals, fungi can also control the rate of ROS production and affect their metabolic processes, thereby improving their ability to withstand high temperatures (Keunen E. et a1. Plant sugars are crucial players in the oxidative challenge during abiotic stress: extending the traditional concept. Plant Cell Environment, 2013, 36: 1242-1255; Asano T. et a1. A rice calcium-dependent proteinkinase OsCPKl2 oppositely modulates salt-stress tolerance and blast disease resistance. Plant Journal, 2012, 69: 26-36).

[0007] In recent years, there have been multiple outbreaks of mushroom rot caused by high temperature stress and subsequent infection with Trichoderma in the main mushroom producing areas of Hubei and Guizhou, my country, resulting in damage to mushroom production and quality, and causing huge economic losses to mushroom production companies and cooperatives (Zhao Caixia et al. Causes and control of mushroom rot. Hubei Plant Protection. 2020(05):45-47.; Wang Ying. Identification of pathogenic fungi and preliminary study on the occurrence law of mushroom rot in Guizhou [Master's thesis]. Guizhou University. 2022.). Therefore, studying the molecular mechanism of heat resistance of mushrooms, exploring heat-resistant genes, and cultivating heat-resistant mushroom varieties are of great significance for solving the problem of mushroom rot caused by high temperature.

[0008] ABC (ATP-binding cassette) transporters, also known as ATP-binding cassette proteins, are a superfamily of membrane-integrated proteins that are commonly found in prokaryotic and eukaryotic cells (Verrier PJ. et al. Plant ABC proteins-a unified nomenclature and updated inventory. Trends in Plant Science, 2008, 13(4): 151-159). The ABC transporter family is the largest family of transmembrane proteins that bind ATP and use energy to drive the active transport of different molecules against the concentration gradient across all cell membranes (Dean M. et al. Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates. Annual Review of Genomics and Human Genetics, 2005, 6: 123-142; Higgins CF. ABC transporters: from microorganisms to man. Annual Review of Cell Biology, 1992, 8: 67-113; Dean M. et al. The human ATP-binding cassette (ABC) transporter superfamily. Journal of Lipid Research, 2001, 42 (7): 1007-1017). ABC transporters have two nucleotide-binding domains (NBDs) and two transmembrane binding domains (TMDs) (Verrier P. et al. Plant ABC proteins--a unified nomenclature and updated inventory. Trends in Plant Science, 2008, 13(4): 151-159).Among the numerous types of ABC transporters, the structure and sequence of NBD are highly conserved (Davidson AL. et al. Structure, function, and evolution of bacterial ATP-binding cassette systems. Microbiology and Molecular Biology Reviews, 2008, 72 (2): 317-364). However, the TMD sequence similarity of ABC transporters is very low. The NBD domain is responsible for binding ATP. When ATP is hydrolyzed, its conformation changes, thereby activating the transport process, while the TMD domain forms a channel to allow the substrate to pass through the lipid bilayer. The coordinated action of the two ultimately achieves the transport of substances (Davidson AL. et al. ABC transporters: how small machines do a big job. Trends in Microbiology, 2007, 15 (10): 448-455). At present, in plant cells, ABC transporters play a key role in plant hormone transport, plant anther development, detoxification of exogenous toxins, lipid metabolism, plant disease resistance, etc. (Wu Zheng et al. Effect of ABC transporters on plant anther development. Molecular Plant Breeding. 2024, https: / / link.cnki.net / urlid / 46.1068.S.20240312.1759.022). In arthropods, ABC transporters play an important role in detoxification and can actively reduce the overall contact of cells and organisms with endogenous toxins and xenobiotic toxins (including pesticides) (Amezian D. et al. The role of ATP-binding cassette transporters in arthropod pesticide toxicity and resistance. Current Opinion in Insect Science, 2024, 63: 101-200). In plant pathogenic fungi, ABC transporters can participate in the pathogenic process of fungi and affect the interaction between pathogens and hosts (Chen Daobo et al. Research progress on the structure and function of ABC transporters in plant pathogenic fungi. Progress in Biochemistry and Biophysics, 2021, 48(03): 309-316.). At present, many studies at home and abroad have focused on the functions of ABC transporters in plants, animals, and pathogens, but there are relatively few studies on their functions in edible fungi, and the role of ABC transporters in heat resistance is still unclear.

[0009] The present invention locates the ABC transporter gene (LeABC2) of Lentinus edodes as a gene related to the heat resistance of mycelium through whole genome association analysis, and uses RNA interference technology to study the function of the LeABC2 gene in the heat resistance of Lentinus edodes, providing a new solution to the problem of high temperature affecting the yield and quality in the Lentinus edodes industry. Summary of the invention

[0010] The object of the present invention is to provide a gene LeABC2 for regulating heat resistance cloned from Lentinus edodes, the full length of the gene is 5715bp, the sequence is shown in SEQ ID NO.1, the length of the open reading frame is 4437bp, the sequence is shown in SEQ ID NO.2, and the encoded amino acid sequence is shown in SEQ ID NO.3.

[0011] The second object of the present invention is to provide an application of an ABC transporter gene LeABC2 in regulating the heat resistance of Lentinus edodes. An RNA interference expression vector of the gene is constructed and transferred into Lentinus edodes through an Agrobacterium-mediated genetic transformation method. Interference with the expression of the gene can improve the heat resistance of mycelium.

[0012] In order to achieve the above object, the present invention adopts the following technical solutions:

[0013] 1. Gene cloning

[0014] Using the genome data of Lentinus edodes monokaryon Wpm-4 as the reference sequence, gene primers LeABC-DNA-F: 5'-TGGCTGTGGACAGTCTCTACAGTAT-3' and LeABC-DNA-R: 5'-GTCTAATACTACTTTAGAAC-3', cNDA primers: LeABC-cDNA-F: 5'-TGGCTGTGGACAGTCTCTACA-3' and LeABC-cDNA-R: 5'-GTCTAATACTACTTTAGAACG-3' were designed. Using the DNA of Lentinus edodes cultivated strain Wpm-4 as a template, the full-length gene sequence of LeABC2 (SEQ ID NO.1) was amplified, and using the cDNA of Wpm-4 strain as a template, the cDNA sequence of LeABC2 (SEQ ID NO.2) was amplified.

[0015] 2. Construction of gene interference (RNAi) vector

[0016] RNAi vector construction: According to the nucleotide sequences at both ends of the restriction site, the recombination primers ABC-RNAi-F: 5'-attgactgcttgaatggtaccCACACGAGGGCTCAGTCGC-3' and ABC-RNAi-R: 5'-ctcgcagctcttcacgaattcGCAGTTTGCTGCAGACCCA-3' were designed to amplify the LeABC2 conservative region fragment (SEQ ID NO.4). The linearized fragment pCAMBIA1300-g, Legpd promoter fragment, Leactin promoter fragment, and LeABC2 gene conservative region fragment were homologously recombined by the one-step cloning method and transformed into Escherichia coli competent cells Trans-T1. The positive clones were sequenced and detected using primers ABC-RNAi-F and ABC-RNAi-R. The vector plasmid of the positive clone was extracted, which was the recombinant interference vector LeABC2-RNAi ( Figure 3 B).

[0017] 3. Genetic transformation and phenotypic analysis of Lentinula edodes

[0018] Agrobacterium-mediated genetic transformation was used to transform the heat-resistant strain S606 of Lentinula edodes. After three screenings, stable RNAi positive transformants were obtained ( Figure 4 The wild type, control empty vector, and RNAi transformant were heat-shocked at 36, 37, 38, 39, 40, and 41°C for 24 h, and then cultured at 25°C to observe the recovery of mycelial growth.

[0019] Experiments have shown that compared with the control empty-load strain, under the same high temperature stress, the RNAi strain can resume growth faster and the growth rate is increased by 2-3 times. The critical temperature of high temperature stress is 1°C higher for the RNAi strain than for the wild-type strain S606.

[0020] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0021] The present invention is the first to disclose the role of the LeABC2 gene in regulating the heat resistance of shiitake mushrooms at home and abroad. Based on the heat resistance phenotypic data of 133 shiitake mushroom strains, a whole genome association analysis was performed to obtain the candidate gene LeABC2 that regulates heat resistance. The LeABC2 gene RNA interference vector was further constructed, and the function of the gene was studied by Agrobacterium-mediated genetic transformation. The results showed that the RNAi strain had stronger heat resistance than the wild-type heat-resistant strain, and the recovery ability under high temperature stress was significantly enhanced. The LeABC2 gene negatively regulated the heat resistance of shiitake mushroom mycelium, providing a new gene resource for breaking through the problem of high temperature affecting yield and quality in the shiitake mushroom industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The results of genome-wide association analysis of heat tolerance traits. The red horizontal line indicates the significant association site detected by the association analysis, and the genes within ±2kb are candidate genes associated with the trait. LeABC2 is located within ±2kb of the association site indicated by the black arrow.

[0023] Figure 2 Sequence and structure analysis of LeABC2 protein.

[0024] Figure 3 Maps of vector plasmid pCAMBIA1300-g (A) and recombinant vector LeABC2-RNAi (B).

[0025] Figure 4 The expression level of LeABC2 gene in LeABC2-RNAi transformants was detected by qRT-PCR. S606 is the wild-type strain, CK is the control with empty vector insertion, and R-1, R-2, and R-3 are three RNAi transformants.

[0026] Figure 5 The growth of wild-type and transformant strains after heat stress at different temperatures. S606 is the wild-type strain, CK is the control with no insertion, and R-1, R-2, and R-3 are three RNAi transformants.

[0027] Figure 6 is the mycelial growth rate of wild-type and transformant strains after heat stress. S606 is the wild-type strain, CK is the control with empty vector insertion, and R-1, R-2, and R-3 are three RNAi transformants. DETAILED DESCRIPTION

[0028] Unless otherwise specified, the methods used in the following examples are conventional biological experimental methods. The primers used were synthesized by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd., and the sequencing was completed by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. pEASY-Basic Seamless Cloning and Assembly Kit was purchased from TransGen, restriction endonucleases were purchased from NewEngland Biolabs, hygromycin B was purchased from Roche, Switzerland, and kanamycin (Kan +), rifampicin (Rif), cefotaxime (Cef) and acetosyringone (AS) were purchased from Qingjiang Biotechnology Co., Ltd., San Prep column DNA recovery kit was purchased from Shanghai Huiling Biotechnology Co., Ltd., and RNAiso Plus was purchased from Bao Biotechnology (Dalian) Co., Ltd. The genome data of the shiitake monokaryon Wpm-4 used in the experiment was the sequencing result of the inventor's research group. Shiitake mushroom strains S606 and Wpm-4, Escherichia coli competent Trans-T1, Agrobacterium competent EHA105, vector plasmid pCAMBIA1300-g (the original 35S promoter of the pCAMBIA1300 vector was replaced by the shiitake mushroom Legpd promoter to start the expression of the hygromycin phosphotransferase gene hph), etc., were all preserved in the inventor's laboratory. Example 1 Cloning of LeABC2 gene

[0029] The ability of 133 shiitake mushroom strains to recover growth under high temperature stress was systematically measured to examine their heat tolerance phenotype. Further genome-wide association analysis revealed that LeABC2 (ABC gene of shiitake mushroom) is an important candidate gene for regulating heat tolerance of shiitake mushrooms ( Figure 1 ).

[0030] Based on the genome data of Lentinus edodes monokaryon Wpm-4 as the reference sequence, the primers LeABC-DNA-F: 5'-TGGCTGTGGACAGTCTCTACAGTAT-3' and LeABC-DNA-R: 5'-GTCTAATACTACTTTAGAAC-3' were designed with the cultivated strain Wpm-4 DNA as the template, and the DNA sequence of the ABC transporter gene (SEQ ID NO.1) was obtained by amplification and sequencing. PCR amplification system: 2×Phanta Max Buffer 25μL, primers (10μmol / L) 2μL each, dNTP Mix (10mmol / L) 1μL, Phanta Max Super-Fidelity DNA Polymerase (1U / μL) 1μL, template 200ng, supplemented with ddH2O to 50μL. Reaction parameters: 95℃ pre-denaturation for 3min; 95℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 6min, cycle number 34; 72℃ complete extension for 10min.

[0031] Using the cDNA of Wpm-4 strain as a template, primers were designed: LeABC-cDNA-F: 5'-TGGCTGTGGACAGTCTCTACA-3' and LeABC-cDNA-R: 5'-GTCTAATACTACTTTAGAACG-3', and the cDNA sequence of the ABC transporter gene (SEQ ID NO.2) was obtained by amplification and sequencing. Reaction parameters: 95℃ pre-denaturation for 3min; 95℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 5min, cycle number 34; 72℃ thorough extension for 10min.

[0032] The basic physicochemical properties of LeABC2 protein were analyzed. The results showed that LeABC2 gene encodes 1478 amino acids. The amino acid sequence is shown in SEQ ID NO.3. The protein molecular formula is C 7376 H 11458 N 1970 O 2137 S 56 The relative molecular mass is 163721.39, the theoretical isoelectric point is 8.09, the instability coefficient is 41.09, the aliphatic index is 86.21, and the overall average hydrophobic index is -0.027. Therefore, LeABC2 is an unstable hydrophilic protein.

[0033] LeABC2 protein functions as a dimer and consists of four domains, namely two highly conserved ATP binding domains (ABC) and two transmembrane domains (TMD). Figure 2 A). LeABC2 protein may have 12 transmembrane structures, located at 510-532bp, 545-567bp, 594-616bp, 623-645bp, 655-674bp, 759-781bp, 1172-1194bp, 1207-1229bp, 1259-1281bp, 1288-1310bp, 1315-1334bp, 1439-1461bp ( Figure 2 B). Signal peptide analysis of the protein sequence showed that LeABC2 protein did not have a signal peptide and was a non-secretory protein ( Figure 2 C).

[0034] Example 2 Construction of gene interference (RNAi) vector

[0035] The plasmid pCAMBIA1300-g was double-digested with Eco RI and Kpn Ⅰ, and the recovered fragments were detected by 1% agarose gel electrophoresis. According to the nucleotide sequences at both ends of the restriction site, the recombinant primers ABC-RNAi-F: 5'-attgactgcttgaatggtaccCACACGAGGGCTCAGTCGC-3' and ABC-RNAi-R: 5'-ctcgcagctcttcacgaattcGCAGTTTGCTGCAGACCCA -3' were designed to amplify the 464bp long LeABC2 conservative region fragment (SEQ ID NO.4). The reaction parameters were: 95℃ pre-denaturation for 3min; 95℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 30s, cycle number 34; 72℃ thorough extension for 10min. The PCR amplification product was purified and recovered. The recombination primers LeActin-F: 5'-ccacctcaaacttcggaattcGCAGTATTTATACCTACGGAGCG-3'G and LeActin-R: 5'-tcttccgagCGTGAAGAGCTGCGAGTGTTG-3' were used to amplify the promoter fragment of Lentinula edodes Leactin. The PCR amplification product was purified and recovered. The linearized fragment pCAMBIA1300-g, the Legpd promoter fragment, the Leactin promoter fragment, and the ABC transporter gene conservative region fragment were homologously recombined by one-step cloning (100 ng of the linearized fragment pCAMBIA1300-g, 50 ng of the Leactin promoter, 40 ng of the Legpd promoter, 20 ng of the LeABC conservative fragment, 5 μL of 2×Basic AssemblyMix, supplemented with ddH2O to 10 μL). The reaction was carried out at 50°C in a PCR instrument for 15 minutes, and the reaction system was transferred to the competent E. coli cell Trans-T1. The positive clones were sequenced with primers ABC-RNAi-1-F and ABC-RNAi-1-R, and sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the positive clone gene fragment had 100% similarity with the reference sequence. The vector plasmid of the positive clone was extracted, which was the recombinant interference vector ABC-RNAi.

[0036] Example 3 Gene interference (RNAi) vectors are transferred into Agrobacterium

[0037] The recombinant vectors ABC-RNAi and pCAMBIA1300-g(CK) constructed above were transformed into Agrobacterium competent cells EHA105 using the freeze-thaw method. The steps are as follows:

[0038] 1) Take the competent Agrobacterium cells stored at -80°C, wait for them to melt and become a mixture of ice and water, and then insert them into ice;

[0039] 2) Add 5 μL of plasmid DNA to every 100 μL of competent cells, stir the tube bottom to mix, and place on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min.

[0040] 3) Add 900 μL of LB medium without antibiotics and culture in a shaking incubator at 28°C for 3.5 h;

[0041] 4) Centrifuge at 5000r / min for 3min, take about 100μL of supernatant, blow to resuspend the bacterial block, and spread it on the plate containing 50μg / mL Kan + and 20 μg / mL Rif on LB medium plates;

[0042] 5) Invert and culture in a 28°C incubator for 2-3 days, about 60 hours;

[0043] 6) Detect RNAi positive clones using primers ABC-RNAi-1-F and ABC-RNAi-1-R;

[0044] 7) Shake the positive monoclonal strain to an OD of 600 =1.8-2.0, add an equal volume of 50% glycerol and store in a -80°C refrigerator for subsequent research.

[0045] Example 4 Genetic transformation and phenotypic analysis of Lentinus edodes

[0046] The heat-resistant strain S606 of Lentinus edodes was used as the recipient strain for Agrobacterium-mediated genetic transformation. The method was as follows: the stored Agrobacterium culture containing the recombinant vector ABC-RNAi and the plasmid pCAMBIA1300-g was added to 1 mL of liquid LB medium (containing 50 μg / mL Kan + , 20 μg / mL Rif), and activated in a shaker at 28°C and 200 r / min for 1 day. Add the activated Agrobacterium culture solution to 100 mL of basic medium MM (50 μg / mL Kan + ) and cultured at 28°C and 200 r / min for 24 h. Centrifuge at 4°C and 5000 r / min for 10 min and discard the supernatant. Add acetosyringone (AS) to the induction medium IM to a final concentration of 200 μmol / L, and resuspend the cells with an appropriate amount of induction medium to obtain an initial OD of 2. 600 The bacterial solution was placed in a shaker at 28°C and 200 r / min for 2.5 h to make the OD 600 About 0.8.

[0047] The mycelium of Lentinus edodes strain S606 was activated in advance on MYG medium. After about 7 days, the mycelium was scraped off with a sterilized pipette tip and the above OD 600About 0.8% of Agrobacterium liquid was immersed for infection for 25 minutes, and the mycelium was gently shaken every 5 minutes to ensure uniform infection of the mycelium. Carefully drain the liquid, inoculate the mycelium block on the co-culture medium Co-IM (containing 200μmol / L AS), and culture at 25℃ for 2 days. After 2 days of co-culture, pick the mycelium block from the culture medium, soak it in sterile water containing 400μg / ml cefotaxime (Cef) for 20 minutes, shake it every 5 minutes, and wash off the Agrobacterium on the surface of the mycelium. Carefully drain the water, inoculate the mycelium block on the MYG medium containing 6μg / mL hygromycin and 400μg / mL Cef, and culture it at 25℃ for 15 days for the first screening.

[0048] Select the mycelium that germinated after the first screening, use a sterilized pipette to take the mycelium block, inoculate it on the MYG medium with 6μg / mL hygromycin, 6-7 mycelium blocks can be inoculated on each plate, culture at 25℃ for 7d, and perform the second screening. Select the mycelium that germinated after the second screening, use a sterilized pipette to take the mycelium block, inoculate it on the MYG medium with 6μg / mL hygromycin, 1 mycelium block can be inoculated on each plate, culture at 25℃ for 7d, and perform the third screening. The strains that can still grow after three screenings are regarded as presumed positive transformants, and their DNA and RNA are extracted to prepare for the next experiment.

[0049] Minimal Media (MM): K-buffer 10 mL, MN buffer 20 mL, 20% glucose (w / v) 10 mL, 0.01% FeSO4 (w / v) 10 mL, 20% (NH4)2SO4 (w / v) 2.5 mL, 1% CaCl 2· 2H2O (w / v) 1mL, ddH2O 1L, adjust pH to 6.7-7.0 with H3PO4 or NaOH.

[0050] Induction Media (IM): K-buffer 10 mL, MN buffer 20 mL, 20% glucose (w / v) 5 mL, 0.01% FeSO4 (w / v) 10 mL, 20% (NH4)2SO4 (w / v) 2.5 mL, 1% CaCl 2· 2H2O (w / v) 1mL, 50% glycerol (w / v) 10mL, 7.808g MES (40mmol / L, MW 195.2), ddH2O 1L, adjust pH to 5.6 with H3PO4 or NaOH.

[0051] Co-induction Media (Co-IM): K-buffer 10 mL, MN buffer 20 mL, 20% glucose (w / v) 2.5 mL, 0.01% FeSO4 (w / v) 10 mL, 20% (NH4)2SO4 (w / v) 2.5 mL, 1% CaCl 2· 2H2O (w / v) 1mL, 50% glycerol (w / v) 10mL, 7.808g MES (40mmol / L, MW 195.2), agar 20g, ddH2O 1L, adjust pH to 5.6 with H3PO4 or NaOH.

[0052] Example 5 PCR and real-time fluorescence quantitative PCR to identify positive transformants

[0053] The strains that can still grow after three screenings are considered as presumptive positive transformants. After culturing on MYG medium with cellophane at 25℃ for 7 days, the mycelia are collected, and the total DNA is extracted by CTAB method. The transformants are verified by PCR amplification. The hygromycin primers GPD-F: TTCGTTTCAGGCCTTGCCTC and HYG-R: CGGTGTCGTCCATCACAGTT are used for PCR verification. The recombinant interference vector ABC-RNAi is used as a positive control, and the S606 wild type, empty DNA, and water are used as negative controls. Reaction parameters: 95℃ pre-denaturation for 3min; 95℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 1min 30s, cycle number 27; 72℃ thorough extension for 10min. The transformants that can amplify the 1242bp target fragment are preliminarily identified as positive transformants.

[0054] The positive transformants screened were cultured on MYG medium with cellophane at 25°C for 7 days, and then the mycelia were collected. Total RNA was extracted using the RNAiso Plus kit (TaKaRa) and reverse transcribed using the HiScript II One Step RT-PCR Kit (Vazyme). Real-time quantitative PCR (qRT-PCR) was performed using the AceQTM qPCR SYBR Green Master Mix (Takara) kit in the CFX Connect Real-Time PCR System (BIO-RAD). The reverse transcribed cDNA was diluted 10 times and used as a template.

[0055] The quantitative primers were qPCR-F: 5'-TGGTATTGGACCGTTGGATTT-3', qPCR-R: 5'-CGGCGAAAGAGACATAGTAGAAG-3'. The internal reference gene was Leactin, the internal reference primers were LY-Leactin-F: 5'-GCATCCTGTCCTTCTTACCGAG-3', LY-Leactin-R: 5'-AAGAGCGAAACCCTCGTAGATG-3', and the control was the S606 strain transformant into which the empty vector was introduced. The relative expression of the gene was calculated using 2 -ΔΔCT (Luo et al.Selection and validation of references for qRT-PCR in Lentinula edodes under different experiment conditions.2019,Genes,10(9),647.)

[0056] The qRT-PCR reaction system was: AceQTM qPCR SYBR Green Master Mix 5μL, primers (10μM) 0.5μL each, cDNA 3μL, ddH2O 1μL. Reaction parameters: 95℃ pre-denaturation 5min, 95℃ denaturation 10s, 60℃ annealing 30s, 72℃ extension 30s, 40 cycles; the temperature of the melting curve was set at 65℃ to 95℃, and the data was read every 0.5℃.

[0057] According to the quantitative results, the wild-type strain S606, a control transformant (CK) transformed with an empty vector, and three RNAi transformants (R-1, R-2, and R-3) were finally selected for subsequent phenotypic experiments ( Figure 4 ).

[0058] Example 6 Determination of heat resistance of ABC-RNAi transformants

[0059] The wild type, empty control, and positive transformants of S606 cultured at 25°C for 5 days were heat-shocked at 36°C, 37°C, 38°C, 39°C, 40°C, and 41°C for 24 h, and then cultured at 25°C to observe the recovery of mycelial growth ( Figure 5 ). Under the temperature condition of 36-38℃, the wild type, empty control and RNAi transformants of S606 can all resume growth within 5 days after heat shock. Under the same time, the mycelial recovery growth rate of transformants RNAi-2 and RNAi-3 was significantly higher than that of the wild type strain ( Figure 6). Under 39℃ heat shock conditions, the empty control strain stopped growing, while the S606 wild type and transformant RNAi-2 could resume growth within 5 days after heat shock. After 40℃ heat shock, the wild type and empty control strain could not resume growth, while transformants RNAi-1, RNAi-2, and RNAi-3 could resume growth within 10 days after heat shock. After 41℃ heat shock, the wild type, CK, and transformants could not resume growth ( Figure 5 ).

[0060] Experiments have confirmed that compared with the control empty-load strain, under the same high temperature stress, the RNAi strain can resume growth faster, and the growth rate is increased by 2-3 times. For the critical temperature of high temperature stress, the RNAi strain is 1°C higher than the wild-type strain S606. After interfering with the expression of the Le-ABC2 gene, the heat resistance of the mushroom mycelium is enhanced, and the strain resumes growth earlier after heat shock.

Claims

1. Shiitake Mushrooms LeABC2 A gene characterized by The cDNA sequence of the gene is shown as SEQ ID NO.

2.

2. The shiitake mushroom according to claim 1 LeABC2 The encoded protein of the gene is characterized in that The amino acid sequence of the protein is shown in SEQ ID NO.

3.

3. Containing the mushroom according to claim 1 LeABC2 Genetic biological material, characterized in that The biological materials include expression cassettes, expression vectors and recombinant bacteria.

4. The shiitake mushroom according to claim 1 LeABC2 Gene, or the mushroom according to claim 2 LeABC2 The protein encoded by the gene, or the protein described in claim 3 LeABC2 Application of genetic biomaterials in regulating the heat tolerance of Lentinus edodes.

5. A method for improving the heat resistance of shiitake mushrooms, characterized in that: Using RNA interference to inhibit the method of claim 1 in shiitake mushrooms LeABC2 Gene expression.

6. The method according to claim 5, characterized in that Build LeABC2 A gene RNA interference vector, wherein the RNA interference vector contains the fragment shown in SEQ ID NO.4, and the RNA interference vector is transferred into shiitake mushrooms through an Agrobacterium-mediated genetic transformation method.

Images