Blueberry salt-tolerant related molecular marker and application

By detecting ProVcHKT1;1-InDel in the promoter of the blueberry VcHKT1;1 gene, the growth problem of blueberries under salt stress was solved, enabling rapid screening and breeding of salt-tolerant varieties and improving the growth ability of blueberries in saline soil.

CN119530420BActive Publication Date: 2026-05-22BEIJING FORESTRY UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311089501.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-28
Publication Date
2026-05-22
Estimated Expiration
2043-08-28

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure HDA0004417201670000011
    Figure HDA0004417201670000011
  • Figure HDA0004417201670000012
    Figure HDA0004417201670000012
Patent Text Reader

Abstract

The application discloses a blueberry salt-tolerant related molecular marker and application. The application provides application of a substance for detecting whether a ProVcHKT1;1-InDel is contained in a VcHKT1;1 gene promoter in a blueberry genome in any one of the following: 1) detecting or assisting in detecting blueberry salt tolerance; 2) breeding salt-tolerant blueberries; the nucleotide sequence of the ProVcHKT1;1-InDel is ATTGATAA; and the coding region of the VcHKT1;1 gene is a DNA molecule as shown in SEQ ID NO:1. The application identifies a nucleotide fragment located in the promoter and linked to blueberry salt tolerance, and the insertion or deletion of the fragment can be used as a blueberry salt-tolerant molecular marker. The application also provides a primer pair and a kit for detecting the blueberry salt-tolerant molecular marker and a method for detecting whether a blueberry is salt-tolerant.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a molecular marker for salt tolerance in blueberries and its application. Background Technology

[0002] blueberry( Vaccinium spp Blueberries (Vaccinium bracteatum) belong to the Ericaceae family and the Vaccinium genus. Their fruits are rich in anthocyanins, flavonoids, and other physiologically active components, possessing strong antioxidant properties and boosting immunity, among other health benefits. They have extremely high economic and health value and are one of the leading emerging economic forest industries in my country. Blueberries are highly sensitive to salt stress, with soil salinization leading to cultivation limitations and poor plant growth. However, research on the mechanisms by which blueberries respond to salt stress is still very limited, mainly focusing on physiological levels. Key genes for blueberry salt tolerance and their molecular and genetic mechanisms are rarely reported. Discovering blueberry salt-tolerant genes and elucidating their mechanisms of action is fundamental to screening and breeding superior salt-tolerant blueberry varieties. Salt stress is one of the most common abiotic stresses in nature, with a wide distribution and significant harm to plant growth. Long-term growth of plants in saline soils can cause various secondary stresses such as osmotic stress, ion toxicity, and oxidative stress, severely inhibiting their growth and development, and even leading to death. Therefore, developing molecular markers related to salt tolerance in blueberries for use in salt-tolerant molecular aids for blueberry production is of great significance.

[0003] Sodium ions (Na) + Na+ is the most abundant soluble cation in saline soils. Under salt stress, plant leaves accumulate excessive amounts of Na+. + This led to K + / Na + A decrease in the ratio leads to ion toxicity. It promotes the production of Na+ in the leaves. + The repulsion of plants is to maintain K + / Na + Homeostasis and an important mechanism for responding to salt stress, Na + Ion transport proteins and their regulators play important roles in this process, but so far, the regulation of Na+ in blueberry leaves has been limited. + No genes involved in rejection have been reported yet. Therefore, it is necessary to identify genes that regulate Na+ in blueberry leaves under salt stress. + Content and K + / Na + The ratio of genes is an important task in understanding the salt tolerance mechanism of blueberries. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker related to salt tolerance in blueberries and its application.

[0005] In a first aspect, the present invention provides the use of a substance for detecting whether the promoter of the VcHKT1;1 gene in the blueberry genome contains ProVcHKT1;1-InDel in any of the following:

[0006] 1) To test or assist in testing the salt tolerance of blueberries;

[0007] 2) Breeding salt-tolerant blueberries;

[0008] The nucleotide sequence of ProVcHKT1;1-InDel is ATTGATAA;

[0009] The coding region of the VcHKT1;1 gene is shown in the DNA molecule of SEQ ID NO:1.

[0010] In the above text, the VcHKT1;1 gene promoter is located upstream of the VcHKT1;1 gene in the blueberry genome and is used to drive the expression of the gene. In the embodiments of the present invention, the nucleotide sequence of the VcHKT1;1 gene promoter is SEQ ID NO:6 or SEQ ID NO:7.

[0011] In the above-described applications, the substance is any one of the following:

[0012] 1) Primer pair for amplifying ProVcHKT1;1-InDel;

[0013] 2) PCR reagents or kits containing the primer pairs described in 1);

[0014] 3) Instruments or reagents required for direct sequencing;

[0015] And / or, further, the primer pair consists of the single-stranded DNA molecule shown in SEQ ID NO:8 and the single-stranded DNA molecule shown in SEQ ID NO:9.

[0016] In a second aspect, the present invention provides a substance for detecting whether the promoter of the VcHKT1;1 gene in the blueberry genome contains ProVcHKT1;1-InDel, as described in the first aspect.

[0017] The substance mentioned above is any one of the following:

[0018] 1) Primer pair for amplifying ProVcHKT1;1-InDel;

[0019] 2) PCR reagents or kits containing the primer pairs described in 1);

[0020] And / or, further, the primer pair consists of the single-stranded DNA molecule shown in SEQ ID NO:8 and the single-stranded DNA molecule shown in SEQ ID NO:9.

[0021] Thirdly, the present invention provides a method for detecting or assisting in the detection of salt tolerance in blueberries, comprising the following steps:

[0022] To detect whether the promoter of the VcHKT1;1 gene in the blueberry genome contains ProVcHKT1;1-InDel,

[0023] Blueberries containing ProVcHKT1;1-InDel have higher or higher salt tolerance than blueberries that do not contain ProVcHKT1;1-InDel.

[0024] If the promoter of the VcHKT1;1 gene in the genome of the blueberry to be tested contains ProVcHKT1;1-InDel, then the blueberry to be tested is or is a candidate salt-tolerant variety. If the promoter of the VcHKT1;1 gene in the genome of the blueberry to be tested does not contain ProVcHKT1;1-InDel, then the blueberry to be tested is or is a candidate salt-sensitive variety.

[0025] The method described above for detecting whether the promoter of the VcHKT1;1 gene in the blueberry genome contains ProVcHKT1;1-InDel involves extracting genomic DNA from the blueberry leaf to be tested as a template, amplifying the blueberry using primer pair I, and then detecting the amplification product.

[0026] If the amplification product is 50 bp, then the promoter of the VcHKT1;1 gene in the blueberry genome being tested contains ProVcHKT1;1-InDel; if the amplification product is 41-42 bp, then the promoter of the VcHKT1;1 gene in the blueberry genome being tested does not contain ProVcHKT1;1-InDel.

[0027] Fourthly, the present invention provides a method for detecting or assisting in the detection of salt tolerance in blueberries, comprising the following steps:

[0028] Blueberries were subjected to PCR amplification using the primers described in the second aspect, and the PCR amplification products were detected.

[0029] Blueberries that produce a 50 bp PCR amplification product have higher or higher salt tolerance than blueberries that produce a 41-42 bp PCR amplification product.

[0030] Alternatively, if the PCR amplification product is 50 bp, the blueberry to be tested is or is a candidate salt-tolerant variety; if the PCR amplification product is 41-42 bp, the blueberry to be tested is or is a candidate salt-sensitive variety.

[0031] Fifthly, the present invention provides a method for breeding salt-tolerant blueberries, comprising the following steps: selecting blueberries containing ProVcHKT1;1-InDel as described in the third aspect, cultivating them, and obtaining salt-tolerant blueberries.

[0032] In a sixth aspect, the present invention provides a method for breeding salt-tolerant blueberries, comprising the following steps: selecting blueberries whose PCR amplification product is 50 bp as described in the fourth aspect, cultivating them, and obtaining salt-tolerant blueberries.

[0033] The beneficial effects of this invention are as follows:

[0034] (1) This invention provides a novel blueberry salt tolerance gene, its nucleotide sequence and its corresponding protein amino acid sequence, and identifies a nucleotide fragment located in the promoter that is inserted or deleted and linked to blueberry salt tolerance within this salt tolerance gene. The insertion or deletion of this fragment can serve as a molecular marker for blueberry salt tolerance. This invention also provides a primer pair and kit for detecting the blueberry salt tolerance molecular marker of this invention, as well as a method for detecting whether blueberries are salt-tolerant.

[0035] (2) Since blueberry salt tolerance is a quantitative trait, phenotypic analysis is time-consuming and laborious. The above-mentioned blueberry salt tolerance genes and their proteins, molecular markers, primer pairs and kits can be used to screen and breed blueberry salt tolerance varieties. They can be identified in the blueberry seedling stage, which is time-saving and accurate, and can accelerate the breeding process of blueberry salt tolerance varieties. Attached Figure Description

[0036] Figure 1 The results show the comparison between 'Duke' and 'Sweetheart' under control and salt stress conditions for 5 days; (A) shows the plant growth status of 'Duke' and 'Sweetheart' under control and salt stress conditions for 5 days; (B) is an enlarged view of the 7th leaf of each plant in Figure A; the scale bar is 10 cm.

[0037] Figure 2 Salt tolerance gene VcHKT1;1 Identification and genetic verification; among which (A) was performed using root transcriptome sequencing of 'Duke' and 'Sweetheart' cultivars under control and salt treatment conditions. VcHKT1;1 (A) is a schematic diagram of the pROK2-VcHKT1;1 vector structure; (B) is a diagram of the transcription level using Agrobacterium rhizogenes technology. VcHKT1;1 Afterwards, in genetically modified materials VcHKT1;1 Transcriptional levels; (D) wild-type and silent transcriptional levels after 4 days of growth under control or salt-treated conditions. VcHKT1;1 transgenic plants ( antiVcHKT1;1#1 , antiVcHKT1;1#2 , antiVcHKT1;1#3 , antiVcHKT1;1#4 , antiVcHKT1;1#5 , antiVcHKT1;1#6The growth status of ( ); where the scale size is 5 cm.

[0038] Figure 3 Wild-type and silent under control or salt treatment conditions VcHKT1;1 (referred to in the diagram) antiVcHKT1;1#1-6 Na in the leaves of transgenic plants + Content (A) and Na + / K + The ratio (B) was determined.

[0039] Figure 4 Salt tolerance gene VcHKT1;1 Genetic validation after complementation in Arabidopsis athkt1 mutant; (A) wild-type, athkt1 mutant (labeled athkt1 in the figure), and control and salt-treated conditions. VcHKT1;1 Growth of replanted plants (labeled Com#1 and Com#2 in the figure) after 6 days; the scale bar is 5 cm; (BC) represents the control or wild-type, athkt1 mutant, and [other plants] under salt treatment conditions. VcHKT1;1 Replenishing Na in plant leaves + Content (B) and Na + / K + The ratio (B) was determined.

[0040] Figure 5 for VcHKT1;1 A schematic diagram of the gene structure.

[0041] Figure 6 for VcHKT1;1 Electrophoresis diagram of PCR amplification of the full-length coding sequence of the gene; where 1 represents the amplification using cDNA from 'Duke' seedlings as a template. VcHKT1;1 Specific primers ( VcHKT1;1 -gene-F and VcHKT1;1 The PCR product obtained by amplification of -gene-R (expected product size 1563 bp), M is the DNA Marker (DL2000 Plus) of Tiangen Company.

[0042] Figure 7 for VcHKT Vector map after the gene coding sequence is ligated into the T vector.

[0043] ​ for ​ The encoded protein is located on the cell membrane and has Na+. +Transport activity; (A) is a schematic diagram of the pCAMBIA1300-VcHKT1;1-GFP vector structure; (B) is a schematic diagram of the pGEMHE-VcHKT1;1 vector structure; (C) shows the subcellular localization of VcHKT1;1-sGFP in tobacco epidermal cells; (D) shows the subcellular localization of VcHKT1;1-sGFP in Xenopus oocytes. ​ Na encoding protein + Transport activity.

[0044] ​ For the anti-sensitivity materials 'Duke' and 'Sweetheart' ​ Comparison of promoter transcriptional activity; (A) for 35S, 'Duke' and 'Sweetheart' promoters. ​ Promoter, and in 'sweetheart' ​ (A) Schematic diagram of the fusion of the promoter-1150-IDel with the reporter GUS; (B) GUS staining results of tobacco leaves after being transformed into the vector shown in (A); (C) GUS staining results of blueberry callus after being transformed into the vector shown in (A).

[0045] ​ The identification of the 8 bp nucleotide sequence difference between the resistant materials 'Duke' and 'Sweetheart'; (A) shows the results of PCR amplification using primer pair I in 'Duke' and 'Sweetheart'; where M is the DNA Marker (DL2000 Plus) from Tiangen Biotech; (B) shows the insertion position of the fragment ProVcHKT1;1-InDel identified in 'Duke' (indicated by the arrow in the figure), the positions of the primers pVcHKT1;1-F1 and pVcHKT1;1-R1 used to amplify the inserted fragment, and the sequencing results of the PCR product.

[0046] ​ The Na content in the leaves of salt-tolerant blueberry varieties (with ProVcHKT1;1-InDel insertion) and salt-sensitive blueberry varieties (without ProVcHKT1;1-InDel insertion) was measured. + Content comparison results. Detailed Implementation

[0047] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0048] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0049] 'Duke' and 'Sweetheart' were purchased from Weihai Beiguo Blueberry Technology Co., Ltd.

[0050] Example 1: Cloning and Functional Analysis of Salt Tolerance Genes in Blueberries

[0051] I. Discovery of Salt Tolerance Genes in Blueberries

[0052] Plants of two blueberry varieties, 'Duke' and 'Sweetheart', were grown for 5 days under salt treatment (150 mM NaCl) and normal growing conditions (control).

[0053] The results are as follows ​ As shown, there are significant differences in salt tolerance among plants under salt treatment conditions, with 'Duke' exhibiting higher salt tolerance than 'Sweetheart'.

[0054] Using 'Duke' and 'Sweetheart' blueberries under control and salt treatment conditions as materials, a candidate gene for salt tolerance in blueberries was identified through transcriptome sequencing analysis and named... ​ Salt treatment (150 mM NaCl) induced 'Duke' ​ The expression level was significantly upregulated (15-fold); while in 'sweetheart'... ​ The expression level is almost unaffected by salt induction ( ​ A).

[0055] ​ The nucleotide sequence of the gene is SEQ ID NO:1, and the protein encoded by the gene is named VcHKT1;1, with the amino acid sequence of the protein being SEQ ID NO:2.

[0056] II. Silence ​ The acquisition of genetically modified blueberries

[0057] 1. Obtaining a silent carrier

[0058] In order to obtain ​ The inventors designed an Anti-sense silencing sequence for the mutant and used PCR amplification to obtain a PCR fragment containing the Anti-sense silencing sequence, which was used to silence positions 870 bp-1090 bp of sequence 1.

[0059] The nucleotide sequence of the PCR fragment containing the anti-sense silencing sequence is SEQ ID NO:3, as follows:

[0060] 5'GCCTCGAACTGACAACTTGAAACAGAGATCCCACAAGTTTCTGGTAAGAATGCAGACCATTCAAAGCCTCTGAATTCCACTCCAAGGAGCAAAACAGTATCAACTGGACCAAAATGAACCCAAAAACAGTGGCTGCCAAACACAAACAATGCATACTTGACAACAAATGACTATACCCCAACTCCCCAAAGTTCTTCAAAAGATAACCAAACTCTTCTCTT 3'.

[0061] use ​ I and ​ I digested and ligated the PCR fragment containing the anti-sense silencing sequence and the pROK2 vector (described in the following literature: Development of an efficient root transgenic system for pigeonpea and its application to other important economically plants; Plant Biotechnology Journal (2019) 17, pp. 1804–1813) to obtain the recombinant vector.

[0062] The recombinant vector was transformed into *E. coli*, and colony PCR amplification was performed using universal primers pROK2-F (ATCCTTCGCAAGACCCTTCCTC) / pROK2-R (CGGCAACAGGATTCAATCTTA). Colonies with a target band of approximately 300 bp were identified as positive clones by electrophoresis. The corresponding bacterial cultures were sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing to obtain the correct pROK2-VcHKT1;1 vector (…). ​ B).

[0063] 2. Obtaining transgenic lines through transfection

[0064] pROK2-VcHKT1;1 was transferred into Agrobacterium tumefaciens MSU440; and T0 generation transgenic plants were obtained by infecting the roots of 'Duke' variety (hereinafter referred to as wild-type blueberry) seedlings (the method is as follows: Yu JQ, Gu KD, Sun CH, Zhang QY, Wang JH, Ma FF, You CX, Hu DG, Hao YJ (2021) The apple bHLH transcription factor MdbHLH3 functions in determining the fruit carbohydrates and malate. Plant Biotechnol J 19: 285-299. Meng D, Yang Q, Dong BY, Song ZH, Niu LL, Wang LT, Cao HY, Li HH, Fu YJ (2019) Development of an efficient root transgenic system for pigeon pea and its application to other important economically plants. Plant Biotechnol J 17: 1804-1813.).

[0065] RNA was extracted from the root tissue of T0 generation transgenic plants, and cDNA was obtained by reverse transcription. The cDNA was then detected using qRT-PCR. ​ The expression level was determined to identify transgenic positive plants. 'Duke' was used as a wild-type control.

[0066] The primers for the above qRT-PCR are: VcHKT1;1-RT-F: CATCATTCTTATTTGCATCACCGAGA, VcHKT1;1-RT-R: TTAAGATAGTTTCCAGGCTCTACCAC; the internal reference gene is... ​ The internal reference primers are VcUBC28-F: CCATCCACTTCCCTCCAGATTATCCAT, and VcUBC28-R: ACAGATTGAGAGCAGCACCTTGGA.

[0067] The results are as follows ​ As shown in C, WT#1 is a wild-type blueberry. ​ #1-6 are T0 generation transgenic plants, showing that compared to wild-type blueberries, ​ #1-6 ​ The amount of expression decreased, achieving silencing.​ Gene.

[0068] 3. Salt tolerance test

[0069] Salt treatment group: The above two identified ​ Plants #1-6 and wild-type 'Duke' (labeled WT#1 or #2 in the figure) were cultured in nutrient soil for 20 days, and then subjected to salt stress treatment for 5 days by adding 150 mM NaCl to the nutrient soil. Phenotypic results were observed.

[0070] Control group: The only difference from the salt treatment group was that 150 mM NaCl was not added.

[0071] The results are as follows ​ As shown in Figure D, it can be seen that under salt treatment conditions, compared with the wild-type 'Duke' (denoted as WT#2 in the figure), ​ #4-6 exhibited the same salt-sensitive phenotype as 'Sweetheart' under salt stress. ​ Plants with the gene silenced are more sensitive to salt stress, exhibiting yellowing leaves. This indicates that the gene is indeed involved in the blueberry's response to salt stress.

[0072] Leaf Na under salt stress + Content and Na + / K + To further evaluate the salt tolerance of different blueberry materials under the above-mentioned salt treatment group and control group e as physiological indicators, the leaf Na+ was compared with the control group e. + Content or Na + / K + The higher the ratio, the lower the salt tolerance.

[0073] The determination method was based on the following literature: Zhang, M., Cao, Y., Wang, Z., Wang, ZQ, Shi, J., Liang, X., Song, W., Chen, Q., Lai, J., and Jiang, C. (2018). Aretrotransposon in an HKT1 family sodium transporter causes variation of leaf Na + Exclusion and salt tolerance in maize. New Phytol 217:14882.

[0074] The results are as follows ​ As shown, A is the leaf Na + Content, B is Na + / K + Compared to salt stress, ​ #4-5 leaves Na+ Content and Na + / K + The ratio was significantly higher than that of the wild type, further illustrating... ​ It participates in regulating the salt tolerance of blueberries.

[0075] The above results indicate that silencing or suppression ​ Gene expression can reduce a plant's salt tolerance.

[0076] 4. Replenishment Experiment

[0077] Arabidopsis ​ The mutant (Wang Wenying, Functional study of HKT transporter protein in xerophytic succulent, Lanzhou University, 2019, Doctoral dissertation) is salt-sensitive, and the salt tolerance gene in blueberries is transferred to the mutant. ​ (SEQ ID NO:1) Introduced into Arabidopsis thaliana via Agrobacterium infection. ​ From the mutants, replacement plants com#1 and com#2 were obtained.

[0078] Replenish plants com#1 and com#2, Arabidopsis thaliana ​ Phenotypic observation and leaf Na content of mutant and wild-type Arabidopsis thaliana col-0 under salt stress were performed. + Content and Na + / K + Comparison of detection methods.

[0079] The results are as follows: using blueberry salt tolerance genes ​ Homologous genes in Arabidopsis ​ promoter ​ Driven in ​ Expression in mutants can enable ​ The mutant reverted to the salt-tolerant phenotype of wild-type Arabidopsis thaliana. ​ A). Leaf Na under salt stress + Content and Na + / K + The data further proves the above conclusion. ​ BC).

[0080] three, ​ As an introverted Na + Applications of transport proteins

[0081] 1. ​ Acquisition of exons

[0082] Based on the GDV website ​ Gene structure prediction: The full-length gene (from start codon to stop codon) is 6272 bp, containing three exons and two introns, with the coding region being 1563 bp in length. ​ As shown.

[0083] For cloning ​ The full-length coding sequence was obtained using salt-tolerant blueberry cultivar 'Duke' grown under salt stress for 5 days. Total RNA was extracted using the plant total RNA extraction kit (Cat.# DP441) from Tiangen Biotech (Beijing) Co., Ltd., and cDNA was obtained by reverse transcription using M-MLV reverse transcriptase from Prometheus (Beijing) Biotechnology Co., Ltd. ​ Specific primers (forward primers) ​ -gene-F: ATGGCGAATCTTGTTCGCTTAGCTCA; reverse primer ​ -gene-R: TTAAGATAGTTTCCAGGCTCTACCAC) is amplified by PCR to obtain the PCR amplification product, which is... ​ Encoded sequence fragments.

[0084] The above PCR amplification system is 50 μl, including: 25 μl of 2×Super Multiplex PCR Mix; 10 μM PCR amplification fluid. ​ -gene-F 2 μl; 10 μM Primer ​ -gene-R 2 μl; DNA 1 μl, ddH2O 20 μl). PCR amplification conditions were: pre-denaturation 95℃ 2 min, denaturation 95℃ 30 s, annealing 58℃ 30 s, extension 72℃ 1 min, 34 cycles from denaturation to extension, and a final extension at 72℃ 5 min.

[0085] The results are as follows ​ As shown, a product with the expected size (1563 bp) was obtained.

[0086] PCR products were recovered and purified using an Omega gel extraction kit (Cat.#D2500-02). The purified products were then ligated into the T-vector using the pEASY-Blunt Cloning Kit from Beijing TransGen Biotech Co., Ltd. (vector pattern shown in [link to kit]). ​ ), to get T Easy+ ​

[0087] The above-mentioned carrier T Easy+ ​Transfected with competent *E. coli* cells, single colonies were picked and colony PCR amplification was performed using universal primers M13-F / M13-R (M13-F: TGT AAA ACG ACG GCC AGT; M13-R: CAG GAA ACA GCT ATG ACC). Colonies with the target band size were identified as positive recombinants by electrophoresis. The corresponding bacterial cultures were sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing, yielding 1563 bp sequences. ​ The exon sequence, whose nucleotide sequence is shown in SEQ ID NO: 1, and the corresponding protein sequence is shown in SEQ ID NO: 2.

[0088] 2. ​ Acquisition of carrier

[0089] Bioinformatics prediction ​ Encode a Na + The transport protein was synthesized by using homologous recombinase (Vazyme ClonExpress II One Step Cloning Kit C112-01) to cleave the VcHKT1;1 fragment obtained in step 1 above and the pCAMBIA1300-GFP vector (Song Xiehai. (2021). Study on the biosynthesis mechanism of anthocyanins in autumn leaves of Pistacia chinensis (Doctoral Dissertation, Beijing Forestry University)) at the restriction enzyme site. ​ I and ​ Homologous recombination was performed at position I, and the recombinant product was transformed into *E. coli*. Colony PCR amplification was performed (primers F: CCAACCACGTCTTCAAAGCA; R: CGGTGGTGCAGATGAACTTC; 1500 bp was considered a positive clone), and positive clones with the target band were screened. The corresponding bacterial culture was sent to Beijing Ruiboxingke Biotechnology Co., Ltd., and the correct pCAMBIA1300-VcHKT1;1-GFP was finally obtained (pattern shown below). ​ (As shown in A).

[0090] The recombinant vector pCAMBIA1300-VcHKT1;1-GFP is the vector shown in SEQ ID NO: 1. ​ Replace pCAMBIA1300-GFP vector ​ I and ​ The fragment between the I restriction sites yields the recombinant vector.

[0091] 3. VcHKT1;1 Positioning Detection

[0092] pCAMBIA1300-VcHKT1;1-GFP (denoted as VcHKT1;1-GFP in the figure) was transformed into Agrobacterium GV3101. Single colonies were picked and inoculated into 3 ml of YEB liquid medium (containing antibiotics) and cultured overnight at 200 rpm and 28°C on a shaker. The overnight culture was then centrifuged at 4500 rpm for 5 min at room temperature to collect the cells. The Agrobacterium cells were then resuspended in osmotic medium (10 mmol MgCl2, 10 mmol MES and 100 uM acetylsylcholine) and the concentration was adjusted to OD. 600 The concentration was increased to 0.5-1.0; then, 1 mL of the infiltration culture medium containing Agrobacterium tumefaciens was drawn up with a needleless syringe and injected into the underside of the tobacco leaf (Nicotiana benthamiana); the injected tobacco continued to grow for 2-3 days; then, the fluorescence expression on the underside of the leaf was observed using a laser confocal microscope. pCAMBIA1300-GFP was used as a control (marked as 35S-GFP in the figure).

[0093] The results are as follows ​ As shown in Figure C, VcHKT1;1-GFP is located on the plasma membrane.

[0094] 4. ​ Gene encoding introverted Na + transport proteins

[0095] Meanwhile, experimental systems in Xenopus oocytes confirmed that VcHKT1;1 possesses the ability to transport Na+ inwards. + The activity. The specific experimental procedure is as follows:

[0096] use ​ I and ​ I obtained the above 1 containing ​ I and ​ The VcHKT1;1 fragment with restriction site I and the pGEMHE vector (kindly provided by Professor Jiang Caifu's laboratory at Agricultural University, A retrotransposon in an HKT1 family sodium transporter causes variation of leaf Na + Exclusion and salt tolerance in maize; New Phytol. 2018;217(3):1161-1176.) was double-digested, and the digested fragments were ligated using T4 ligase. The resulting recombinant vector was transformed into E. coli, and positive clones with the target band were screened by colony PCR amplification. The corresponding bacterial culture was sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing, and finally the correct pGEMHE-VcHKT1;1 was obtained (graph as shown). ​ (as shown in B)

[0097] pGEMHE-VcHKT1;1 was obtained by reverse transcription using a Promega kit. ​ cRNA; 25 nl (0.5 µg µl -1 )of ​ cRNA and an equal volume of H2O were injected into Xenopus oocytes; after culturing for 36 hours, different Na+ concentrations were recorded using voltage clamp. + Currents in Xenopus oocytes under specific concentration conditions (method reference: Zhang, M., Cao, Y., Wang, Z., Wang, ZQ, Shi, J., Liang, X., Song, W., Chen, Q., Lai, J., and Jiang, C. (2018). A retrotransposon in an HKT1 family sodium transporter causes variation of leaf Na + exclusion and salt tolerance in maize. New Phytol 217:14882.).

[0098] The results are as follows ​ As shown in D, injection ​ cRNA-mediated Xenopus oocytes can record a significant electric current, which increases with the amount of Na+ in the recording medium. + Changes in concentration significantly alter the recorded reversal potential. The recording voltage used in the experiment ranged from -140 mV to +40 mV. This indicates... ​ Encode an introverted Na + Transporter protein, which may regulate Na+ under salt stress + Salt tolerance in blueberries is regulated by long-distance transport from the roots to the above-ground parts.

[0099] Example 2: Blueberry Salt Tolerance Gene ​ ProVcHKT1;1-InDel in the promoter and its application

[0100] I. Discovery of ProVcHKT1;1-InDel

[0101] A primer pair, ProVcHKT1;1-F1 / R1, was designed to target the genomic DNA of 'Duke' and 'Sweetheart'. ​ The promoter sequence of the gene is used for cloning.

[0102] The primer sequences are:

[0103] ProVcHKT1;1-F1:ACAATGGTATCTGAGCTGTTGATCTCAA;

[0104] ProVcHKT1;1-R1: CTAGCTTCTTGTTTTGTGAAATGGCATTTG.

[0105] Amplification was performed using TOYOBO's KOD-Plus polymerase. The PCR system consisted of 50 μl of: 1 μl KOD-Plus, 5 μl 10X KOD Buffer, 5 μl 2 mM dDNP, 2 μl 25 mM MgSO4, 1.5 μl (F) + 1.5 μl (R) 10 μM Primer, 2.0 μl DNA, and 32 μl ddH2O. The PCR program was as follows: pre-denaturation at 94℃ for 2 min, denaturation at 94℃ for 15 s, annealing at 58℃ for 30 s, and extension at 68℃ for 2 min, for a total of 34 cycles from denaturation to extension. The PCR products were sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing. After obtaining the sequencing results, they were assembled using DNAMAN software.

[0106] 'Duke' ​ The promoter sequence is 1993 bp in length (nucleotide sequence SEQ ID NO:6), in 'sweetheart' ​ The promoter sequence is 1987 bp in length (nucleotide sequence is SEQ ID NO:7).

[0107] Multiple sequence alignment analysis showed that, in the two varieties ​ The promoter sequence contains 71 SNPs and 21 InDels. Bioinformatics analysis indicates that ProVcHKT1;1-InDel (ATTGATAA, 8-bp) may be the binding site of the MYB transcription factor (SEQ ID NO:6, positions 840-847).

[0108] Therefore, it is speculated that the insertion or deletion of ProVcHKT1;1-InDel is the cause of salt stress in 'Duke' and 'Sweetheart'. ​ The reasons for the differences in transcription levels.

[0109] II. ProVcHKT1;1-InDel Regulation ​ The function of the promoter

[0110] Duke and Sweetheart ​ The promoters were constructed into the PBI121 vector, and ProVcHKT1;1-InDel was introduced into 'Sweetheart' using site-directed mutagenesis. ​ On the promoter, ​A is a simplified schematic diagram of the three carriers mentioned above.

[0111] pVcHKT1;1 DK To extract the 'Duke' shown in SEQ ID NO:6 ​ The promoter was inserted between the ScaI and XbaI sites of the PBI121 vector to obtain the vector.

[0112] pVcHKT1;1 SH To make the sweetheart shown in SEQ ID NO:7 ​ The promoter was inserted between the ScaI and XbaI sites of the PBI121 vector to obtain the vector.

[0113] pVcHKT1;1 (SH-1150-IDel) Import ProVcHKT1;1-InDel into pVcHKT1;1 SH Carrier (insertion pVcHKT1;1) SH The vector contains SEQ ID NO:7 between 1145-1146bp; specifically, the Mut Express MultiS FastMutagenesis Kit V2 Novizan Vazyme kit was used.

[0114] The aforementioned vectors were transferred into the GV3101 strain, which then infected tobacco (Tobacco Benedictine) leaves and blueberry (blueberry variety "Hokuriku", purchased from Beiguo Blueberry Technology Co., Ltd.) callus tissue, respectively.

[0115] Salt treatment group: The above transfected callus culture medium was added with 150 mM NaCl for 3 hours to subject the tissue to salt stress.

[0116] Control group: The culture medium without added NaCl served as the control group.

[0117] The results of GUS staining of tobacco leaves and blueberry callus from each group are as follows: ​ As shown in BC, B is a tobacco leaf, and C is the result of blueberry callus tissue; pVcHKT1;1 in the figure DK / ​ pVcHKT1;1 DK Transfection, pVcHKT1;1 SH / ​ pVcHKT1;1 SH Transfection, pVcHKT1;1 (SH-1150-IDel) / ​ pVcHKT1;1 (SH-1150-IDel) Transfection shows that ​ Insertion of ProVcHKT1;1-InDel into the promoter leads to increased transcriptional activity and upregulation of transcriptional levels.

[0118] III. Blueberry Salt Tolerance Genes ​ Discovery and establishment of methods for ProVcHKT1;1-InDel insertion or deletion as a molecular marker

[0119] 1. Primers for amplifying ProVcHKT1;1-InDel

[0120] The ProVcHKT1;1-InDel insertion is present only in the salt-tolerant blueberry variety 'Duke', and it leads to the exponential activation of the salt-tolerant gene under salt stress. ​ Upregulation at the transcriptional level promotes salt tolerance in blueberries. Therefore, ProVcHKT1;1-InDel insertion can be used as a molecular marker to determine whether a blueberry variety is salt-tolerant.

[0121] Primers VcHKT1;1-F (forward) and VcHKT1;1-R (reverse) were designed using flanking sequences based on the ProVcHKT1;1-InDel insertion to form primer pair I: pVcHKT1;1-F: GTATAACCATGACAT / pVcHKT1;1-R: GTTATTGAGGGGTCCC (the specific locations of the primers on the gene are as follows...). ​ As shown in B).

[0122] 2. Methods for assessing the salt tolerance of blueberries

[0123] Using leaf genomic DNA from salt-tolerant blueberry cultivar 'Duke' and salt-sensitive cultivar 'Sweetheart' as templates, PCR amplification was performed using pVcHKT1;1-F / pVcHKT1;1-R.

[0124] Primer pVcHKT1;1-F: GTATAACCATGACAT (SEQ ID NO:8);

[0125] Primer pVcHKT1;1-R: CTTATAGGGGTCTC (SEQ ID NO:9).

[0126] The above PCR system (50 μl) consisted of: 25 μl of 2×Super Multiplex PCR Mix, 2.5 μl of 10 μM primer pVcHKT1;1-F, 2.5 μl of 10 μM primer pVcHKT1;1-R, 2 μl of DNA, and 18 μl of ddH2O. The PCR program was as follows: pre-denaturation at 95℃ for 2 min, denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, for 34 cycles from denaturation to extension, with a final extension at 72℃ for 5 min.

[0127] The results are as follows ​As shown in Figure A, PCR amplification using total DNA from the salt-tolerant blueberry variety 'Duke' as a template yielded a 50 bp band with primer pair I (detailed sequence in SEQ ID NO: 4), while PCR amplification using total DNA from the salt-sensitive blueberry variety 'Sweetheart' as a template yielded a 42 bp band with primer pair I (detailed sequence in SEQ ID NO: 5). The electrophoresis results were detected using 4% agarose gel electrophoresis. The specific sequences were obtained by sequencing the PCR products sent to Beijing Ruiboxingke Biotechnology Co., Ltd., and comparing the sequencing results with DNAMAN software. ​ B), SEQ ID NO: 4 and SEQ ID NO: 5 differ only in ProVcHKT1;1-InDel.

[0128] Therefore, ProVcHKT1;1-InDel is used as a molecular marker to identify whether a blueberry sample is salt-tolerant. This can be achieved by detecting [the marker] in the blueberry genome. ​ The presence of ProVcHKT1;1-InDel in the gene promoter is used to determine whether the blueberry being tested is salt-tolerant.

[0129] 3. Establishment of a method for identifying salt tolerance in blueberries using ProVcHKT1;1-InDel insertion or deletion.

[0130] Method A: Detection of the blueberry genome in the test ​ Does the gene promoter contain ProVcHKT1;1-InDel?

[0131] Blueberries containing ProVcHKT1;1-InDel have higher or higher salt tolerance than blueberries that do not contain ProVcHKT1;1-InDel.

[0132] Or if the blueberry genome to be tested contains ​ If the gene promoter contains ProVcHKT1;1-InDel, the blueberry being tested is or is a candidate for a salt-tolerant variety. If the blueberry genome being tested contains... ​ If the gene promoter does not contain ProVcHKT1;1-InDel, the blueberry being tested is or is a candidate for a salt-sensitive variety.

[0133] Method B: Genomic DNA was extracted from the blueberry leaves to be tested and used as a template. Primer pair I was used to amplify the blueberry leaves to be tested, and the amplification products were detected.

[0134] Blueberries with an amplification product of 50 bp showed higher or higher salt tolerance than blueberries with an amplification product of 41-42 bp.

[0135] If the amplification product is 50 bp, then the promoter of the VcHKT1;1 gene in the blueberry genome to be tested contains ProVcHKT1;1-InDel, and the blueberry to be tested is or is a candidate salt-tolerant variety.

[0136] If the amplification product is 41-42 bp, then the promoter of the VcHKT1;1 gene in the blueberry genome to be tested does not contain ProVcHKT1;1-InDel, and the blueberry to be tested is or is a candidate salt-sensitive variety.

[0137] The primer pair I above was named the salt-tolerant molecular marker VcSALT1.

[0138] In section A above, the detection of the blueberry genome... ​ Whether a gene promoter contains ProVcHKT1;1-InDel can be determined by direct sequencing or by using method B.

[0139] IV. Using salt tolerance molecular markers to detect whether blueberries are salt-tolerant

[0140] Twenty varieties of northern highbush blueberries (including some major cultivated varieties) were selected for testing, and the testing method is as shown in Method B of Section 3 above.

[0141] The results are shown in Table 1 below. Three varieties contain ProVcHKT1;1-InDel insertion, which are salt-tolerant varieties, and the PCR product length is 50 bp. The other 17 varieties do not contain ProVcHKT1;1-InDel insertion, which are salt-sensitive varieties, and the PCR product length is 42 bp.

[0142] Table 1 lists the names and identification results of the blueberry varieties used.

[0143]

[0144] “√” indicates that the PCR product has ProVcHKT1;1-InDel insertion; “×” indicates that the PCR product does not have ProVcHKT1;1-InDel insertion.

[0145] Three salt-tolerant varieties containing ProVcHKT1;1-InDel insertions (referred to as those with ProVcHKT1;1-InDel insertions in the figure) and seven salt-sensitive varieties without ProVcHKT1;1-InDel insertions (referred to as those without ProVcHKT1;1-InDel insertions in the figure) were selected using the method of this invention for salt sensitivity phenotypic experiments, and the Na+ in the leaves of each variety was measured under salt stress. + The content was determined according to the method described by Zhang et al. (2018).

[0146] The results are as follows​ As shown, under salt stress, the Na+ content in blueberry leaves with ProVcHKT1;1-InDel insertion is reduced. + The content was significantly lower than that of blueberries without ProVcHKT1;1-InDel insertion, which is consistent with the identification results of the salt-tolerant molecular marker VcSALT1 by the method of the present invention.

Claims

1. The application of detecting whether the promoter of the VcHKT1;1 gene in the blueberry genome contains ProVcHKT1;1-InDel in any of the following: 1) To test or assist in testing the salt tolerance of blueberries; 2) Breeding salt-tolerant blueberries; The nucleotide sequence of ProVcHKT1;1-InDel is ATTGATAAA, which is located at positions 840-847 of SEQ ID NO:6; The nucleotide sequence of the coding region of the VcHKT1;1 gene is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that: The substance is any one of the following: 1) Primer pair for amplifying ProVcHKT1;1-InDel; 2) PCR reagents or kits containing the primer pairs described in 1); The primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO:8 and a single-stranded DNA molecule shown in SEQ ID NO:

9.

3. A method for detecting or assisting in the detection of salt tolerance in blueberries, comprising the following steps: The test is performed to determine whether the promoter of the VcHKT1;1 gene described in claim 1 in the blueberry genome contains the ProVcHKT1;1-InDel described in claim 1. Blueberries containing ProVcHKT1;1-InDel have higher or higher salt tolerance than blueberries that do not contain ProVcHKT1;1-InDel. If the promoter of the VcHKT1;1 gene in the genome of the blueberry to be tested contains the ProVcHKT1;1-InDel, then the blueberry to be tested is or is a candidate salt-tolerant variety. If the promoter of the VcHKT1;1 gene in the genome of the blueberry to be tested does not contain the ProVcHKT1;1-InDel, then the blueberry to be tested is or is a candidate salt-sensitive variety.

4. A method for detecting or assisting in the detection of salt tolerance in blueberries, comprising the following steps: Blueberries were subjected to PCR amplification using the primers described in claim 2, and the PCR amplification products were detected. Blueberries that yielded a 50 bp PCR amplification product had higher or higher salt tolerance than blueberries that yielded a 42 bp PCR amplification product. Alternatively, if the PCR amplification product yields a 50 bp product, the blueberry to be tested is or is a candidate salt-tolerant variety; if the PCR amplification product yields a 42 bp product, the blueberry to be tested is or is a candidate salt-sensitive variety.

5. A method for breeding salt-tolerant blueberries, comprising the following steps: selecting blueberries containing ProVcHKT1;1-InDel as described in claim 3, cultivating them, and obtaining salt-tolerant blueberries.

6. A method for breeding salt-tolerant blueberries, comprising the following steps: selecting blueberries with a PCR amplification product of 50 bp as described in claim 4, cultivating them to obtain salt-tolerant blueberries.