Alcohol-free lysis solution and nucleic acid extraction kit suitable for various sample nucleic acid extraction
By using an alcohol-free lysis buffer and nucleic acid extraction kit containing components such as cetearyl alcohol polyether and alkyl glycosides, the complexity of nucleic acid extraction for multiple sample types and the problem of alcohol residue have been solved, achieving efficient and convenient nucleic acid extraction and detection.
Patent Information
- Application Number
- CN202411634828.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-15
- Publication Date
- 2026-06-05
- Estimated Expiration
- 2044-11-15
AI Technical Summary
Existing nucleic acid extraction reagents suffer from problems such as residual alcohol affecting detection accuracy, inconvenient transportation, and high cost. Alcohol-free reagents also have poor compatibility with multiple sample types, are complex to operate, have poor stability, and cannot process blood samples, thus limiting their application scope.
Using cetearyl alcohol polyether and alkyl glycosides as lysis agents, combined with guanidine salts, reducing agents and buffers, an alcohol-free lysis buffer was prepared. With the addition of magnetic bead solution, washing solution and elution solution, the composition and ratio were optimized to achieve efficient nucleic acid extraction for multiple sample types.
It achieves high-quality nucleic acid extraction, simplifies the operation process, is suitable for automated equipment, and is applicable to various sample types, especially blood samples. It reduces operation time and cost, and improves extraction efficiency and detection accuracy.
Smart Images

Figure BDA0005136887930000071 
Figure BDA0005136887930000081 
Figure BDA0005136887930000091
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to an alcohol-free lysis buffer and nucleic acid extraction kit suitable for nucleic acid extraction from a variety of samples. Background Technology
[0002] Nucleic acid extraction, as one of the most fundamental experiments in molecular biology, is the first step in biological research. Subsequent processes such as cloning, PCR, qPCR, library construction, and sequencing all require nucleic acids to proceed smoothly, and the quality of the extracted nucleic acids is a key factor determining the success or failure of downstream experiments. In the context of the COVID-19 pandemic, the downstream nucleic acid testing industry has become one of the important standards for virus diagnosis and is experiencing rapid development. As a highly efficient and accurate detection method, nucleic acid testing plays a crucial role in the early diagnosis, prevention, and treatment of diseases through pathogen detection, cancer screening, and personalized medication guidance. Therefore, in practical applications, nucleic acid extraction faces a wide variety of sample types, and the requirements for the compatibility of extraction reagents with different sample types are becoming increasingly stringent.
[0003] For nucleic acid extraction reagents for multiple sample types, including alcohol-containing and alcohol-free reagents, alcohol-containing reagents suffer from several drawbacks. Alcohol residues inhibit the reaction, affecting the accuracy of test results. Furthermore, ethanol and isopropanol are flammable and volatile liquids, making transportation inconvenient and requiring self-preparation, which increases costs and procedures. Additionally, alcohol-containing pre-packaged reagents use aluminum foil sealing, which places high demands on the quality of the aluminum foil, further increasing costs. Alcohol-free reagents, on the other hand, are limited to a single sample type. For multi-sample extraction reagents, the kit components are complex, requiring different extraction methods for different samples. The reagents exhibit poor stability, demanding storage conditions, and cumbersome operation procedures with long extraction times, hindering automation. They also cannot handle blood samples or blood sample types, limiting their application scope. Therefore, the development of multi-sample nucleic acid extraction reagents with a wide range of applications, simple reagent components, high stability, easy operation, short extraction time, and compatibility with automated equipment is imperative. Summary of the Invention
[0004] In view of this, the technical problem to be solved by the present invention is to provide an alcohol-free lysis buffer and a nucleic acid extraction kit suitable for nucleic acid extraction from a variety of samples.
[0005] This invention provides the application of cetearyl alcohol polyether and / or alkyl glycosides in cell lysis.
[0006] Furthermore, the cetearyl alcohol polyether is selected from at least one of cetearyl alcohol polyether-6, cetearyl alcohol polyether 10, cetearyl alcohol polyether-12, cetearyl alcohol polyether 20 and / or cetearyl alcohol polyether 25; in a specific embodiment of the present invention, cetearyl alcohol polyether 12 is used as an example for cell lysis.
[0007] The alkyl glycoside is selected from at least one of undecyl glucoside, dodecyl glucoside, hexadecyl glucoside and / or decyl glucoside; in a specific embodiment of the present invention, undecyl glucoside is used as an example for cell lysis.
[0008] This invention provides a lysis buffer comprising guanidine salts, cetearyl alcohol polyethers, alkyl glycosides, and / or reducing agents;
[0009] The guanidine salt is a powerful protein denaturant that can break the secondary bonds between nucleic acids and proteins, causing the nucleoprotein to unlink and release the viral nucleic acid, and can directly lyse and inactivate the virus; furthermore, the guanidine salt is selected from at least one of guanidine hydrochloride, guanidine nitrate, guanidine carbonate, guanidine thiocyanate and / or guanidine phosphate; in a specific embodiment of the present invention, guanidine isothiocyanate is preferred.
[0010] The cetearyl alcohol polyether is selected from at least one of cetearyl alcohol polyether-6, cetearyl alcohol polyether 10, cetearyl alcohol polyether-12, cetearyl alcohol polyether 20 and / or cetearyl alcohol polyether 25. In a specific embodiment of the present invention, cetearyl alcohol polyether 12 is preferred.
[0011] The alkyl glycoside is selected from at least one of undecyl glucoside, dodecyl glucoside, hexadecyl glucoside and / or decyl glucoside, and in specific embodiments of the present invention, undecyl glucoside (C11APG) is preferred;
[0012] The reducing agent is selected from at least one of tris(carboxyethyl)phosphine, dithioerythritol, tris(hydroxypropyl)phosphine and / or thioglycerol; in specific embodiments of the present invention, dithioerythritol is preferred.
[0013] The lysis solution also includes a buffer component.
[0014] The buffer component includes at least one of Tris buffer, HEPES buffer, Tris-HCl buffer, or TAPS buffer.
[0015] The pyrolysis solution also includes a nonionic detergent.
[0016] The nonionic detergent is used to dissolve and separate membrane proteins, thereby improving protein separation efficiency. The nonionic detergent is selected from n-octyl-β-D-glucopyranoside, dodecyl-β-D-maltodextrin, and polyoxyethylene lauroyl ether.
[0017] Furthermore, the lysis solution described in this invention comprises guanidine isothiocyanate, polyvinyl lauroyl ether, cetearyl alcohol polyether 12, undecyl glucoside, dithioerythritol, and Tris.
[0018] Furthermore, the lysis buffer of the present invention comprises 3-5 mol / L guanidine isothiocyanate; 8 wt%-15 wt% polyoxyethylene lauroyl ether; 0.25 wt%-10 wt% cetearyl alcohol polyether-12; 0.25 wt%-10 wt% undecyl glucoside; 1 wt%-10 wt% dithioerythritol; and 0.05-0.2 M Tris.
[0019] The optimal lysis buffer described in this invention is 4.5 mol / L guanidine isothiocyanate; 10 wt% polyoxyethylene lauroyl ether; 5 wt% cetearyl alcohol polyether-12; 5 wt% undecyl glucoside; 3 wt% dithioerythritol; and 0.1 M Tris (Formula b of this invention in Example 2).
[0020] Furthermore, the lysis buffer described in this invention uses a strong acid solution to adjust the pH to 7-9.
[0021] Furthermore, before the lysis buffer described in this invention is used, it can be pretreated with proteinase K at a concentration of 0.05 mg / ml to 1 mg / ml. In a specific embodiment of this invention, 0.2 mg / ml may be selected.
[0022] This invention optimizes the composition and ratio of the lysis buffer;
[0023] In some embodiments of the present invention, the composition of the lysis buffer was optimized; the types of cetearyl alcohol polyether, alkyl glycosides, and reducing agents were screened, and the experimental results showed that the lysis performance was better when the cetearyl alcohol polyether was cetearyl alcohol polyether 12, the alkyl glycoside was undecyl glucoside, and the reducing agent was dithioerythritol.
[0024] Furthermore, in this invention, the lysis buffer may include guanidine isothiocyanate, polyethylene lauroyl ether, Tris, cetearyl alcohol ether 12, undecyl glucoside, and dithioerythritol; the lysis buffer may also include guanidine isothiocyanate, polyethylene lauroyl ether, Tris, cetearyl alcohol ether 12, undecyl glucoside, and dithioerythritol. This invention also validated Triton X-100 and / or Tween 20. Experimental results showed that neither Triton X-100 nor Tween 20 could obtain effective amplification results after being added to the lysis buffer.
[0025] In some embodiments of the present invention, the composition ratio of the pyrolysis solution has been optimized; in the present invention, the pyrolysis solution is:
[0026] It may include 3 mol / L guanidine isothiocyanate, 8% wt polyoxyethylene lauroyl ether, 50 mmol / L tris(hydroxymethyl)aminomethane, 0.25 wt cetearyl alcohol polyether 12, 0.25 wt% undecyl glucoside and 1 wt% dithioerythritol (formulation a of the present invention in Example 2);
[0027] It may also include 4.5 mol / L guanidine isothiocyanate, 10% wt polyoxyethylene lauroyl ether, 100 mmol / L tris(hydroxymethyl)aminomethane, 5 wt% cetearyl alcohol polyether 12, 5 wt% undecyl glucoside and 3 wt% dithioerythritol (formulation b of the present invention in Example 2);
[0028] It may also include 5 mol / L guanidine isothiocyanate, 15% wt polyoxyethylene lauroyl ether, 200 mmol / L tris(hydroxymethyl)aminomethane, 10 wt% cetearyl alcohol polyether 12, 10 wt% undecyl glucoside and 5 wt% dithioerythritol (formulation c of the present invention in Example 2);
[0029] The experimental results show that when the lysis buffer is above a certain level, good nucleic acid can be obtained and the Ct value can meet the amplification requirements. Among them, the formulation b of the present invention in Example 2 is the best.
[0030] The present invention provides a kit comprising at least one of a magnetic bead solution, a washing solution and / or an elution solution and the lysis buffer described in the present invention.
[0031] Furthermore, the magnetic beads in the magnetic bead solution are magnetic microspheres with surfaces modified with hydroxyl, amino, silane, or polyethylene glycol.
[0032] Furthermore, the surface of the magnetic microspheres is coated with silicon dioxide.
[0033] Furthermore, the particle size of the magnetic beads is 50–500 nm.
[0034] Furthermore, the washing solution includes washing solution 1 and washing solution 2; washing solution 1 includes guanidine isothiocyanate, tris(hydroxymethyl)aminomethane hydrochloride, sodium chloride and / or disodium ethylenediaminetetraacetate dihydrate;
[0035] Furthermore, the washing solution 1 comprises 1-2 mol / L guanidine isothiocyanate, 50-200 mmol / L tris(hydroxymethyl)aminomethane hydrochloride (Tris), 20-100 mmol / L sodium chloride, 25-100 mmol / L disodium ethylenediaminetetraacetate dihydrate, and a pH value of 6-7.
[0036] In this invention, in formulation a of Example 2, the washing solution 1 consists of 1 mol / L guanidine isothiocyanate, 50 mmol / L tris(hydroxymethyl)aminomethane hydrochloride (Tris), 20 mmol / L sodium chloride, and 25 mmol / L disodium ethylenediaminetetraacetate dihydrate, with a pH of 6.
[0037] In this invention, in formulation b of Example 2, the washing solution 1.5 consists of 2 mol / L guanidine isothiocyanate, 100 mmol / L tris(hydroxymethyl)aminomethane hydrochloride (Tris), 60 mmol / L sodium chloride, and 50 mmol / L disodium ethylenediaminetetraacetate dihydrate, with a pH of 6.
[0038] In this invention, in formulation c of Example 2, the washing solution 1 consists of 2 mol / L guanidine isothiocyanate, 200 mmol / L tris(hydroxymethyl)aminomethane hydrochloride (Tris), 100 mmol / L sodium chloride, and 100 mmol / L disodium ethylenediaminetetraacetate dihydrate, with a pH of 6.
[0039] Washing solution 2 includes tris(hydroxymethyl)aminomethane hydrochloride;
[0040] Furthermore, the washing solution 2 comprises 10–100 mmol / L tris(hydroxymethyl)aminomethane hydrochloride, with a pH of 7–8;
[0041] In a specific embodiment of the present invention, the washing solution 2 is 50 mmol / L tris(hydroxymethyl)aminomethane hydrochloride with a pH of 7;
[0042] The eluent includes tris(hydroxymethyl)aminomethane;
[0043] Furthermore, the eluent contains 10–50 mmol / L tris(hydroxymethyl)aminomethane, with a pH of 8–9;
[0044] In a specific embodiment of the present invention, the eluent is 10 mmol / L tris(hydroxymethyl)aminomethane with a pH of 8.
[0045] This invention provides a method for extracting nucleic acids, which includes processing a sample using the lysis buffer and / or the kit described in this invention to obtain nucleic acids.
[0046] Furthermore, the nucleic acid extraction method of the present invention includes the following steps: the sample is mixed with proteinase K, magnetic bead solution and lysis buffer, and then incubated, magnetically adsorbed, washed and eluted to obtain the nucleic acid.
[0047] Furthermore,
[0048] The incubation conditions are 35℃~39℃ for 1~5 min, and in a specific embodiment of the present invention, it is 37℃ for 2 min;
[0049] The magnetic attraction time is 60-90 seconds;
[0050] The washing process involves sequentially washing with washing solution 1 and washing solution 2.
[0051] The washing and elution process also includes a step of magnetically removing the liquid, which is a conventional operation performed by those skilled in the art and will not be described in detail here.
[0052] The elution conditions are: incubation at a constant temperature of 80℃ for 3–5 minutes.
[0053] The volume ratio of proteinase K (20 mg / ml), sample solution, magnetic bead solution and lysis buffer is (2-5):(20-60):(5-20):(60-120), specifically 3:60:10:120.
[0054] Specifically, in a specific embodiment of the present invention, the extraction method includes the following steps:
[0055] Step 1: Add 20 μL proteinase K (20 mg / ml), 600 μL sample solution, 100 μL magnetic bead solution, and 1.2 ml lysis buffer to a 2 ml centrifuge tube (the concentration of proteinase K in the lysis system at this time is 0.208 mg / ml), mix well, and incubate in a 37°C incubator for 2 min to obtain the lysate.
[0056] Step 2: After the disruption liquid is allowed to stand for 60-90 seconds and then magnetically attracted, magnetic beads with adsorbed nucleic acid are obtained; the magnetic beads with adsorbed nucleic acid are washed with 2 ml of washing solution 1 and then magnetically attracted to remove the liquid, and then washed with 2 ml of washing solution 2 and magnetically attracted to remove the liquid; then eluted with 100-300 μL of elution solution to obtain the nucleic acid.
[0057] The nucleic acid extraction method of this invention includes at least one of the following samples: oropharyngeal swabs, nasopharyngeal swabs, vaginal swabs, cervical swabs, cervical exfoliated cells, herpes fluid, serum, plasma, and / or saliva. It is particularly compatible with the extraction of nucleic acids from blood-containing samples such as vaginal / cervical swabs encountered in clinical testing. In a specific embodiment of this invention, the samples include cervical exfoliated cell samples and blood samples. Experimental results of this invention show that the lysis buffer and kit described herein can be used for the extraction of nucleic acids from cervical exfoliated cell samples, cervical exfoliated cell blood-containing samples, and blood samples. Compared with existing technologies, the concentration of extracted nucleic acids is significantly increased, resulting in better detection performance for real-time quantitative PCR. Furthermore, compared with other alcohol-free multi-sample nucleic acid extraction methods, this invention has simpler operation steps, does not require the separate addition of binding agents or enhancers, does not add ethanol or isopropanol during the entire operation, has fewer inhibitory residues, and the experimental steps are simple, requiring only about 20 minutes for the entire process. It is safe and pollution-free, free of toxic reagents such as chloroform and phenol, and suitable for various sample types, especially blood-containing samples that cannot be resampled.
[0058] The kit described in this invention comprises proteinase K, lysis buffer, washing buffer, and elution buffer, enabling the extraction of nucleic acids from different samples. In this kit, the strong denaturing agent guanidine salt in the lysis buffer lyses cells; detergents such as polyethylene glycol lauroyl ether and proteinase K facilitate complete cell lysis; reducing agents such as erythritol help protect the activity of proteinase K, allowing it to function effectively; alkyl glucoside and cetearyl alcohol polyether help rupture red blood cells and increase the solubility of hemoglobin in blood cells, removing heme and avoiding residues that inhibit subsequent PCR amplification. Then, the sample is washed with alcohol-free washing buffers 1 and 2 to remove impurities such as proteins and salt ions, ultimately obtaining high-quality viral nucleic acids (DNA or RNA). The reagents in this invention work synergistically to achieve the extraction of nucleic acids from different samples and obtain better extraction results. Compared with existing technologies, the extracted nucleic acid concentration is high, resulting in better detection performance. Furthermore, the kit is easy to operate, does not require the use of alcohols, and can be used both manually and on automated platforms. Combined with different detection reagents, it enables fully automated, randomized, simultaneous detection of multiple sample types, showing broader application prospects.
[0059] This invention provides an alcohol-free lysis buffer and kit, wherein the alcohol-free lysis buffer comprises guanidine salt, cetearyl alcohol polyether, and alkyl glucoside. Compared with existing alcohol-free nucleic acid extraction reagents, it offers higher nucleic acid extraction concentration, simpler experimental procedures, shorter processing time, contains no toxic reagents, and exhibits better detection performance. Furthermore, it can be integrated with automated platforms to achieve fully automated, randomized, simultaneous detection of multiple sample types, demonstrating broader application prospects. Detailed Implementation
[0060] This invention provides an alcohol-free lysis buffer and nucleic acid extraction kit suitable for nucleic acid extraction from various samples. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.
[0061] In the prior art, patent "CN113462683A - Alcohol-free washing solution and nucleic acid extraction kit suitable for nucleic acid extraction of various samples" contains dithiothreitol, a toxic reagent with an irritating odor, in its lysis buffer. Dithiothreitol is easily degraded at room temperature and needs to be prepared and used immediately, which is not conducive to automation. Moreover, it does not mention whether it is suitable for processing blood samples. Patent CN111254141B - Nucleic acid extraction composition and its application contains reagents and kits containing the nucleic acid extraction composition. The alcohol-free lysis buffer can process various sample types, but its composition includes nucleic acid carrier, binding solution, washing solution, lysis buffer, enhancer, and elution buffer. The process is complex and the extraction time is long. In addition, the reagent has poor stability at room temperature and needs to be stored at 2-8°C, resulting in high storage and transportation costs. The patent "An Alcohol-Free Nucleic Acid Extraction Kit and Method Using Magnetic Beads" (Publication No.: CN116121237A) contains proteinase K, lysis buffer, magnetic bead solution, first washing buffer, second washing buffer, third washing buffer, and elution buffer. Different extraction procedures are required for different sample types, making simultaneous extraction of multiple sample types impossible. The process for blood samples takes approximately 30 minutes, which is relatively long. Therefore, this invention provides a nucleic acid extraction reagent and kit for multiple sample types that features simple reagent components, high stability, easy operation, short extraction time, and can be integrated with automated equipment.
[0062] The test materials used in this invention are all common commercially available products. The invention is further illustrated below with reference to embodiments:
[0063] Example 1: Processing of Blood Samples
[0064] I. Components of the lysis buffer:
[0065] 1. Sample preparation: Cervical exfoliated cell samples from different patients (containing 20% whole blood to simulate whole blood interference); the formula is shown in Table 1;
[0066] Table 1. Components of the lysis buffer
[0067]
[0068]
[0069] 2. Extraction steps of this invention:
[0070] The reagent extraction steps of this invention are as follows:
[0071] a (lysis): Take 20 μL of proteinase K (20 mg / ml), 300 μL of blood-containing cervical exfoliated cell sample, 100 μL of silica hydroxyl magnetic bead solution (concentration 10 mg / mL, particle size 300 nm), and 1.2 ml of lysis buffer and add them to a 2 ml centrifuge tube. Mix well and incubate at 37 °C for 2 min.
[0072] b (protein removal washing): Place the centrifuge tube from step 1 on the magnetic rack and let it stand for 60-90 seconds until the magnetic beads are completely adsorbed. Discard the liquid. Remove the magnetic plate, add 2ml of washing solution 1 to the centrifuge tube, mix well, insert the magnetic plate, and magnetically attract for 60-90 seconds. Discard the liquid.
[0073] c (Desalting ion washing): Remove the magnetic plate, add 2 ml of washing solution 2 to the centrifuge tube, mix well, insert the magnetic plate, magnetically attract for 60-90 seconds, and then discard the liquid.
[0074] d (Nucleic acid elution): Remove the centrifuge tube from the magnetic rack in step 3, add 80 μL of elution buffer, mix well, and incubate at a constant temperature of 80℃ for 3 min. Place the centrifuge tube on the magnetic rack and let it stand for 1-2 min until the magnetic beads are completely adsorbed. Then, transfer the nucleic acid solution to a new centrifuge tube to obtain the nucleic acid solution, which can be used for downstream detection or stored for later use.
[0075] 3. Detection: Five clinically positive HPV16 samples (samples 1-5) were detected using the HPV16 detection reagent (PCR-fluorescent probe method) from the publicly disclosed patent of Antu Bio, "Primer Combination, Probe Combination and Human Papillomavirus Nucleic Acid Detection Kit" (CN 112575123 A).
[0076] Table 2. PCR reaction solution formulation
[0077]
[0078] The sequences used for detection are as follows, the PCR reaction solutions are shown in Table 2, the amplification program is shown in Table 3, and the operation method is performed according to the instructions in the patent (HPV16 upstream primer: ccacaataatggcatttgttggggtaacca (SEQ ID NO:1); HPV16 downstream primer: cgtctgcagttaaggttattttgcacgttg (SEQ ID NO:2); HPV16 probe: taaactgtaaatcatattcctccccatg-CY5 (SEQ ID NO:3); internal standard upstream primer: gactctctctgcctattggtctatt (SEQ ID NO:4); internal standard downstream primer: cccataacagcatcaggagtg (SEQ ID NO:5); internal standard probe: cagatccccaaaggactcaaagaacc-HEX (SEQ ID NO:6)):
[0079] Table 3. PCR amplification program
[0080]
[0081] Table 4. Optimization Results 1
[0082]
[0083] Table 4 shows that Triton X100 or Tween 20 alone were ineffective in this lysis buffer formulation, while effective nucleic acid amplification and detection results could be obtained by using cephalotearyl alcohol polyether, alkyl glycoside, and reducing agent alone.
[0084] II. Concentration Screening:
[0085] 1. Sample preparation: Cervical exfoliated cell samples from different patients (containing 20% whole blood to simulate whole blood interference); lysis buffer reagent formulation is shown in Table 5:
[0086] It is understood that the lysis buffer of the present invention is also compatible with different types of washing and elution buffers: when validating formulations 13-31, the washing and elution buffers used are the washing buffer 1, washing buffer 2, and elution buffer formulations corresponding to those in Table 1 of Example 1; when validating formulation 32, the washing / elution buffer uses the basic formulation, i.e., the washing buffer contains 0.1M Tris-HCl and 150mM NaCl, pH=7; the Tris elution buffer contains 10mM Tris-HCl and 1mM EDTA, pH=8.0; the extraction steps are the same as in "2. Extraction Steps of the Present Invention". The amplification reagents used are shown in Tables 2 and 3, and 5 clinical HPV16 positive samples (samples 6-10) were tested. The results are shown in Table 6. 0.25 wt%–10 wt% cetearyl alcohol polyether, 0.25 wt%–10 wt% alkyl glycoside, and 1 wt%–10 wt% reducing agent can all effectively process blood samples; among these, cetearyl alcohol polyether is preferably 5 wt%–10 wt%, alkyl glycoside is preferably 5 wt%–10 wt%, and reducing agent is preferably 1 wt%–5 wt%. The Ct values obtained by the washing and elution solutions of this invention are approximately 3 Ct lower than the Ct values of the basic washing / elution solutions.
[0087] Table 5. Optimization of lysis buffer concentration
[0088]
[0089] Table 6. Concentration Screening Results
[0090]
[0091]
[0092] Example 2 Combined Test
[0093] 1. Sample preparation: Cervical exfoliated cell samples from the same patient (containing 20% whole blood to simulate whole blood interference);
[0094] 2. Reagent preparation: The reagent formulas and comparative reagents of this invention are shown in Table 7.
[0095] Table 7. Reagent formulations and comparative reagents of the present invention
[0096]
[0097] 3. Extraction steps:
[0098] The extraction steps for the comparison reagent and this reagent are the same as the extraction steps of the present invention in Example 1.
[0099] 4. Testing
[0100] The human papillomavirus (types 16 and 18) nucleic acid detection kit (PCR-fluorescent probe method) (National Medical Device Registration Certificate No. 20173400081) of Sansure Biotech was used. The amplification system and amplification program were configured according to the instructions, and the above-mentioned prepared nucleic acids were amplified using an ABI7500.
[0101] Table 8 shows that the amplification results of the present invention were all detected in formulations a to c, while the results of the comparison reagents were all missed, indicating that the combination of Tween20 and TritonX-100 did not play a key role in processing blood cells in the system of the present invention.
[0102] Table 8. Detection results of the formulation and comparative reagents of this invention.
[0103]
[0104] Example 3: Comparison of the nucleic acid extraction kit of the present invention with an alcohol-based nucleic acid extraction or purification reagent (Sansure-Xiangchang Medical Device Registration No. 20150021-S10015) and a similar product in the prior art (CN 116334073 A - A blood alcohol-free extraction kit based on magnetic beads and its usage method).
[0105] 1. Formula comparison: The reagent formula in the extraction kit of the present invention adopts formula c in Table 7 of Example 2. The formula of comparative reagent 1 - prior art CN 116334073 A is shown in Table 9 below. The formula of comparative reagent 2 - alcohol extraction reagent was purchased.
[0106] Table 9. Existing technology CN 116334073 A Reagent formulation
[0107]
[0108] 2. Comparison of extraction steps
[0109] 2.1 Extraction steps of the present invention:
[0110] a (lysis): Add 20 μL proteinase K (20 mg / ml), 200 μL blood, 100 μL magnetic bead solution, and 1.2 ml lysis buffer to a 2 ml centrifuge tube, mix well, and incubate at 37°C for 2 min.
[0111] b (protein removal washing): Place the centrifuge tube from step 1 on the magnetic rack and let it stand for 60-90 seconds until the magnetic beads are completely adsorbed. Discard the liquid. Remove the magnetic plate, add 2ml of washing solution 1 to the centrifuge tube, mix well, insert the magnetic plate, and magnetically attract for 60-90 seconds. Discard the liquid.
[0112] c (Desalting ion washing): Remove the magnetic plate, add 2 ml of washing solution 2 to the centrifuge tube, mix well, insert the magnetic plate, magnetically attract for 60-90 seconds, and then discard the liquid.
[0113] d (Nucleic acid elution): Remove the centrifuge tube from the magnetic rack in step 3, add 80 μL of elution buffer, mix well, and incubate at a constant temperature of 80°C for 3 min. Place the centrifuge tube on the magnetic rack and let it stand for 1-2 min until the magnetic beads are completely adsorbed. Then, transfer the nucleic acid solution to a new enzyme-free centrifuge tube to obtain the nucleic acid solution, which can be used for downstream detection or stored for later use.
[0114] 2.2 Comparison reagent 1 - Extraction steps of prior art CN 116334073 A:
[0115] a (lysis): Take 200 μL of blood sample and place it in a 1.5 ml centrifuge tube. Add 200 μL of lysis buffer, 20 μL of proteinase K and 20 μL of magnetic bead suspension. Vortex to mix. Preheat the water bath or constant temperature mixer to 65°C and incubate at 1700 rpm for 20 minutes.
[0116] b (rinsing): Fix the centrifuge tube on the magnetic rack and let it stand for 1 minute, then discard the solution; add 500 μL of rinsing solution 1, vortex to mix, fix the centrifuge tube on the magnetic rack and let it stand for 1 minute, then discard the solution.
[0117] c (rinsing): Add 500 μL of rinsing solution 2, vortex to mix, fix the centrifuge tube on a magnetic rack and let it stand for 1 minute, then discard the solution. Repeat once;
[0118] d (Nucleic Acid Elution): After brief centrifugation, the centrifuge tubes were reattached to a magnetic rack, and the solution at the bottom of the tubes was removed using a pipette. 80 μL of elution buffer was added to the centrifuge tubes, and the tubes were vortexed to fully suspend the magnetic beads in the elution buffer. The centrifuge tubes were then fixed at 56°C and 1600 rpm for 10 minutes of elution. The tubes were then fixed to a magnetic rack and allowed to stand for 2 minutes. The resulting supernatant was the nucleic acid extract, which was transferred to centrifuge tubes and stored at -20°C for later use.
[0119] 2.3 Comparative reagent 2 - Alcohol extraction reagent: Proceed according to the instructions.
[0120] 3. Comparison of reagent performance
[0121] Ten whole blood samples were collected, and nucleic acid extraction was performed using the kit of this invention and Comparative Reagent 1 and Comparative Reagent 2, respectively. The corresponding nucleic acids were collected and detected using the Human ALDH2 Gene Detection Kit (PCR-Fluorescent Probe Method) (National Medical Device Registration Certificate 20243400144) sold by Antu Biotechnology. The operation method was performed according to the kit instructions. The results are shown in Table 10. Comparison revealed that in both channels, the Ct value of blood samples extracted using the kit of this embodiment was on average 2-3 Ct lower than that extracted using Comparative Reagent 1 kit, and 1.5 Ct lower than that of Comparative Reagent 2 (alcohol-based extraction kit). There was a linear relationship between the Ct value and the logarithm of the starting template; a 10-fold difference in template amount corresponded to a Ct value difference of approximately 3.3 cycle numbers. The Ct value accurately characterizes the quantity and quality of the target nucleic acid. Corresponding to this invention, the recovery rate of the blood sample extraction kit for the target nucleic acid of this invention is approximately 4 times higher than that of the prior art (Prior Art CN 116334073A) and approximately 2 times higher than that of the alcohol-based extraction kit.
[0122] Table 10. Comparison of Reagent Performance
[0123]
[0124] Example 4: Comparison of detection results between formulation c in reagent formulation table 7 of the present invention and formulation table 9 in prior art (CN 116334073 A) with cross-interchangeable extraction steps.
[0125] 1. The reagent formulation table 7 (Formula c) of this invention and the prior art CN 116334073A (Formula 9) were used simultaneously for whole blood extraction using the extraction steps of this invention (Example 1). Nucleic acids were detected using the Human ALDH2 Gene Detection Kit (PCR-Fluorescent Probe Method) (National Medical Device Registration Certificate 20243400144) sold by Antu Biotechnology. The operation method followed the kit instructions. Table 11. Detection results of reagent formulation table 7 (Formula c) of this invention and prior art CN 116334073A (Formula 9) using the extraction steps of this invention.
[0126]
[0127] The results are shown in Table 11. The Ct values extracted from the two channels of this invention are about 11 Ct lower than those of the prior art, indicating that other reagents are not suitable for the detection steps of this invention, and the detection effect of the reagents and steps of this invention is better than that of the comparative document.
[0128] 2. The reagent formulation table 7 (Formula c) of this invention and the formulation table 9 of the prior art (CN 116334073 A) were used simultaneously for whole blood extraction using the extraction steps of the prior art (the existing extraction steps in Example 2). Nucleic acid was detected using the Human ALDH2 Gene Detection Kit (PCR-Fluorescent Probe Method) (National Medical Device Registration Certificate 20243400144) sold by Antu Biotechnology. The operation method followed the kit instructions. The results are shown in Table 12. The Ct values extracted from the two channels of this invention were approximately 2-3 Ct values lower than those of the prior art, and the nucleic acid recovery rate of this invention was approximately 4 times higher than that of the prior art.
[0129] Table 12. Comparison of detection results between reagent formulation c of the present invention (Table 7) and prior art formulation 10 (Table 10) using the extraction steps of the prior art.
[0130]
[0131] Experimental results show that, regardless of whether the extraction steps of this invention or the extraction steps of the prior art are used, the reagent of this invention exhibits superior results, especially when the reagent of this invention is used in conjunction with the steps of this invention, the results are optimal.
[0132] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A lysis buffer, characterized in that, include: Guanidine isothiocyanate, polyvinyl lauroyl ether, cetearyl alcohol polyether, alkyl glycosides, reducing agents and Tris.
2. The pyrolysis solution according to claim 1, characterized in that, The cetearyl alcohol polyether is selected from at least one of cetearyl alcohol polyether-6, cetearyl alcohol polyether 10, cetearyl alcohol polyether-12, cetearyl alcohol polyether 20 and / or cetearyl alcohol polyether 25; The alkyl glycoside is selected from at least one of undecyl glucoside, dodecyl glucoside, hexadecyl glucoside and / or decyl glucoside; The reducing agent is selected from at least one of tris(carboxyethyl)phosphine, dithioerythritol, tris(hydroxypropyl)phosphine, and / or thioglycerol.
3. The pyrolysis solution according to claim 2, characterized in that, The lysis buffer comprises: guanidine isothiocyanate, polyoxyethylene lauroyl ether, cetearyl alcohol polyether 12, undecyl glucoside, dithioerythritol and Tris.
4. The pyrolysis solution according to claim 3, characterized in that, It includes 3-5 mol / L guanidine isothiocyanate; 8 wt%-15 wt% polyoxyethylene lauroyl ether; 0.25 wt%-10 wt% cetearyl alcohol polyether-12; 0.25 wt%-10 wt% undecyl glucoside; 1 wt%-10 wt% dithioerythritol and 0.05-0.2 M Tris.
5. A reagent kit, characterized in that, The lysis buffer includes at least one of proteinase K, magnetic bead solution, washing solution and / or elution solution and the lysis buffer according to any one of claims 1 to 4.
6. The reagent kit according to claim 5, characterized in that, The washing solution includes washing solution 1 and washing solution 2; The washing solution 1 includes guanidine isothiocyanate, tris(hydroxymethyl)aminomethane hydrochloride, sodium chloride and / or disodium ethylenediaminetetraacetate dihydrate. Washing solution 2 includes tris(hydroxymethyl)aminomethane hydrochloride.
7. The reagent kit according to claim 6, characterized in that, The eluent includes tris(hydroxymethyl)aminomethane.
8. A method for extracting nucleic acids, characterized in that, This includes processing samples using the lysis buffer according to any one of claims 1 to 4 and / or the kit according to any one of claims 5 to 7 to obtain nucleic acids.
9. The extraction method according to claim 8, characterized in that, The samples include at least one of the following: oropharyngeal swabs, nasopharyngeal swabs, saliva, vaginal swabs, cervical swabs, cervical exfoliated cells, herpes fluid, serum, plasma, and / or whole blood.
Citation Information
Patent Citations
Nucleic acid extraction compositions and their applications, reagents and kits containing the nucleic acid extraction compositions.
CN111254141B
Primer combination, probe combination and human papilloma virus nucleic acid detection kit
CN112575123A
Alcohol-free cleaning solution suitable for nucleic acid extraction of multiple samples and nucleic acid extraction kit
CN113462683A
Magnetic bead method alcohol-free nucleic acid extraction kit and extraction method thereof
CN116121237A
Blood alcohol-free extraction kit based on paramagnetic particle method and use method
CN116334073A