A SNP molecular marker related to the antioxidant stress resistance of tibetan sheep and application thereof

By detecting the genotype of specific SNP loci on the Tibetan sheep genome, the challenges of assessing oxidative stress capacity and breeding in Tibetan sheep have been solved, improving selection efficiency and accuracy, and providing new SNP molecular marker resources.

CN119372329BActive Publication Date: 2026-05-29NORTHWEST UNIVERSITY FOR NATIONALITIES
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NORTHWEST UNIVERSITY FOR NATIONALITIES
Filing Date
2024-10-30
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

The lack of effective molecular markers in existing technologies to assist in the assessment and breeding of Tibetan sheep's oxidative stress capacity in high-altitude environments leads to low breeding efficiency.

Method used

A SNP molecular marker located at the 196,714,361st base on chromosome 3 of the Oar_v4.0 version of the international sheep genome is provided, with the mutated base being A or C. By detecting the association between the genotype of Tibetan sheep and the antioxidant stress index T-AOC, individuals of Tibetan sheep with strong antioxidant stress capacity can be screened.

Benefits of technology

This study enabled efficient assessment and breeding assistance of the oxidative stress capacity of Tibetan sheep, improved the accuracy and efficiency of breeding selection, and provided new SNP molecular marker resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119372329B_ABST
    Figure CN119372329B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of molecular markers, and particularly relates to a SNP molecular marker related to the anti-oxidative stress capacity of Tibetan sheep and application thereof.A SNP molecular marker related to the anti-oxidative stress capacity of Tibetan sheep, the molecular marker is located at the 196714361th base on the 3rd chromosome of the international sheep genome Oar_v4.0 version, and the mutation base is A or C.Through detecting the base of the 196714361th nucleotide site on the 3rd chromosome of the Tibetan sheep, the anti-oxidative stress index T-AOC content of the Tibetan sheep individual can be judged, and the present application provides a new SNP molecular marker resource for the marker-assisted selection of the anti-oxidative stress trait of the Tibetan sheep for non-diagnostic purposes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, and in particular to an SNP molecular marker related to the antioxidant stress capacity of Tibetan sheep and its application. Background Technology

[0002] Tibetan sheep are an important part of grassland animal husbandry in the high-altitude pastoral areas of the Qinghai-Tibet Plateau. The Qinghai-Tibet Plateau is characterized by high altitude, low air pressure, strong ultraviolet radiation, and hypoxia. Due to the harsh environment, Tibetan sheep experience a series of non-specific reactions, primarily immune stress, cold stress, and oxidative stress, with oxidative stress being the most significant. Stimulants disrupt the dynamic balance between the oxidative and antioxidant systems in Tibetan sheep. Antioxidants in organisms mainly consist of two categories: antioxidant enzymes and non-enzymatic antioxidants. The antioxidant effect of this system is mainly achieved through three pathways: eliminating free radicals and reactive oxygen species to prevent lipid peroxidation; decomposing peroxides and blocking peroxidation chains; and removing catalytic metal ions. Total Antioxidant Capacity (T-AOC) is a key indicator reflecting the overall antioxidant level of both enzymatic and non-enzymatic systems in the body. In existing technologies, there are many studies on movement, free radicals, and antioxidant systems, but very few studies on the adaptive regulation of Tibetan sheep, a native animal of the plateau, in different degrees of hypoxia.

[0003] By detecting the total antioxidant capacity, the oxidative stress capacity and health status of Tibetan sheep can be assessed. Detecting antioxidant stress indicators allows for the timely identification of oxidative stress responses in Tibetan sheep, enabling the implementation of measures to improve their oxidative stress capacity and better adapt them to the harsh environmental conditions of the Qinghai-Tibet Plateau, thus providing a basis for assisted breeding of Tibetan sheep.

[0004] With the rapid development of molecular marker technology, identifying gene mutation sites at the gene level and analyzing their association with traits to discover the relationship between genes and traits allows for early selection, thereby improving selection efficiency and accuracy. This can fundamentally enhance the oxidative stress capacity of Tibetan sheep and has broad application value. Therefore, molecular markers have laid the foundation for studying the genetic mechanisms of oxidative stress capacity in Tibetan sheep at the molecular level, and screening for appropriate molecular markers for more efficient use in Tibetan sheep breeding is an important issue in this field. Currently, there are few existing technologies that study molecular markers related to oxidative stress capacity in Tibetan sheep for assisted breeding. Providing a molecular marker related to oxidative stress capacity in Tibetan sheep for use in marker-assisted breeding to screen for Tibetan sheep with strong oxidative stress resistance is particularly important. Summary of the Invention

[0005] The purpose of this invention is to provide an SNP molecular marker related to the antioxidant stress capacity of Tibetan sheep and its application.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides an SNP molecular marker related to the antioxidant stress resistance of Tibetan sheep. The molecular marker is located at the 196,714,361st base on chromosome 3 of the Oar_v4.0 version of the international sheep genome, and the mutated base is A or C.

[0008] Preferably, the genotype of Tibetan sheep with a mutant base A is AA or AC;

[0009] The genotype of Tibetan sheep with a mutated base C is CC;

[0010] The antioxidant stress index T-AOC of Tibetan sheep individuals with the CC genotype was significantly higher than that of individuals with the AA genotype;

[0011] The antioxidant stress index T-AOC of Tibetan sheep individuals with AA and AC genotypes did not differ significantly;

[0012] The antioxidant stress index T-AOC showed no significant difference between the AC and CC genotypes of Tibetan sheep.

[0013] This invention also provides the application of the aforementioned SNP molecular markers in marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes.

[0014] This invention also provides the application of the aforementioned SNP molecular markers in Tibetan sheep assisted breeding.

[0015] The present invention also provides primer pairs for amplifying the SNP molecular markers, as shown in SEQ ID NO. 2-3.

[0016] The present invention also provides the application of the primer pair described herein in the preparation of marker-assisted selection products for antioxidant stress traits in Tibetan sheep for non-diagnostic purposes.

[0017] This invention also provides the application of the primer pair in the preparation of Tibetan sheep assisted breeding products.

[0018] This invention also provides a method for marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes, comprising the following steps:

[0019] (1) Extracting genomic DNA from Tibetan sheep;

[0020] (2) Using the Tibetan sheep genomic DNA obtained in step (1) as a template, amplification is performed using the primer pair to obtain the amplification product;

[0021] (3) Perform genotyping analysis on the amplification products to obtain Tibetan sheep with different genotypes; associate the genotypes of Tibetan sheep with antioxidant stress indicators; the antioxidant stress indicators include total antioxidant capacity.

[0022] Preferably, the amplification system in step (2) is: 22 μL of gold-coated mix (green), 1 μL each of upstream and downstream primers, and 1 μL of template DNA;

[0023] The amplification program in step (2) is as follows: 98℃ for 2 min; 98℃ for 10 s, 59℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.

[0024] The present invention also provides a kit for non-diagnostic marker-assisted selection and / or Tibetan sheep assisted breeding, comprising reagents for detecting the SNP molecular markers or the primer pairs.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The SNP molecular marker described in this invention is located at the 196,714,361st base on chromosome 3 of the International Sheep Reference Genome Oar_v4.0. The variant type is A / C, named g196714361A>C, and there are three genotypes. When the 196,714,361st base on chromosome 3 is A, the genotype is AA or AC; when the 196,714,361st base on chromosome 3 is C, the genotype is CC. Through association analysis between different genotypes and the antioxidant stress index T-AOC content, it was found that the antioxidant stress index T-AOC of Tibetan sheep individuals with the CC genotype was significantly higher than that of individuals with the AA genotype (p<0.05), while there was no significant difference in the antioxidant stress index T-AOC between Tibetan sheep individuals with the AA and AC genotypes (p>0.05), and there was no significant difference in the antioxidant stress index T-AOC between Tibetan sheep individuals with the AC and CC genotypes (p>0.05).

[0027] This invention can determine the content of T-AOC, an antioxidant stress indicator, in individual Tibetan sheep by detecting the base at the 196,714,361st nucleotide site on chromosome 3. This invention provides a new SNP molecular marker resource for marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0029] Figure 1 The amplification products of SNP sites are detected by agarose gel electrophoresis, where M represents the marker; 1, 2, and 3 represent 3 replicates.

[0030] Figure 2 The peak diagram and sequence are obtained after purification and sequencing of PCR amplification products. Detailed Implementation

[0031] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0032] Example 1

[0033] 1. Sample collection

[0034] The samples were collected from Tibetan sheep populations under natural grazing conditions, including 58 samples from Gannan Tibetan Autonomous Prefecture in Gansu Province, 50 samples from Yushu Tibetan Autonomous Prefecture in Qinghai Province, and 67 samples from Shigatse City in Tibet Autonomous Region. 5 mL of blood samples were collected from 175 fasting Tibetan sheep in clean, anticoagulant vacuum blood collection tubes. The tubes were allowed to stand for 30 min, then centrifuged at 3500 rpm for 15 min. The supernatant was collected into clean PE tubes, sealed, and stored at -20°C. Another 5 mL blood sample was collected in blood collection tubes containing EDTA-K2 anticoagulant. After collection, the samples were quickly mixed and temporarily stored in a sampling box containing ice packs. After being transported back to the laboratory, the samples were frozen at -20°C for genomic DNA extraction.

[0035] 2. Main reagents and instruments

[0036] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomic DNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; the NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were all purchased from Beijing Solarbio Science & Technology Co., Ltd.; Gold Mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; the electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; and the PCR instrument was purchased from BioRad. The total antioxidant capacity T-AOC (A015-2-1) detection kit was purchased from Nanjing Jiancheng Bioengineering Institute.

[0037] 3. Methods

[0038] 3.1 Detection of T-AOC in serum

[0039] The T-AOC assay kit from Nanjing Jiancheng Bioengineering Institute was used to determine the OD value using the ABTS method. The assay steps were as follows: (1) Add 10 μL of double-distilled water and 20 μL of reagent IV working solution (reagent I and peroxidase were mixed at a ratio of 9:1) to the blank tube, add 10 μL of MTLolox solution of different concentrations and 20 μL of reagent IV working solution to the standard tube, and add 10 μL of serum to be tested and 20 μL of reagent IV working solution to the test tube; (2) Add 170 μL of ABTS working solution (reagent I: reagent II: reagent III working solution = 76:5:4) to the blank tube, standard tube and test tube; (3) React at room temperature for 6 min, and read the OD value of each well at a wavelength of 405 nm using an ELISA reader; (4) Prepare a standard curve using the OD of the standard and obtain the curve formula, and substitute the OD measured in the sample test tube into the calculation formula to obtain the result.

[0040] 3.2 Extraction of genomic DNA from blood

[0041] Genomic DNA was extracted from blood samples using the blood genome extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The concentration and purity of the extracted DNA were detected by ultraviolet spectrophotometer. A concentration >20 ng / μL and an OD260 / OD280 between 1.7 and 1.9 were sufficient for the experiment. The DNA was stored at -20℃ for later use.

[0042] 3.3 Primer Design

[0043] Based on the gene sequence of chromosome 3 in the Oar_v4.0 version of the international sheep genome (GenBank accession number: NC_019460.2), a pair of specific primers containing the g196714361A>C SNP site was designed using PrimerPremier 5.0 software.

[0044] Primer sequences:

[0045] F: 5'-CAAGAATACTTTGCCATTCCCT-3'; (SEQ ID NO. 2)

[0046] R: 5'-TGGCATGACTGACTCAATGGAC-3' (SEQ ID NO. 3).

[0047] The amplified fragment was 412 bp in length, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0048] 3.4 PCR Amplification and Sequencing

[0049] PCR amplification system 25μL: Gold Mix (green) 22μL, upstream and downstream primers 1μL each, template 1μL.

[0050] PCR amplification program: 98℃ for 2 min; 98℃ for 10 s, 59℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.

[0051] PCR products were detected by 1.5% agarose gel electrophoresis. After passing the agarose gel electrophoresis test, the PCR products were sequenced using direct sequencing, which was performed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID NO.1, with the SNP marker located at position 266 of the nucleotide sequence shown in SEQ ID NO.1.

[0052] The sequencing results of PCR products were compared using the bioanalysis software MEGA 6.0, and the sequencing peak diagrams were analyzed to complete the typing.

[0053] 4. Statistical Analysis

[0054] Based on the genotyping results, the number of individuals with different genotypes at each locus was counted. The frequency of the g196714361A>C gene, genotype frequency, effective allele count (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test were calculated using Popgen32 software. The polymorphism information content (PIC) was calculated using PIC software. The association between different genotypes and the antioxidant stress index T-AOC in Tibetan sheep was analyzed using a general linear model in IBM SPSS Statistics 22 software. Results are expressed as mean ± standard error.

[0055] 5 Results

[0056] 5.1 PCR amplification and sequencing results

[0057] The amplification products of the SNP site g196714361A>C on chromosome 3 of Tibetan sheep were detected using 1.5% agarose gel electrophoresis (see [link to article]). Figure 1 The bands were clear and free of impurities, indicating good specificity. The PCR product fragment size was 412 bp, which met the expected size, and the next step of the experiment could be carried out.

[0058] SEQ ID NO.1:

[0059] CAAGAATACTTTGCCATTCCCTTCTCCAGTGGACCATGTTTTGTCAGAAATTTCCACTATTACCTGTCCATCTTGGTTGGCCCTATACAGCGTGGCTCATAGTTTCATTGAGTTAGACAAGGCTATGGTCCATGTGATCAGTTAGGTTAGTTTTCTGTGACTGTGGTTTTTCAGTCTGTCTGCCCTCTGATGAATGAAGATAAGAGG CTTATAGAAGCTTCCTGATGGGAGAGACTGACTGTGGGGGGAATCTAGGTCTTGTTCTGATGGGCAGGGCCATGCTCGGTTGAGTTCAGTCACTCAGTCCTGTCTGACTCTTTGTGACCCCACAAACTGCAGCACACAAGGCCTCCCTGTCTATCACCAACTCCCAGAGTTCACCCAAACTCATGTCCATTGAGTCAGTCATGCCA.

[0060] The peak chromatogram and sequence obtained after purification and sequencing of the PCR product are shown below. Figure 2 .Depend on Figure 2 It can be seen that the AC mutation occurs at the g196714361A>CSNP site, resulting in three genotypes: AA, AC, and CC.

[0061] 5.2 Statistical Analysis Results

[0062] Genotype and allele frequencies of the g196714361A>C SNP locus on chromosome 3 of Tibetan sheep were analyzed from a population genetics perspective. Table 1 shows that at the g196714361A>C SNP locus, the CC genotype had the highest frequency and was the dominant genotype, while the C allele frequency was 72.3%, also indicating a dominant allele. The χ² fitness test showed that the SNP locus significantly deviated from Hardy-Weinberg equilibrium (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.401, and the PIC was 0.320, with 0.25 < PIC < 0.50, indicating moderate polymorphism.

[0063] Table 1. Polymorphism of SNP site g196714361A>C on chromosome 3 of Tibetan sheep.

[0064]

[0065] 2.3 Association analysis between different genotypes and the antioxidant stress index T-AOC

[0066] The association between different genotypes of Tibetan sheep and the content of the antioxidant stress index T-AOC was analyzed using a general linear model in IBM SPSS Statistics 22 software. The results showed that the antioxidant stress index T-AOC in Tibetan sheep with the CC genotype was significantly higher than that of those with the AA genotype (p<0.05). There was no significant difference in T-AOC between Tibetan sheep with the AA and AC genotypes (p>0.05), nor between those with the AC and CC genotypes (p>0.05). This indicates that the bases at the g196714361A>C SNP site on chromosome 3 of Tibetan sheep are significantly correlated with T-AOC, and this SNP is a T-AOC-related SNP marker in Tibetan sheep. The results are shown in Table 2.

[0067] Table 2. Correlation analysis between different genotypes and the antioxidant stress index T-AOC

[0068]

[0069] Note: Different lowercase letters in the intercalation of data in the same row indicate significant differences (P < 0.05).

[0070] In summary, the SNP molecular marker described in this invention is located at the 196,714,361st base on chromosome 3 of the International Sheep Reference Genome Oar_v4.0; the variant type is A / C, named g196714361A>C, and there are three genotypes. When the 196,714,361st base on chromosome 3 is A, the genotype is AA or AC; when the 196,714,361st base on chromosome 3 is C, the genotype is... The genotype was CC. Through association analysis between different genotypes and the content of the antioxidant stress index T-AOC, it was found that the antioxidant stress index T-AOC of Tibetan sheep individuals with the CC genotype was significantly higher than that of individuals with the AA genotype (p<0.05). There was no significant difference in the antioxidant stress index T-AOC between Tibetan sheep individuals with the AA and AC genotypes (p>0.05), and there was no significant difference in the antioxidant stress index T-AOC between Tibetan sheep individuals with the AC and CC genotypes (p>0.05).

[0071] This invention can determine the content of T-AOC, an antioxidant stress indicator, in individual Tibetan sheep by detecting the base at the 196,714,361st nucleotide site on chromosome 3. This invention provides a new SNP molecular marker resource for marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes.

[0072] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of a SNP molecular marker related to the antioxidant stress capacity of Tibetan sheep in marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes or in Tibetan sheep assisted breeding, characterized in that, The molecular marker is located at the 196,714,361st base on chromosome 3 of the Oar_v4.0 version of the international sheep genome, with a mutation base of A or C; the genotype of Tibetan sheep with a mutation base of A is AA or AC; the genotype of Tibetan sheep with a mutation base of C is CC. The antioxidant stress index T-AOC of Tibetan sheep individuals with the CC genotype was significantly higher than that of individuals with the AA genotype; there was no significant difference in the antioxidant stress index T-AOC between Tibetan sheep individuals with the AA and AC genotypes; there was no significant difference in the antioxidant stress index T-AOC between Tibetan sheep individuals with the AC and CC genotypes.

Citation Information

Patent Citations

  • Genetic marker related to low oxygen resistance of Tibet sheep and application of genetic marker

    CN110241232A

  • Molecular marker for detecting oxidative stress capability of Tibetan sheep and application of molecular marker

    CN118853908A