Application of wheat TaPND gene

Abstract

The present invention relates to the fields of genetic engineering and plant genetic breeding, and specifically to the application of wheat TaPND gene. In the present invention, by taking gene TaPND as a target, designing a sgRNA sequence based on CRISPR / Cas9, connecting a DNA fragment containing the encoding sgRNA sequence to a vector carrying CRISPR / Cas, a plant binary expression vector capable of knocking out the TaPND gene in wheat is constructed; by genetically transforming wheat, offspring with TaPND gene knockout are obtained, and wheat mutants with early flowering time are obtained. Experiments have confirmed that transgenic wheat with TaPND gene knockout achieves the advancement of wheat flowering time. The technical scheme of the present invention provides a practical method for realizing rapid wheat breeding using genetic engineering technology, which has important breeding application value and broad market application prospects.

Description

Technical Field

[0001] The invention relates to the fields of genetic engineering and plant genetic breeding, and in particular to the application of wheat TaPND gene. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] During the entire growth cycle, wheat goes through different developmental stages, namely the "rooting stage", "tillering stage", "jointing stage", "heading stage", "heading and flowering stage" and "grain filling and maturity stage". During this whole process, the heading and flowering stage is a sign that wheat has switched from vegetative growth to reproductive growth, and it is also a critical period that determines the number of grains in the wheat ear and the final yield. Wheat generally begins to bloom in April and May, during which time a variety of diseases and insect pests such as wheat ergot, rust, powdery mildew, wheat ear aphids, and armyworms enter a high-incidence and recurrence period; at the same time, as the months increase, the temperature rises, transpiration increases, the plant metabolism is vigorous, and it enters a peak period of water and fertilizer demand and a sensitive reaction period; therefore, promoting the early flowering period of wheat has a strong practical application effect on optimizing wheat field production, can avoid the occurrence of mildew caused by high temperature and heavy rain, and better ensure the normal progress of the wheat flowering period. Summary of the invention

[0004] In order to overcome the above problems, the present invention provides the application of wheat TaPND gene.

[0005] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0006] The first aspect of the present invention provides the use of wheat TaPND gene in regulating the flowering time of wheat, wherein the nucleotide sequence of the TaPND gene is shown as SEQ ID NO.1.

[0007] The second aspect of the present invention provides a method for advancing the flowering period of wheat, comprising: knocking out or reducing the TaPND gene in wheat by means of genetic engineering; the nucleotide sequence of the TaPND gene is shown in SEQ ID NO.1.

[0008] In one or more embodiments, the method of knocking out or reducing the TaPND gene in wheat by genetic engineering includes:

[0009] Taking the gene TaPND as the target, a sgRNA sequence based on CRISPR / Cas9 was designed, and a DNA fragment containing the sgRNA sequence was connected to a vector carrying CRISPR / Cas, and wheat was transformed to obtain transgenic wheat with the gene function missing.

[0010] Preferably, the nucleotide sequence of sgRNA is as shown in SEQ ID NO.2, or SEQ ID NO.3, preferably the nucleotide sequence shown in SEQ ID NO.3; it belongs to the TaPND coding sequence or the complementary sequence of the TaPND coding sequence, has a length of 22 to 23 deoxyribonucleotides, and the last three deoxyribonucleotide sequences adjacent to its 3' end are NGG, wherein N is adenine or guanine or thymine or cytosine.

[0011] Preferably, the CRISPR / Cas vector includes pBUE411.

[0012] Further preferably, the DNA fragment containing the encoding sgRNA sequence is connected to the CRISPR / Cas-carrying vector pBUE411 to construct a plant binary expression vector.

[0013] Preferably, the method for transforming wheat comprises:

[0014] The DNA fragment containing the encoding sgRNA sequence was connected to a vector carrying CRISPR / Cas to construct a plant binary expression vector, and the plant binary expression vector was transformed into wheat by Agrobacterium.

[0015] The third aspect of the present invention provides the use of the transgenic wheat obtained by the method of the second aspect in plant breeding.

[0016] In one or more embodiments, the breeding method includes transgenic, hybridization, backcrossing, selfing, or asexual reproduction.

[0017] The beneficial effects of the present invention are:

[0018] In the present invention, by targeting the gene TaPND, designing a sgRNA sequence based on CRISPR / Cas9, connecting a DNA fragment encoding the sgRNA sequence to a vector carrying CRISPR / Cas, a plant binary expression vector capable of knocking out the TaPND gene in wheat is constructed; wherein the sgRNA sequence can target and destroy the exon region of the TaPND gene, and the targeting domain sequence of the sgRNA sequence is selected from the coding sequence of the TaPND gene, which can specifically target and destroy the coding region of the TaPND gene and effectively reduce the protein level of TaPND. By genetically transforming wheat, offspring with TaPND gene knockout are obtained, and wheat mutants with early flowering time are obtained. Experiments have confirmed that transgenic wheat with TaPND gene knockout achieves the early flowering time of wheat. The technical scheme of the present invention provides a practical method for realizing rapid wheat breeding using genetic engineering technology, which has important breeding application value and broad market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0020] Figure 1 It is the coding region of the TaPND gene of the wheat variety Chinese Spring; among which: the single underlined sequence is the sgRNA sequence used for gene editing.

[0021] Figure 2 This is the sequencing result of the strain tapnd-ko-8# in which all three homologous copies were gene-edited;

[0022] Figure 3 This is the protein coding result of the strain tapnd-ko-8# in which all three homologous copies were gene-edited;

[0023] Figure 4 It is the restriction digestion amplification fragment of the editing site of the tapnd-ko-8# strain; among them: 1 is Transgen 2K plusmarker, 2-18 are the restriction digestion results of the PCR amplification fragment of the tapnd-ko-8# offspring, 19-23 are the restriction digestion results of the negative control amplified with water as the template, and 24 and 25 are the restriction digestion results of the PCR amplification fragment in JW1.

[0024] Figure 5 Comparison of flowering time between JW1 and the homozygous gene knockout line tapnd-ko-8#; A is the phenotype of the two plants photographed at the same time, and B is the comparison of flowering time. DETAILED DESCRIPTION

[0025] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0026] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0027] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0028] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0029] Unless otherwise specified, the test materials used in the following examples were purchased from conventional biochemical reagent companies.

[0030] The high-fidelity enzyme required for PCR amplification is KOD-FX NEO (Toyobo); the restriction endonuclease BsaI and T4 ligase required for Gibson assembly are purchased from NEB; the restriction endonuclease EcoRI, the gel recovery kit required for enzyme fragment recovery, and the plasmid extraction kit are all purchased from Thermo Fisher Scientific. The inorganic salts required for the preparation of the culture medium were purchased from Sinopharm Group, and the vitamins and antibiotics were purchased from Sigma. The plant CRISPR / Cas9 gene editing vector is pBUE411, which contains the wheat U3 promoter TaU3 to start sgRNA. Cas9 simulates the characteristics of the 5'-end GC content of the grass gene and is a designed and synthesized plant codon-optimized gene. The plasmid pBUE411 is publicly available from China Agricultural University, and its sequence is known to the public, which is 17430bp. The Escherichia coli strain used in the present invention is E. coli Transgen 5α, purchased from Beijing Quanshijin Company; the primers used are synthesized by Qingdao Qingke Zixi Biotechnology Co., Ltd., and the relevant primer sequences are shown in Table 1:

[0031] Table 1 Primers used in the present invention

[0032]

[0033]

[0034] The wheat variety JW1 used in the present invention is a new germplasm with good tissue culture ability bred by the Crop Research Institute of Shandong Academy of Agricultural Sciences, and is available to the public from the Crop Research Institute of Shandong Academy of Agricultural Sciences.

[0035] Example 1

[0036] Construction of expression vector: With gene TaPND as the target, a sgRNA sequence based on CRISPR / Cas9 was designed, and the DNA fragment containing the sgRNA sequence was connected to the vector pBUE411 carrying CRISPR / Cas to construct the plant binary expression vector pBUE411-TaPND.

[0037] 1.1 Design of sgRNA targeting TaPND

[0038] In order to design an sgRNA that can edit the coding region of the TaPND gene, a suitable targeting site was found in the coding region of the TaPND gene through the website CRISPRdirect (http: / / crispr.dbcls.jp / ), and a 20 bp sequence fragment was found before the PAM structure and set as the target sequence. In this example, one of the sgRNAs was used as an example for a knockout experiment, and its nucleotide sequence was GGACCTAGAGAAGAAGAATTCGG, as shown in SEQ ID NO.3, that is, Figure 1 The underlined sequence in the TaPND gene sequence shown is the sgRNA sequence targeting the TaPND gene, and the CGG at the 3' end of the sgRNA is the PAM sequence.

[0039] 1.2 Obtaining fragments containing sgRNA

[0040] The two primers TaPND-gR1-F and TaPND-gR1-R (Table 1) used to construct the pBUE411-TaPND plant binary expression vector were synthesized by Qingdao Qingke Zixi Biotechnology Co., Ltd. The two primers were phosphorylated and directly annealed to form double strands. The reaction system was: TaPND-gR1-F (10 μM): 4 μL, TaPND-gR1-R (10 μM): 4 μL, 10×T4PNKbuffer: 1.5 μL, PNK: 1 μL, ATP: 1 μL, ddH 2 Make up to 15 μL of 1% O. PCR reaction: 37°C, 30 min; 95°C, 5 min; ramp to 25°C at 5°C / min.

[0041] 1.3pBUE411 vector and sgRNA connection

[0042] Gibson assembly was used to complete the connection between pBUE411 and sgRNA. The specific reaction system was as follows: pBUE411 plasmid (100 ng / μL): 2 μL, product fragment of step 2: 2 μL, 10×NEB T4 Buffer: 1.5 μL, 10×BSA: 1.5 μL, BsaI: 1 μL, T4 Ligase: 1 μL, ddH 2 The reaction system was reacted in a 37°C water bath for 5 hours to obtain the pBUE411 vector and sgRNA ligation product.

[0043] 1.4 Transformation and identification

[0044] The ligation product was transformed into Escherichia coli. Specifically: the ligation product was added to the Escherichia coli competent Transgen 5α and ice-bathed for 20 minutes, heat-shocked at 42°C for 60 seconds, ice-bathed for 2 minutes, added with antibiotic-free LB, and placed in a 37°C shaker for 1 hour to recover. Then, it was spread on an LB (containing kanamycin) plate with a spreader, and incubated at 37°C upside down until clones grew. Three single clones were selected for sequencing. The primers used were pBUE411-F and pBUE411-R.

[0045] The sequencing results detected the target sequence of sgRNA, and the TaU3 promoter sequence was detected upstream of the target sequence. The sequencing results showed that the expression cassette E1 containing sgRNA was successfully assembled into the plant binary expression vector, proving that the CRISPR / Cas9 gene editing vector of TaPND, namely the plant binary expression vector pBUE411-TaPND, was successfully constructed.

[0046] The plant binary expression vector pBUE411-TaPND is composed of expression cassette E1 and expression cassette E2; the expression cassette E1 is composed of the following from upstream to downstream: TaU3 promoter from wheat, sgRNA targeting TaPND gene and terminator T1; the expression cassette E2 is composed of the following from upstream to downstream: ubiquitin promoter Ubi from corn, corn Cas9 coding sequence and terminator T2.

[0047] The nucleotide sequence of the plant binary expression vector pBUE411-TaPND is:

[0048]

[0049] The nucleotide sequence of expression cassette E1 is:

[0050] catgaatccaaaccacacggagttcaaattcccacagattaaggctcgtccgtcgcacaaggtaatgtgtgaatattatatctgtcgtgcaaaattgcctggcctgcacaattgctgttatagttggcggcagggagagttttaacattgactagcgtgctgataatttgtgagaaataataattgacaagtagatactgacatttgagaagagcttctgaactgttattagtaacaaaaatggaaagctgatgcacggaaaaaggaaagaaaaagccatacttttttttaggtaggaaaagaaaaagccatacgagactgatgtctctcagatgggccgggatctgtctatctagcaggcagcagcccaccaacctcacgggccagcaattacgagtccttctaaaagctcccgccgaggggcgctggcgctgctgtgcagcagcacgtctaacattagtcccacctcgccagtttacagggagcagaaccagcttataagcggaggcgcggcaccaagaagcggcggcggcgcgtcgtcgccggacatgctgctcgacgagcagcgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttttttcgttttgcattgagttttctccgtcgcatgtttgcagttttattttccgttttgcattgaaatttctccgtctcatgtttgcagcgtgttcaaaaagtacgcagctgtatttcacttatttacggcgccacattttcatgccgtttgtgccaactatcccgagctagtgaatacagcttggcttcacacaacactggtgacccgctgacctgctcgtacctcgtaccgtcgtacggcacagcatttggaattaaagggtgtgatcgatactgcttgctgct

[0051] The nucleotide sequence of expression cassette E2 is:

[0052]

[0053] The nucleotide sequence of the TaU3 promoter of wheat is as follows:

[0054] catgaatccaaaccacacggagttcaaattcccacagattaaggctcgtccgtcgcacaaggtaatgtgtgaatattatatctgtcgtgcaaaattgcctggcctgcacaattgctgttatagttggcggcagggagagttttaacattgactagcgtgctgataatttgtgagaaataataattgacaagtagatactgacatttgagaagagcttctgaactgttattagtaacaaaaatggaaagctgatgcacggaaaaaggaaagaaaaagccatacttttttttaggtaggaaaagaaaaagccatacgagactgatgtctctcagatgggccgggatctgtctatctagcaggcagcagcccaccaacctcacgggccagcaattacgagtccttctaaaagctcccgccgaggggcgctggcgctgctgtgcagcagcacgtctaacattagtcccacctcgccagtttacagggagcagaaccagcttataagcggaggcgcggcaccaagaagcggc

[0055] The nucleotide sequence of the terminator T1 is as follows:

[0056] ttttttttttcgttttgcattgagttttctccgtcgcatgtttgcagttttattttccgttttgcattgaaatttctccgtctcatgtttgcagcgtgttcaaaaagtacgcagctgtatttcacttatttacggcgccacattttcatgccgtttgtgccaactatcccgagctagtgaatacagcttggcttcacacaacactggtgacccgctgacctgctcgtacctcgtaccgtcgtacggcacagcatttggaattaaagggtgtgatcgatactgcttgctgct

[0057] The nucleotide sequence of the maize ubiquitin promoter Ubi is as follows:

[0058]

[0059] The nucleotide sequence of the maize Cas9 coding sequence is:

[0060]

[0061] The nucleotide sequence of terminator T2 is:

[0062] aagcggccagcggcgacgaagaaggcggggcaggcgaagaagaagaagtgagctcagagctttcgttcgtatcatcggtttcgacaacgttcgtcaagttcaatgcatcagtttcattgcgcacacaccagaatcctactga gtttgagtattatggcattgggaaaactgtttttcttgtaccatttgttgtgcttgtaatttactgtgttttttattcggttttcgctatcgaactgtgaaatggaaatggatggagaagagttaatgaatgatatggtcctt ttgttcattctcaaattaatattatttgttttttctctcttatttgttgtgtgttgaatttgaaattataagagatatgcaaacattttgttttgagtaaaaatgtgtcaaatcgtggcctctaatgaccgaagttaatatgagg agtaaaacacttgtagttgtaccattatgcttattcactaggcaacaaatatattttcagacctagaaaagctgcaaatgttatgaatacaagtatgtcctcttgtgttttagacatttatgaactttcctttatgtaattt

[0063] Example 2 Obtaining and Identifying Transgenic Offspring

[0064] 2.1 Obtaining TaPND transgenic offspring

[0065] The plant binary expression vector pBUE411-TaPND constructed in Experimental Example 1 was transformed into Agrobacterium EHA105 competent cells. Specifically, the plant binary expression vector pBUE411-TaPND was added to the Agrobacterium EHA105 competent cells and placed in an ice bath for 5 minutes, quick-frozen in liquid nitrogen for 5 minutes, heat-shocked at 37°C for 5 minutes, then placed in an ice bath for 5 minutes, added with antibiotic-free LB, and placed in a 28°C shaker for 2 hours. Then, it was applied to an LB (containing rifampicin, streptomycin and kanamycin) plate with a spreader, and incubated at 28°C inverted until clones grew out. A single clone was picked and inoculated into an LB culture solution containing the corresponding resistance, and the bacteria were shaken at 28°C, 160rpm, and cultured for 24 hours.

[0066] Take JW1 wheat seeds about 15 days after pollination and peel off the young embryos. Take 1mL of Agrobacterium suspension in a 1.5mL centrifuge tube, add 1.4μL of acetosyringone (0.1M) and mix well. Add the prepared bacterial solution for infection for 5 minutes and place it on the co-cultivation medium, and culture it in the dark at 23℃ for 3 days. After co-cultivation, place it on the resting medium and culture it in the dark at 25℃ for 5 days. Transfer the callus to screening medium 1, seal the culture dish with sealing film, and culture it in the dark in a 25.5℃ incubator for 2 weeks. After the callus is cut, transfer it to screening medium 2, seal the culture dish again with sealing film, and continue to culture it in the dark in a 25.5℃ incubator for 2 weeks. After 2 weeks of callus cutting and screening, the resistant callus with green buds is transferred to the regeneration medium. Seal the culture dish and place it in a 25℃ incubator for 2 weeks of light / darkness (16h / 8h). After 2 weeks of regeneration, transfer the healthy seedlings to a new resistant regeneration box. When the seedlings grow to a certain size, samples can be taken for testing.

[0067] The various culture media and their preparations involved in the above wheat genetic transformation are shown in the following documents:

[0068] Kan Wang (ed.), Agrobacterium Protocals: Volume 1, Methods in Molecular Biology, vol.1223DOI10.007 / 978-1-4939-1695-5_15, Spring Science+Businessed Media New York 2015.

[0069] The young leaves of regenerated wheat were taken, and the genomic DNA was extracted by CTAB method. The primers on the two vectors BUE-DF1 and BUE-DR1 were used for PCR identification. The PCR reaction program was as follows: 2×PCR master mix: 10μL, pBUE411-F (10μM): 0.5μL, pBUE411-R (10μM): 0.5μL, gDNA (50ng / μL): 1μL, ddH 2 O: 8 μL. The PCR reaction program was: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 sec, 58°C annealing for 30 sec, 72°C extension for 30 sec, 32 cycles, and 72°C annealing for 5 min.

[0070] 2.2 Identification of TaPND transgenic knockout progeny

[0071] Wheat is an allohexaploid, the TaPND gene is a copy on chromosome 6B, and the homologous copies on chromosomes 6A and 6D are TaPND6A and TaPND6D. The DNA sequences of the three copies are highly homologous, and it is necessary to detect the gene editing of the three homologous copies at the same time. This experiment uses the Hi-TOM gene editing site detection kit purchased from Xi'an Qingxue Biotechnology Co., Ltd., which completes the high-throughput library construction process through PCR, and uses Hi-TOM online software to directly analyze the variation information of multiple samples and multiple sites. TaPND, TaPND6A and TaPND6D were amplified simultaneously using specific primers on both sides of the target sequence (Seq-F and Seq-R in Table 1), and the amplified products were sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing after library construction.

[0072] The gene editing results of target wheat TaPND, TaPND6A and TaPND6D genes are shown in Figure 2. Figure 2 The amino acid sequence encoded by it is shown in Figure 3 As shown. After comparison, the mutant protein tapnd began to have a frameshift from the 121st amino acid; the protein tapnd6a began to have a frameshift from the 120th amino acid; the protein tapnd6d began to have a frameshift from the 121st amino acid. The results showed that the sgRNA and Cas9 elements were successfully transformed and played their functions, editing the TaPND gene, resulting in the premature termination of the translation of the three proteins TaPND, TaPND6A and TaPND6D, and the corresponding loss of gene function.

[0073] Among them: The first round of PCR reaction system: 1 μL of DNA from wheat plant leaves with pBUE411-TaPND gene as template, 10 μL of 2×Taq Master Mix in the kit, 0.5 μL of Seq-F and Seq-R (Table 1) (10 μM) each, and Nuclease-free Water to make up the volume to 20 μL. The PCR reaction conditions are: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 20 s, a total of 32 cycles; and finally 72℃ extension for 5 min. After the PCR is completed, 5 μL of agarose gel electrophoresis is taken to detect the PCR product to ensure the presence of the target product and good specificity. Then the second round of PCR reaction is carried out, 12 μL of Hi-TOM Mix in the kit, 1 μL of the first round of PCR product as template is added, and Nuclease-free Water is made up to 20 μL. PCR reaction program: 94℃ denaturation for 2min; 94℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 25s, a total of 33 cycles; finally 72℃ extension for 5min. The amplified products were mixed and gel-recovered. The gel-recovered products were the library sequencing samples, which were then sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing. The gene editing results were as follows: Figure 2 shown.

[0074] Example 3

[0075] Phenotypic identification of wheat offspring with TaPND, TaPND6A and TaPND6D knockout genes:

[0076] In order to obtain homozygous knockout strains of three homologous copies of TaPND, TaPND6A and TaPND6D, restriction amplified polymorphic sequence (CAPS) markers were developed for the editing sites, and the self-pollinated progenies of the gene-edited mutants were identified until homozygous mutants with simultaneous knockout of TaPND, TaPND6A and TaPND6D were obtained.

[0077] Seq-F and Seq-R (Table 1) were used to perform PCR amplification of TaPND, TaPND6A, and TaPND6D genes in the gene-edited offspring. The PCR reaction system was: KOD-FX NEO buffer: 10 μL, dNTP (2 mM): 4 μL, Seq-F (10 μM): 0.6 μL, Seq-R (10 μM): 0.6 μL, knockout strain gDNA (about 20 ng / μL): 1 μL, KOD-FX NEO: 0.4 μL, ddH 2 The PCR reaction program was as follows: 98°C pre-denaturation for 2 min, 98°C denaturation for 12 sec, 58°C annealing for 20 sec, 68°C extension for 45 sec, 35 cycles, and 68°C annealing for 5 min.

[0078] The amplified product was digested with restriction endonuclease EcoRI produced by Thermo Fisher Scientific. The digestion reaction system was as follows: PCR product: 10 μL, 10× Buffer Tango: 1.3 μL, restriction endonuclease EcoRI: 0.5 μL, ddH 2 The reaction system was digested in a 37°C water bath for 3 h, and then electrophoresis was performed. The results were as follows. Figure 4 As shown. Electrophoresis was used to identify homozygous mutants, and all wild-type genes could be cut, while the sites where gene editing was successful could not be cut, thereby screening the transgenic homozygous three-copy gene knockout strain tapnd-ko-8#.

[0079] The wild-type receptor variety JW1 and the homozygous knockout strain of the TaPND gene and its homologous copy (named tapnd-ko-8#) were planted together in the artificial climate room of Shandong University Qingdao Campus. The culture conditions were: 16 h of light, 8 h of darkness; daytime temperature 22°C, nighttime temperature 16°C; humidity 40%-50%; CO 2The concentration is 500ppm to 700ppm. During the wheat growth cycle, the flowering time of JW1 and tapnd-ko-8# was recorded. The flowering time of JW1 and tapnd-ko-8# of 8 individual plants was recorded respectively.

[0080] The results showed that compared with the wild-type JW1, the flowering time of the mutant line tapnd-ko-8# was significantly advanced (e.g. Figure 5 ). It shows that the knockout of TaPND gene has a significant positive regulatory effect on the flowering time of wheat. The present invention constructs a pBUE411-TaPND plant binary expression vector containing sgRNA that can specifically target TaPND and its homologous genes, uses Agrobacterium to infect callus tissue induced by wheat immature embryos, and specifically edits the TaPND gene to make it lose its function, which significantly shortens the flowering time of wheat and helps to accelerate the cultivation process of wheat.

[0081] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Application of knocking out or reducing the TaPND gene, TaPND6A gene and TaPND6D gene in wheat in advancing the flowering time of wheat, wherein the TaPND gene is a copy on wheat chromosome 6B, and the homologous copies on chromosomes 6A and 6D are TaPND6A and TaPND6D, and the nucleotide sequence of the TaPND gene is shown in SEQ ID NO.

1.

2. A method for advancing the flowering period of wheat, characterized in that: include: Using genetic engineering to knock out or reduce the TaPND gene, TaPND6A gene and TaPND6D gene in wheat; The TaPND gene is a copy on wheat chromosome 6B, and the homologous copies on chromosomes 6A and 6D are TaPND6A and TaPND6D. The nucleotide sequence of the TaPND gene is shown in SEQ ID NO.

1.

3. The method according to claim 2, characterized in that Methods for knocking out or reducing the TaPND gene, TaPND6A gene and TaPND6D gene in wheat by means of genetic engineering include: Taking the gene TaPND as the target, a sgRNA sequence based on CRISPR / Cas9 was designed, and a DNA fragment containing the sgRNA sequence was connected to a vector carrying CRISPR / Cas, and wheat was transformed to obtain transgenic wheat with the gene function missing.

4. The method according to claim 3, characterized in that The nucleotide sequence of sgRNA is shown in SEQ ID NO.

3.

5. The method according to claim 3, characterized in that The CRISPR / Cas vector includes pBUE411.

6. The method according to claim 5, characterized in that The DNA fragment containing the sgRNA sequence was connected to the CRISPR / Cas vector pBUE411 to construct a plant binary expression vector.

7. The method according to claim 3, characterized in that Methods for transforming wheat include: The DNA fragment containing the encoding sgRNA sequence was connected to a vector carrying CRISPR / Cas to construct a plant binary expression vector, and the plant binary expression vector was transformed into wheat by Agrobacterium.

8. Use of the transgenic wheat obtained by the method according to any one of claims 2 to 7 in plant breeding.

9. The use according to claim 8, wherein the breeding method comprises transgenic, hybridization, backcrossing, selfing or asexual reproduction.

Images