Application of wheat TaLNUE protein in regulating plant tolerance to low nitrogen stress

By using sgRNA knockout technology targeting the wheat TaLNUE gene, the spike length and spikelet number of wheat under low nitrogen stress were increased, solving the problem of yield improvement under low nitrogen stress and achieving efficient nitrogen utilization and yield increase.

CN120924594BActive Publication Date: 2025-12-23SHANDONG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511476168.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-16
Publication Date
2025-12-23
Estimated Expiration
2045-10-16

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate wheat spike length and spikelet number under low nitrogen stress, resulting in limited yield increases and slow progress in traditional breeding methods.

Method used

By designing a single-stranded guide RNA (sgRNA) targeting the wheat TaLNUE gene, constructing an expression vector to knock out the TaLNUE gene, and transforming it into wild-type wheat, TaLNUE protein expression was silenced or inhibited. Genetic engineering techniques were used to enhance spike length and spikelet number in wheat under low nitrogen stress.

Benefits of technology

It significantly improved the yield per plant and total yield of wheat under low nitrogen stress, enhanced nitrogen absorption and utilization efficiency, and provided a practical genetic engineering method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120924594B_ABST
    Figure CN120924594B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering, and particularly relates to application of wheat TaLNUE protein in regulating low nitrogen stress tolerance of plants. The present application designs single-stranded guide RNA targeting wheat TaLNUE gene, constructs an expression vector for knocking out TaLNUE gene, and transforms the expression vector into wild-type wheat to obtain transgenic wheat with inhibited TaLNUE gene function. Research shows that inhibiting expression of wheat TaLNUE protein can increase ear length and spikelet number of wheat under low nitrogen stress, thereby increasing single plant yield and total yield of wheat under low nitrogen stress, and improving nitrogen absorption efficiency and utilization efficiency of wheat under low nitrogen stress. The technical scheme of the present application provides a feasible method for improving wheat yield under low nitrogen stress by using genetic engineering technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to the application of wheat TaLNUE protein in regulating plant tolerance to low nitrogen stress. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] In long-term agricultural production, significant breakthroughs have been achieved in increasing wheat yields through measures such as the selection and promotion of improved varieties, the use of chemical fertilizers and pesticides, and improvements in cultivation and irrigation methods. However, blindly pursuing yield will have serious negative impacts on sustainable agricultural development. Nitrogen is a crucial element for plant growth, development, and yield formation, and the application of nitrogen fertilizer is an important agronomic measure to increase wheat yield. However, excessive application of nitrogen fertilizer not only increases crop planting costs and reduces nitrogen fertilizer use efficiency, but also causes serious environmental pollution. Therefore, improving the nitrogen use efficiency of wheat is of great significance for reducing excessive nitrogen fertilizer application, lowering planting costs, mitigating environmental pollution, and achieving sustainable agricultural development.

[0004] Wheat's final yield is composed of three core elements: number of spikes per unit area, number of spikelets per spikelet, and thousand-grain weight. Among these, the number of spikelets is one of the key factors determining yield; longer spikes generally mean more potential spikelets and florets, and a higher number of spikelets is directly linked to the number of spikelets per grain. Therefore, spike length and spikelet number are important agronomic traits that directly affect wheat yield potential. Positively regulating these traits through genetic improvement is an effective way to overcome wheat yield bottlenecks and achieve yield increase targets.

[0005] Currently, research on improving crop nitrogen efficiency largely focuses on the regulation of nitrogen absorption, assimilation, and translocation pathways. However, how to specifically enhance wheat's growth capacity under low nitrogen stress, especially prioritizing spike development under limited nitrogen supply to increase spike length and spikelet number, thereby directly driving yield formation, remains a crucial scientific issue that urgently needs exploration. Traditional breeding methods have made slow progress in this area, and there is an urgent need to use modern biotechnology to discover key genes and regulatory networks with breakthrough effects. Summary of the Invention

[0006] To overcome the aforementioned problems, this invention provides the application of wheat TaLNUE protein in regulating plant tolerance to low nitrogen stress. This invention designs a single-stranded guide RNA (sgRNA) targeting the wheat TaLNUE gene, constructs an expression vector knocking out the TaLNUE gene, and transforms this expression vector into wild-type wheat to obtain transgenic wheat with suppressed TaLNUE gene function. Studies have found that inhibiting the expression of wheat TaLNUE protein can increase spike length and spikelet number in wheat under low nitrogen stress, thereby increasing the yield per plant and total yield under low nitrogen stress, and improving the efficiency of nitrogen uptake and utilization in wheat under low nitrogen stress. The technical solution of this invention provides a practical method for increasing wheat yield under low nitrogen stress using genetic engineering technology, which has significant practical production application value and broad market application prospects.

[0007] To achieve the above technical objectives, the present invention adopts the following technical solution:

[0008] The first aspect of the present invention provides the use of wheat TaLNUE protein and related biomaterials in any of the following:

[0009] a1) Application in regulating nitrogen uptake efficiency in plants under low nitrogen stress;

[0010] a2) Application in regulating nitrogen use efficiency in plants under low nitrogen stress;

[0011] a3) Application of regulating spike length in plants under low nitrogen stress;

[0012] a4) Application of regulating spikelet number in plants under low nitrogen stress;

[0013] a5) Application in regulating total yield of plants under low nitrogen stress;

[0014] a6) Application of regulating plant yield per plant under low nitrogen stress;

[0015] a7) Application in cultivating plants tolerant to low nitrogen stress;

[0016] The wheat TaLNUE protein is the protein shown as b1), b2), b3), or b4) below:

[0017] b1) The protein with the amino acid sequence shown in SEQ ID NO: 2;

[0018] b2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 2;

[0019] b3) Proteins with the same function obtained by substituting, deleting or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2.

[0020] b4) Proteins that have 75% or more homology with the amino acid sequence shown in SEQ ID NO: 2 and have the same function.

[0021] In one or more embodiments, the biomaterial associated with wheat TaLNUE protein is any one of c1) to c7) below:

[0022] c1) A nucleic acid molecule encoding wheat TaLNUE protein; the sequence of said nucleic acid molecule is shown in SEQ ID NO: 1;

[0023] c2) An expression cassette containing the nucleic acid molecule described in c1);

[0024] c3) A recombinant vector containing the nucleic acid molecule described in c1) or a recombinant vector containing the expression cassette described in c2);

[0025] c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3);

[0026] c5) A transgenic plant cell line containing the nucleic acid molecule described in c1) or a transgenic plant cell line containing the expression cassette described in c2);

[0027] c6) Transgenic plant tissue containing the nucleic acid molecule described in c1) or transgenic plant tissue containing the expression cassette described in c2);

[0028] c7) A transgenic plant organ containing the nucleic acid molecule described in c1) or a transgenic plant organ containing the expression cassette described in c2).

[0029] In one or more embodiments, the regulation is negative regulation.

[0030] In one or more embodiments, the plant is wheat.

[0031] A second aspect of the present invention provides a method for cultivating transgenic plants, comprising: using genetic engineering techniques to silence or inhibit the expression of wheat TaLNUE protein to obtain transgenic plants;

[0032] The wheat TaLNUE protein is the protein shown in b1), b2), b3), or b4) below:

[0033] b1) The protein with the amino acid sequence shown in SEQ ID NO: 2;

[0034] b2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 2;

[0035] b3) Proteins with the same function obtained by substituting, deleting or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2.

[0036] b4) Proteins that have 75% or more homology with the amino acid sequence shown in SEQ ID NO: 2 and have the same function;

[0037] Among them, the transgenic plant has at least one of the following characteristics compared with the original plant:

[0038] d1) Improved nitrogen uptake efficiency under low nitrogen stress;

[0039] d2) Improved nitrogen use efficiency under low nitrogen stress;

[0040] d3) Ear length increases under low nitrogen stress;

[0041] d4) The number of spikelets increases under low nitrogen stress;

[0042] d5) Total yield increases under low nitrogen stress;

[0043] d6) Increased yield per plant under low nitrogen stress.

[0044] In one or more embodiments, methods for silencing or inhibiting wheat TaLNUE protein expression using genetic engineering techniques include:

[0045] We designed a single-stranded guide RNA (sgRNA) targeting the wheat TaLNUE gene, constructed an expression vector that knocks out the TaLNUE gene, and transformed the expression vector into the starting plant.

[0046] Preferably, the nucleotide sequence of the single-stranded guide RNA targeting the wheat TaLNUE gene is as shown in SEQ ID NO: 5 or SEQ ID NO: 6, and more preferably SEQ ID NO: 6.

[0047] Preferred methods for transforming the expression vector into the starting plant include Agrobacterium tumefaciens infection.

[0048] A third aspect of the present invention provides the application of transgenic plants cultivated by the cultivation method described in the second aspect in plant breeding.

[0049] In one or more embodiments, plant breeding methods include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

[0050] The beneficial effects of this invention are as follows:

[0051] This invention relates to the field of genetic engineering technology, specifically to the application of wheat TaLNUE protein in regulating plant tolerance to low nitrogen stress. This invention designs a single-stranded guide RNA (sgRNA) targeting the wheat TaLNUE gene, constructs an expression vector that knocks out the TaLNUE gene, and transforms this expression vector into wild-type wheat to obtain transgenic wheat with suppressed TaLNUE gene function. Studies have found that inhibiting the expression of wheat TaLNUE protein can increase spike length and spikelet number in wheat under low nitrogen stress, thereby increasing the yield per plant and total yield under low nitrogen stress, and improving the nitrogen uptake and utilization efficiency of wheat under low nitrogen stress. The technical solution of this invention provides a practical method for increasing wheat yield under low nitrogen stress using genetic engineering technology, which has significant practical production application value and broad market application prospects. Attached Figure Description

[0052] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0053] Figure 1 This is the coding region of the TaLNUE gene in the wheat variety Chinese Spring; where: the single underlined sequence is the sgRNA sequence used for gene editing;

[0054] Figure 2 Sequencing results for the talnue-ko-21# strain, in which gene editing occurred in all three homologous copies;

[0055] Figure 3 The protein coding results are for the talnue-ko-21# strain in which gene editing has occurred in all three homologous copies; where A is TaLNUE, B is TaLNUE1B, and C is TaLNUE1D.

[0056] Figure 4 Phenotypic traits of JW1 and homozygous knockout line talnue-ko-21# are compared; where A is a physical image of the phenotypic traits, B is a statistical graph of spikelet length, and C is a statistical graph of spikelet number. Detailed Implementation

[0057] It should be noted that the following detailed descriptions are exemplary and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0058] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0059] This invention designs a single-stranded guide RNA (sgRNA) targeting the wheat TaLNUE gene, constructs an expression vector to knock out the TaLNUE gene, and transforms this vector into wild-type wheat to obtain transgenic wheat with suppressed TaLNUE gene function. Studies have shown that inhibiting the expression of wheat TaLNUE protein can increase spike length and spikelet number under low nitrogen stress, thereby increasing the yield per plant and total yield under low nitrogen stress, and improving the efficiency of nitrogen uptake and utilization in wheat under low nitrogen stress. The technical solution of this invention provides a practical method for increasing wheat yield under low nitrogen stress using genetic engineering technology.

[0060] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0061] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0062] Unless otherwise specified, all experimental materials used in the following examples were purchased from conventional biochemical reagent companies.

[0063] The high-fidelity enzyme required for PCR amplification is KOD-FX NEO (Toyobo).

[0064] The restriction endonuclease BsaI and T4 ligase required for Gibson assembly were purchased from NEB.

[0065] The inorganic salts required for the preparation of the culture medium were purchased from Sinopharm Group, and the vitamins and antibiotics were purchased from Sigma-Aldrich.

[0066] The plant CRISPR / Cas9 gene editing vector is pBUE411, which contains the wheat U3 promoter TaU3 to initiate sgRNA. Cas9 mimics the high 5' GC content characteristic of grass genes and is a genetically designed and synthesized gene with optimized plant codons. The plasmid pBUE411 is publicly available from China Agricultural University, and its sequence is publicly known, with a length of 17430 bp.

[0067] The Escherichia coli strain used in this invention is E. coli Transgen5α Purchased from Beijing Quanshi Gold Company;

[0068] The wheat variety JW1 used in this invention is a new germplasm with good tissue culture ability, bred by the Crop Research Institute of Shandong Academy of Agricultural Sciences. It is available to the public from the Crop Research Institute of Shandong Academy of Agricultural Sciences.

[0069] Example 1

[0070] Construct an expression vector to knock out the TaLNUE gene:

[0071] (1) Design of sgRNA targeting TaLNUE:

[0072] Using the CRISPRdirect website (http: / / crispr.dbcls.jp / ), a suitable target site was found in the coding region of the TaLNUE gene. A 20 bp sequence fragment before the PAM structure was identified and set as the target sequence. In this embodiment, one sgRNA was used as an example for knockout experiment. Its nucleotide sequence is GTCGCGGCGCGCGATATCCGCGG, as shown in SEQ ID NO: 6. Figure 1 The underlined sequence in the TaLNUE gene sequence shown is the sgRNA sequence targeting the TaLNUE gene, and the CGG at the 3' end of the sgRNA is the PAM sequence.

[0073] (2) Obtain the fragment containing sgRNA:

[0074] Primers TaLNUE-gR1-F and TaLNUE-gR1-R were phosphorylated and directly annealed to form double strands. The reaction system was as follows: TaLNUE-gR1-F (10 μM): 4 μL, TaLNUE-gR1-R (10 μM): 4 μL, 10×T4 PNK buffer: 1.5 μL, PNK: 1 μL, ATP: 1 μL, and ddH2O to a final volume of 15 μL. PCR reaction was performed at 37 ℃ for 30 min; 95 ℃ for 5 min; and then cooled to 25 ℃ at a rate of 5 ℃ / min.

[0075] Among them, TaLNUE-gR1-F (SEQ ID NO: 19): GTCGCGGCGCGCGATATCCG;

[0076] TaLNUE-gR1-R (SEQ ID NO: 20): CGGATATCGCGCGCCGCGAC.

[0077] (3) Ligation of pBUE411 vector with sgRNA:

[0078] The pBUE411 and sgRNA were ligated using Gibson assembly. The specific reaction system was as follows: pBUE411 plasmid (100 ng / μL): 2 μL, product fragment from step (2): 2 μL, 10×NEB T4 buffer: 1.5 μL, 10×BSA: 1.5 μL, BsaI: 1 μL, T4 ligase: 1 μL, and ddH2O to make up to 15 μL. The reaction system was incubated in a 37 ℃ water bath for 5 h to obtain the pBUE411 vector ligation product with sgRNA.

[0079] (4) Transformation and identification:

[0080] The pBUE411 vector ligation product with sgRNA was transformed into E. coli. Specifically, the pBUE411 vector ligation product with sgRNA was added to competent E. coli cells. E. coli Transgen5α The cells were placed in an ice bath for 20 min, subjected to a heat shock reaction at 42 °C for 60 s, then in an ice bath for 2 min. Antibiotic-free LB was added, and the cells were placed in a shaker at 37 °C for 1 h to recover. The cells were then spread onto LB (containing kanamycin) plates and incubated upside down at 37 °C until clones emerged. Three single clones were selected for sequencing using primers pBUE411-F and pBUE411-R.

[0081] PBUE411-F (SEQ ID NO: 21): TTGTAAAACGACGGCCAGTG;

[0082] pBUE411-R (SEQ ID NO: 22): TGCACTGCAGGCATGCAA;

[0083] Sequencing results detected the target sequence of sgRNA, and simultaneously detected the TaU3 promoter sequence upstream of the target sequence. The sequencing results indicate that the expression cassette E1 containing sgRNA was successfully assembled into the pBUE411 binary expression vector, proving the successful construction of the CRISPR / Cas9 gene editing vector for TaLNUE, namely the recombinant binary expression vector pBUE411-TaLNUE. The complete nucleotide sequence of this recombinant binary expression vector pBUE411-TaLNUE is composed of the three nucleotide fragments shown in SEQ ID NO: 7, SEQ ID NO: 23, and SEQ ID NO: 24, assembled sequentially.

[0084] The recombinant binary expression vector pBUE411-TaLNUE includes expression cassette E1 and expression cassette E2; the nucleotide sequence of expression cassette E1 is shown in SEQ ID NO: 8, and from upstream to downstream it consists of: a TaU3 promoter from wheat, a single-stranded guide RNA (sgRNA) targeting the TaLNUE gene, and a terminator T1; the nucleotide sequence of expression cassette E2 is shown in SEQ ID NO: 9, and from upstream to downstream it consists of: a ubiquitin promoter from maize, a maize Cas9 coding sequence, and a terminator T2.

[0085] Among them: the nucleotide sequence of the wheat TaU3 promoter is shown in SEQ ID NO: 10; the nucleotide sequence of the single-stranded guide RNA targeting the wheat TaLNUE gene is shown in SEQ ID NO: 6; and the nucleotide sequence of the terminator T1 is shown in SEQ ID NO: 11.

[0086] The nucleotide sequence of the maize ubiquitin promoter Ubi is shown in SEQ ID NO: 12; the nucleotide sequence of the maize Cas9 coding sequence is shown in SEQ ID NO: 13; and the nucleotide sequence of the terminator T2 is shown in SEQ ID NO: 14.

[0087] Example 2

[0088] Acquisition and identification of genetically modified offspring:

[0089] (1) Obtaining TaLNUE transgenic offspring:

[0090] The recombinant binary expression vector pBUE411-TaLNUE constructed in Experiment 1 was transformed into Agrobacterium EHA105 competent cells. Specifically, the recombinant binary expression vector pBUE411-TaLNUE was added to Agrobacterium EHA105 competent cells and incubated on ice for 5 min, flash-frozen in liquid nitrogen for 5 min, heat-shocked at 37 °C for 5 min, then incubated on ice for 5 min, and then added to antibiotic-free LB medium. The cells were then incubated on a shaker at 28 °C for 2 h. After that, the cells were spread on LB agar plates (containing rifampin, streptomycin, and kanamycin) and incubated upside down at 28 °C until colonies grew. Single colonies were picked and inoculated into LB medium containing the corresponding antibiotics, and cultured at 28 °C and 160 rpm for 24 h.

[0091] JW1 wheat seeds, approximately 15 days post-pollination, were harvested, and the embryos were extracted. 1 mL of Agrobacterium suspension was added to a 1.5 mL centrifuge tube, along with 1.4 μL of acetylsylgenin (0.1 M). The mixture was then inoculated with the prepared bacterial solution for 5 min, and placed on a co-culture medium. The tubes were incubated in the dark at 23 °C for 3 days. After co-culture, the tubes were placed on a resting medium and incubated in the dark at 25 °C for 5 days. Callus tissue was transferred to selection medium A, the plates were sealed with sealing film, and incubated in the dark at 25.5 °C for 2 weeks. After cutting the callus, it was transferred to selection medium B, the plates were sealed again with sealing film, and incubated in the dark at 25.5 °C for another 2 weeks. After 2 weeks of callus selection, resistant callus exhibiting green buds was transferred to regeneration medium. The plates were sealed and incubated in a 25 °C incubator under light / dark conditions (16 h / 8 h) for 2 weeks. Two weeks after regeneration, the healthy seedlings are transferred to new resistance regeneration boxes. Once the seedlings have grown to a certain size, samples can be taken for testing.

[0092] Genomic DNA was extracted from young leaves of regenerated wheat using the cetyltrimethylammonium bromide (CTAB) method. PCR identification was performed using primers BUE-DF1 and BUE-DR1. The PCR reaction program was as follows: 2×PCR master mix: 10 μL, BUE-DF1 (10 μM): 0.5 μL, BUE-DR1 (10 μM): 0.5 μL, gDNA (50 ng / μL): 1 μL, ddH2O: 8 μL. The PCR reaction program was: 95 ℃ pre-denaturation for 5 min, 95 ℃ denaturation for 30 s; 58 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 32 cycles; 72 ℃ annealing for 5 min.

[0093] BUE-DF1 (SEQ ID NO: 15):TCATTGAGCAGATTTCCGAGT;

[0094] BUE-DR1 (SEQ ID NO: 16):ATTTGCAGCTTTTCTAGGTCT.

[0095] The various culture media and their preparation methods involved in the above-mentioned wheat genetic transformation process can be found in the following literature:

[0096] Kan Wang (ed.), Agrobacterium Protocals: Volume 1, Methods in Molecular Biology, vol.1223DOI10.007 / 978-1-4939-1695-5_15, Spring Science+Businessed Media New York 2015.

[0097] The formulations of co-culture medium, rest medium, medium A, medium B and regeneration medium are shown in Table 1.

[0098] Table 1. Formulations of co-culture medium, resting medium, medium A, medium B, and regeneration medium.

[0099]

[0100] (2) Identification of TaLNUE transgenic knockout progeny:

[0101] Wheat is an allohexaploid, and the TaLNUE gene is a copy on chromosome 1A (amino acid sequence SEQ ID NO: 2). Homologous copies on chromosomes 1B and 1D are TaLNUE1B (amino acid sequence SEQ ID NO: 3) and TaLNUE1D (amino acid sequence SEQ ID NO: 4). The three copies share high DNA sequence homology, necessitating simultaneous detection of gene editing in all three homologous copies. This experiment used the Hi-TOM gene editing site detection kit purchased from Xi'an Qingxue Biotechnology Co., Ltd. This kit performs high-throughput library construction via PCR and directly analyzes the variation information of multiple samples and sites using Hi-TOM online software. Specific primers (Seq-F and Seq-R) flanking the target sequence were used to simultaneously amplify TaLNUE, TaLNUE1B, and TaLNUE1D. The amplified products were then used to construct a library and sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing.

[0102] Seq-F (SEQ ID NO: 17):gagtacggtgtgcGGCGCCGGGGCGGAAGAC;

[0103] Seq-R (SEQ ID NO: 18): ggatgctggatggCCTGCGGCGCGCCCAC.

[0104] The gene editing results of the target genes wheat TaLNUE, TaLNUE1B, and TaLNUE1D are as follows: Figure 2 As shown, its encoded amino acid sequence is as follows Figure 3 As shown. Comparison revealed that the mutant proteins talnue, talnue1b, and talnue1d exhibited large deletions and frameshift mutations starting from amino acids 51 to 94. The results indicate that the sgRNA was successfully transformed with the Cas9 element and functioned, editing the TaLNUE gene and resulting in large deletions and frameshift mutations in the three proteins TaLNUE, TaLNUE1B, and TaLNUE1D, leading to the corresponding loss of gene function.

[0105] The first round of PCR reaction consisted of: 1 μL of leaf DNA from wheat plants transfected with the pBUE411-TaLNUE gene as template, 10 μL of 2× Taq Master Mix from the kit, 0.5 μL each of 10 μM Seq-F and Seq-R, and nuclease-free water to a final volume of 20 μL. The PCR conditions were: 94 ℃ pre-denaturation for 2 min; 94 ℃ denaturation for 30 s, 64 ℃ annealing for 30 s, 72 ℃ extension for 20 s, for a total of 32 cycles; and a final extension at 72 ℃ for 5 min. After PCR, 5 μL of agarose gel electrophoresis was used to detect the PCR products, ensuring the presence and specificity of the target product. The second round of PCR was then performed using 12 μL of Hi-TOM Mix from the kit, with 1 μL of the first round PCR product added as template, and nuclease-free water to a final volume of 20 μL. PCR reaction procedure: 94 ℃ denaturation for 2 min; 94 ℃ denaturation for 30 s, 58 ℃ annealing for 30 s, 72 ℃ extension for 25 s, for a total of 33 cycles; final extension at 72 ℃ for 5 min. The amplification products were mixed and gel-extracted. The gel-extracted products were used as the library construction and sequencing samples, which were then sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing. The gene editing results are as follows: Figure 2 and Figure 3 As shown.

[0106] Example 3

[0107] Representative typology of wheat after knockout of TaLNUE, TaLNUE1B, and TaLNUE1D genes:

[0108] Analysis of the knockout lines after Hi-Tom sequencing revealed a transgenic homozygous three-copy gene knockout line (named talnue-ko-21#).

[0109] Wild-type recipient variety JW1 and the homozygous knockout line talnue-ko-21#, containing the TaLNUE gene and its homologous copy, were co-cultured in the artificial climate chamber of Shandong University's Qingdao campus under the following conditions: 16 h light, 8 h dark; daytime temperature 22 ℃, nighttime temperature 16 ℃; humidity 40%-50%; CO2 concentration 500 ppm-700 ppm; high nitrogen environment (540 mg calcium nitrate per pot); low nitrogen environment (180 mg calcium nitrate per pot). During the wheat growth cycle, the spike length and spikelet number of JW1 and talnue-ko-21# were recorded after growth in soils with different nitrogen contents. The spike length and spikelet number of eight individual plants of JW1 and talnue-ko-21# were also recorded.

[0110] The results showed that, compared with wild-type JW1 wheat, the homozygous knockout line talnue-ko-21# showed no statistically significant difference from JW1 under high nitrogen (540 mg N) conditions. Compared with wild-type JW1, the mutant line talnue-ko-21# exhibited significantly increased spike length and spikelet number under low nitrogen conditions (e.g., ...). Figure 4 This indicates that knockout of the TaLNUE gene has a significant positive regulatory effect on spike length and spikelet number in wheat under low nitrogen conditions.

[0111] This invention constructs a pBUE411-TaLNUE binary recombinant vector containing sgRNA that specifically targets TaLNUE and its homologous genes. By using Agrobacterium to infect wheat embryo-induced callus tissue, the TaLNUE gene is specifically edited to lose its function, significantly increasing spike length and spikelet number under low nitrogen conditions, which is beneficial for wheat cultivation under low nitrogen conditions.

[0112] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. Applications of wheat TaLNUE protein and related biomaterials in any of the following: a1) Application of regulating spike length in plants under low nitrogen stress; a2) Application of regulating spikelet number in plants under low nitrogen stress; a3) Application in regulating total yield of plants under low nitrogen stress; a4) Application of regulating plant yield per plant under low nitrogen stress; a5) Applications in cultivating plants tolerant to low nitrogen stress; The wheat TaLNUE protein is the protein shown in b1) or b2) below: b1) The protein with the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4; b2) Fusion proteins obtained by attaching tags to the N-terminus and / or C-terminus of the proteins shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4; The regulation is achieved by silencing or inhibiting the expression of wheat TaLNUE protein to increase spike length and spikelet number in wheat under low nitrogen stress, thereby increasing the yield per plant and total yield of wheat under low nitrogen stress. The plant in question is wheat.

2. The application as described in claim 1, characterized in that, The biological material associated with wheat TaLNUE protein is any one of c1) to c4) below: c1) Nucleic acid molecules encoding wheat TaLNUE protein; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1) or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3).

3. A method for cultivating a transgenic plant, characterized in that, include: Transgenic plants were obtained by silencing or inhibiting the expression of wheat TaLNUE protein using genetic engineering techniques; The wheat TaLNUE protein is the protein shown in b1) or b2) below: b1) The protein with the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4; b2) Fusion proteins obtained by attaching tags to the N-terminus and / or C-terminus of the proteins shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4; Among them, the transgenic plant has at least one of the following characteristics compared with the original plant: d1) Ear length increases under low nitrogen stress; d2) The number of spikelets increases under low nitrogen stress; d3) Total yield increases under low nitrogen stress; d4) Increased yield per plant under low nitrogen stress; The plant in question is wheat.

4. The cultivation method as described in claim 3, characterized in that, Methods for silencing or inhibiting wheat TaLNUE protein expression using genetic engineering techniques include: We designed a single-stranded guide RNA targeting the wheat TaLNUE gene, constructed an expression vector that knocks out the TaLNUE gene, and transformed the expression vector into the starting plant.

5. The cultivation method as described in claim 4, characterized in that, The nucleotide sequence of the single-stranded guide RNA targeting the wheat TaLNUE gene is shown in SEQ ID NO:

6.

6. The cultivation method as described in claim 4, characterized in that, Methods for transforming expression vectors into the starting plant include Agrobacterium tumefaciens infection.

7. The application of the transgenic plant cultivated by the cultivation method according to any one of claims 3 to 6 in wheat breeding.

8. The application as described in claim 7, characterized in that, Methods of wheat breeding include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

Citation Information

Patent Citations

  • Animal-derived food pathogen identification and drug-resistant and toxic gene detection composite chip

    CN105950732A

  • Composition for enhancing nitrogen assimilation in plants

    TW202435757A