Phosphate transketolase mutant from bifidobacterium adolescentis and application of phosphate transketolase mutant in production of metabolites

Abstract

The invention belongs to the field of gene engineering and enzyme engineering, and discloses a phosphoketolase mutant derived from bifidobacterium adolescentis and application of the phosphoketolase mutant in production of metabolites. By adopting a site-specific mutagenesis method, histidine at the 480th site of the phosphoketolase PKT from bifidobacterium adolescentis is mutated into lysine, so that the enzyme activity of the phosphoketolase is remarkably improved, and the problem that the existing phosphoketolase has relatively low catalytic performance on 6-phosphofructose is effectively solved; the strain is successfully applied to fermentation production of bacitracin, ectoine and gamma-aminobutyric acid, and a new thought is provided for improving the production level of metabolites.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and enzyme engineering, and specifically relates to a phosphoketolase mutant derived from Bifidobacterium adolescentis and its application in the production of metabolites. The metabolites involved include but are not limited to antibiotics (such as bacitracin) and amino acid derivatives derived from acetyl-coenzyme A (such as ectoine and γ-aminobutyric acid, etc.). Background Art

[0002] Bacitracin is a non-ribosomal peptide antibiotic with the advantages of strong antibacterial activity, broad antibacterial spectrum, and low resistance to drug resistance. It is widely used in the field of feed additives and veterinary drugs. Tetrahydropyrimidine and γ-aminobutyric acid are two typical aspartic acid and glutamic acid derivatives derived from acetyl-CoA, respectively, and play an important role in the food, pharmaceutical and chemical industries. At present, bacitracin, ectoine and γ-aminobutyric acid are mainly produced by microbial fermentation. In recent years, with the rapid development of genetic engineering technology, researchers have used genetic engineering methods to genetically modify host strains and successfully improved the production level of metabolites.

[0003] In the microbial glycolysis pathway, 1 mol of glucose is degraded to produce 2 mol of pyruvate, which is then catalyzed by the pyruvate dehydrogenase system to produce 2 mol of acetyl-CoA and release 2 mol of CO. 2 . This carbon loss is not only not conducive to the efficient synthesis of metabolites, but will also further aggravate the greenhouse effect and reduce the economy and sustainability of microbial manufacturing. The phosphoketolase (encoded by the gene fxpK) from Bifidobacterium adolescentis has bifunctional enzyme activity, which can catalyze the conversion of fructose 6-phosphate (F6P) into erythrose 4-phosphate (E4P) and acetyl phosphate (AcP), and can also catalyze the conversion of xylulose 5-phosphate (X5P) into 3-phosphoglyceraldehyde (G3P) and AcP; then, AcP generates acetyl-CoA under the catalysis of phosphotransacetylase. Compared with the reaction catalyzed by pyruvate dehydrogenase, the metabolic reaction catalyzed by phosphoketolase does not lose carbon atoms, but microbial fermentation usually uses host strains (including Escherichia coli, Corynebacterium glutamicum and Bacillus licheniformis, etc.) that do not have natural phosphoketolase. Introducing phosphoketolase into these strains can increase the yield and conversion rate of metabolites (especially metabolites derived from acetyl-CoA). However, the activity of natural phosphoketolase is low, and its expression level in the host strain needs to be greatly increased to show the effect of promoting the synthesis of metabolites, which limits its application potential. Therefore, it is urgent to develop phosphoketolase with better catalytic performance. Summary of the invention

[0004] The object of the present invention is to provide a phosphoketolase mutant derived from Bifidobacterium adolescentis, wherein the amino acid sequence of the phosphoketolase mutant H480K is shown in SEQ ID NO.4.

[0005] Another object of the present invention is to provide the use of the phosphoketolase mutant H480K in the fermentation production of metabolites.

[0006] In order to achieve the above object, the present invention adopts the following technical measures:

[0007] The applicant mutated the histidine H at position 480 of the wild-type phosphoketolase derived from Bifidobacterium adolescentis (shown in SEQ ID NO.2) to lysine K, and obtained the phosphoketolase mutant H480K of the present invention, as shown in SEQ ID NO.4.

[0008] The protection scope of the present invention also includes:

[0009] A fusion protein obtained by fusing the mutant protein described in SEQ ID NO.4 with a protein tag.

[0010] The mutant or fusion protein encoding gene described in SEQ ID NO.4.

[0011] An expression cassette, a recombinant vector, a recombinant microorganism or an in vitro recombinant cell having the above coding gene.

[0012] The mutant, fusion protein, mutant or fusion protein encoding gene of SEQ ID NO.4, expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the encoding gene are used in preparing metabolites.

[0013] A method for improving the activity of phosphoketolase comprises the following steps: mutating the phosphoketolase as follows: mutating the 480th histidine H in SEQ ID NO.4 to lysine K.

[0014] A method for preparing metabolites comprises the following steps: preparing metabolites by culturing the above-mentioned recombinant microorganism.

[0015] In the above-mentioned use or method, preferably, the metabolite is: bacitracin, an amino acid derivative derived from acetyl-CoA;

[0016] In the above-mentioned use or method, preferably, the amino acid derivative derived from acetyl-CoA is ectoine and / or γ-aminobutyric acid.

[0017] The encoding gene of the mutant described in SEQ ID NO.4 is preferably shown in SEQ ID NO.3.

[0018] In the above-mentioned uses or methods, preferably, the recombinant microorganism is a recombinant Bacillus licheniformis.

[0019] In the above-mentioned use or method, preferably, the Bacillus licheniformis is Bacillus licheniformis DW2.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] The present invention mutates the 480th histidine of the phosphoketolase molecule to lysine (named as mutant H480K in the present invention) by site-directed mutagenesis, greatly improves the enzyme activity of the phosphoketolase, and solves the problem that the catalytic efficiency of the current phosphoketolase to fructose 6-phosphate is not high. The phosphoketolase mutant H480K is integrated and expressed into the genome of Bacillus licheniformis DW2, and the ability of the transformed recombinant strain to ferment and produce bacitracin and metabolites derived from acetyl-CoA is significantly enhanced. The measurement results show that compared with the recombinant strain integrated with the expression of the wild-type phosphoketolase, the yields of bacitracin, ectoine and gamma-aminobutyric acid of the H480K mutant strain are increased by 7.18%, 21.01% and 23.48%, respectively, showing good prospects for industrial application. DETAILED DESCRIPTION

[0022] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention. The technical solutions described in the present invention are conventional solutions in the art unless otherwise specified; the reagents or materials described are all from commercial sources unless otherwise specified.

[0023] The culture medium involved in the following implementation cases is as follows:

[0024] LB liquid medium: yeast powder 5g·L -1 , Peptone 10 g·L -1 、NaCl 10g·L -1 , pH 7.0.

[0025] LB solid medium: yeast powder 5g L -1 , Peptone 10 g·L -1 、NaCl 10g·L -1 , agar powder 15g·L -1 .

[0026] TB medium: yeast powder 24g·L -1 , Peptone 12 g·L -1 , glycerol 5g·L -1 , K 2 HPO 4 ·3H 2 O 16.4 g·L-1 , KH 2 PO 4 2.3 g·L -1 , pH 7.0.

[0027] Bacitracin fermentation medium: corn starch 50g·L -1 , soybean meal 90g·L -1 , Light calcium carbonate 5g·L -1 , ammonium sulfate 2g·L -1 , pH 7.2.

[0028] Tetrahydropyrimidine fermentation medium: glucose 20g·L -1 , peptone 5g·L -1 , Yeast powder 5g·L -1 MgSO 4 7H 2 Og·L -1 NH 4 ) 2 SO 4 1g·L -1 , pH 7.2.

[0029] γ-aminobutyric acid fermentation medium: glucose 60g·L -1 , peptone 6g·L -1 , Yeast powder 12g·L -1 NH 4 ) 2 SO 4 6g·L -1 , K 2 HPO 4 ·3H 2 O 12.5 g·L -1 , KH 2 PO 4 2.5 g L -1 、Trace Metal Mix A9:CoCl 2 6H 2 O 0.4 g·L -1 , H 3 BO 4 0.05g·L -1 、ZnSO 4 7H 2 O 0.2g·L -1 、MnSO 4 ·5H 2 O 1.0g·L -1 、NaMoO 4 ·2H 2 O 0.2g·L -1、CuCl·H 2 O 0.1g·L -1 、FeSO 4 7H 2 O 4.0g·L -1 、AlCl 3 6H 2 O0.1g·L -1 , CaCl 2 4.0g·L -1 , pH 7.2.

[0030] Embodiment 1:

[0031] Construction of integration expression plasmid T2-fxpK:

[0032] The gene sequence of phosphoketolase was cloned from Bifidobacterium adolescentis ATCC 15703 using fxpK-F and fxpK-R as primers. The amplified sequence is shown in SEQ ID NO.1, encoding the wild-type phosphoketolase shown in SEQ ID NO.2 (Accession No.NC_008618).

[0033] Using the genome of Bacillus subtilis 168 as a template, P43-F and P43-R were used as primers to amplify the P43 promoter; TamyL-F and TamyL-R were used as primers to amplify the amylase terminator TamyL. Using P43-F and TamyL-R as primers, the three fragments of P43, fxpK, and TamyL were subjected to SOE-PCR to obtain the fxpK expression element P43-fxpK-TamyL. Using the genome of Bacillus licheniformis DW2 as a template, lanp-AF / AR and lanp-BF / BR were used as primers to amplify the upstream homology arm and downstream homology arm of lanp. Using lanp-AF and lanp-BR, the upstream homology arm, P43-fxpK-TamyL and the downstream homology arm were subjected to SOE-PCR to obtain the target gene fragment. Using plasmid T2(2)-ori as a template, T2-T5-F and T2-T5-R were used as primers to amplify the linear vector backbone. After the above amplification products were tested by electrophoresis, the PCR products were purified and recovered using a gel recovery kit. The fusion fragment was fused with the linearized vector using the ClonExpress II one-step cloning kit to obtain the recombinant plasmid T2-fxpK. The recombinant plasmid T2-fxpK was transformed into competent E.coli DH5α, and positive colonies were screened using LB plates containing kanamycin. After overnight culture at 37°C in a shaking incubator, plasmid T2-fxpK was extracted and sequenced for verification.

[0034] The sequences of the primers are:

[0035] T2-T5-F: GAGCTCGTAGAAAAGATCAAAGG

[0036] T2-T5-R: TCTAGAACTAGTGGATCCCCC

[0037] lanp-AF: GATCTTTTCTACGAGCTCGATTGTCCTTGGCTATGC

[0038] lanp-AR: AAAACATACCACCTATCAACTGTCATTAGCGGAAGC

[0039] P43-F: GCTTCCGCTAATGACAGTTGATAGGTGGTATGTTTT

[0040] P43-R: AATCACCGGGCTTGTCATTTTATATTTTACATAATC

[0041] fxpK-F: GATTATGTAAAATATAAAATGACAAGCCCGGTGATT

[0042] fxpK-R: AATCCGTCCTCTCTGCTCTTTCATTCATTATCTCCGGCTGT

[0043] TamyL-F: ACAGCCGGAGATAATGAATGAAAGAGCAGAGAGGACGGATT

[0044] TamyL-R: TTGACCTCTTAGCGGAGCCGCAATAATGCCGTCGCA

[0045] lanp-BF: TGCGACGGCATTATTGCGGCTCCGCTAAGAGGTCAA

[0046] lanp-BR: GGATCCACTAGTTCTAGAAGCACCATTCAAACCCTT

[0047] Example 2:

[0048] Preparation and enzyme activity determination of wild-type phosphoketolase integrated expression strain DW2::fxpK:

[0049] The obtained integrated expression plasmid T2-fxpK was transferred into Bacillus licheniformis DW2, and kanamycin resistance was used as a screening marker to screen positive transformants, which were then verified by colony PCR. After the verified correct transformants were subcultured several times at 45°C with kanamycin, colony PCR was used to detect the positive single exchange conjugate strains that produced single exchange between the upstream / downstream homology arms of the expression element P43-fxpK-TamyL and the genomic DNA of Bacillus licheniformis DW2. After the correct single exchange strains were inoculated and subcultured several times in a medium without kanamycin at 37°C, colony PCR detection and sequencing verification were performed to screen the recombinant Bacillus licheniformis DW2::fxpK that integrated the fxpK gene.

[0050] The strain DW2::fxpK was inoculated into 50mL LB medium, cultured at 37°C for 12h; then transferred to TB medium at 3% inoculation, cultured at 37°C for 24h, centrifuged to collect the bacteria, washed twice with PBS, and then resuspended with 50mM phosphate buffer (pH 6.8). The cells were disrupted by ultrasonic disruptor, and the supernatant was collected by centrifugation at 4°C, which was the crude enzyme solution. Take 22.5μL crude enzyme solution, 90mM substrate F6P, 50mM potassium dihydrogen phosphate buffer, make up to 75μL with water, react at 37°C for 30 minutes, and then add 75μL hydroxylamine hydrochloride (2M, pH 6.5) to terminate the reaction; then add 50μL trichloroacetic acid, hydrochloric acid and ferric chloride to the reaction system respectively, take the supernatant after centrifugation, and measure the absorbance at 505nm with an enzyme marker.

[0051] Enzyme activity definition: The amount of enzyme required to convert the substrate F6P to produce 1 μmol AcP per minute is defined as one activity unit (U). The results of enzyme activity determination showed that the crude enzyme activity of wild-type phosphoketolase PKT was 0.71 U / mL.

[0052] Embodiment 3:

[0053] Phosphoketolase mutant strain DW2::fxpK H480K Preparation and enzyme activity determination:

[0054] Using the site-directed mutagenesis strategy, we designed point mutation primers based on the amino acid site to be mutated, and designed the mutation site H480K into the primer fxpK H480K -AR and fxpK H480K -BF. Using the genome of Bacillus licheniformis DW2::fxpK as a template, fxpK H480K -AF / AR and fxpK H480K -BF / BR are primers for amplification to obtain upstream homology arms and downstream homology arms. H480K -AF and fxpK H480K-BR The upstream homology arm and the downstream homology arm were subjected to SOE-PCR to obtain a fusion fragment. Plasmid T2(2)-ori was used as a template and T2-H480K-F and T2-H480K-R were used as primers to amplify the linear vector backbone. Subsequently, according to the methods of Examples 1 and 2, the phosphoketolase mutant strain DW2::fxpK H480K .

[0055] The strain DW2::fxpK H480K The cells were inoculated into 50 mL LB medium and cultured at 37°C for 12 h. Then, the cells were transferred to TB medium at a 3% inoculum and cultured at 37°C for 24 h. The crude enzyme activity of the phosphoketolase of the recombinant strain was detected according to the method in Example 2.

[0056] The experimental results show that compared with DW2::fxpK, DW2::fxpK H480K The enzyme activity was 1.93U / mL, which was 2.7 times that of DW2::fxpK.

[0057] The sequences of the primers are:

[0058] T2-T5-F:GAGCTCGTAGAAAAGATCAAAGG

[0059] T2-T5-R:TCTAGAACTAGTGGATCCCCC

[0060] f H480K -AF:GATCTTTTCTACGAGCTCCGCACACCGAAAGGCTGGA

[0061] f H480K -AR:TCCTTCCATCTGTTTTTCGCTCAACTGTTCCGTG

[0062] f H480K -BF:GAAAAACAGATGGAAGGATTTCTG

[0063] f H480K -BR:GGATCCACTAGTTCTAGAGCCATCGCGTCCAGTTT.

[0064] Example 4: Test of the performance of recombinant strains producing bacitracin

[0065] The recombinant strains DW2::fxpK and DW2::fxpK obtained in Examples 2 and 3 were H480KThe strain DW2 and the control strain were inoculated into 50 mL LB medium and cultured at 37°C for 12 h; the inoculation amount was transferred to 20 mL bacitracin fermentation medium at 5% and cultured at 37°C for 48 h; the bacitracin production was detected by high performance liquid chromatography.

[0066] Bacitracin production detection method: 2mL fermentation broth was centrifuged at 12000rpm for 10 minutes, 400μL fermentation supernatant was taken, added to 1.6mL 50% anhydrous ethanol, mixed, centrifuged at 12000rpm for 10 minutes, 500μL supernatant was filtered through a 0.22μm pore size filter membrane, and placed in a liquid phase bottle for testing. Liquid chromatography column model: Agilent Eclipse Plus C18 (4.6m×250mm, 5μm); mobile phase: mobile phase A (100mL phosphate buffer mixed with 300mL distilled water): mobile phase B (520mL methanol mixed with 40mL acetonitrile) = 35:65; detection conditions: column temperature 30℃, UV detector wavelength 254nm, flow rate 1.0mL / min, injection volume 20μL, single sample detection time 15min.

[0067] The results of liquid phase detection showed that DW2::fxpK H480K The bacitracin production of DW2::fxpK was 839.85 U / mL, which was 7.18% and 18.82% higher than that of DW2::fxpK and DW2, respectively.

[0068] Example 5: Testing of the performance of recombinant strains in producing ectoine

[0069] The free expression plasmid pHY-P carrying the ectoine synthase EctABC expression cassette bacA -ectABC He (Li Xujie, Metabolic Engineering Breeding of Bacillus licheniformis DW2 for Synthesis of Ectohydropyrimidine. Hubei University, 2024) were transformed into DW2, DW2::fxpK and DW2::fxpK H480K The recombinant strain DW2 / pHY-P was obtained. bacA -ectABC He 、DW2::fxpK / pHY-P bacA -ectABC He and DW2::fxpK H480K / pHY-P bacA -ectABC He The above strains were inoculated into 50 mL LB medium and cultured at 37°C for 12 h; 3% inoculation amount was transferred into 30 mL ectoine fermentation medium and cultured at 37°C for 60 h; the ectoine yield was detected by high performance liquid chromatography.

[0070] Tetrahydropyrimidine production detection method: 2mL fermentation broth was centrifuged at 12000rpm for 10 minutes, 500μL supernatant was filtered through a 0.22μm pore size filter membrane, and placed in a liquid phase bottle for testing. Liquid chromatography column model: Agilent Eclipse PlusC18 (4.6m×250mm, 5μm); mobile phase was 2% acetonitrile; detection conditions: column temperature 30℃, UV detector wavelength 210nm, flow rate 1.0mL / min, injection volume 10μL, single sample detection time 15min.

[0071] The results of liquid phase detection showed that DW2::fxpK H480K / pHY-P bacA -ectABC He The ectoine production of DW2::fxpK / pHY-P was 240.62 mg / L, which was comparable to that of DW2::fxpK / pHY-P bacA -ectABC He and DW2 / pHY-P bacA -ectABC He Compared with the previous results, the difference was 21.01% and 53.87% respectively.

[0072] Example 6: Performance test of recombinant strain producing γ-aminobutyric acid

[0073] The free expression plasmid pHY-P carrying the glutamate decarboxylase expression element 43 -gadB Ec (Wang et al., Int. J. Biol. Macromol., 2023, 233:123468) were transformed into DW2, DW2::fxpK and DW2::fxpK H480K The recombinant strain DW2 / pHY-P was obtained. 43 -gadB Ec 、DW2::fxpK / pHY-P 43 -gadB Ec and DW2::fxpK H480K / pHY-P 43 -gadB Ec The above strains were inoculated into 50 mL LB medium and cultured at 37°C for 12 h; 3% inoculation amount was transferred into 20 mL γ-aminobutyric acid fermentation medium and cultured at 37°C for 60 h; the yield was detected by high performance liquid chromatography.

[0074] γ-aminobutyric acid production detection method: Take 100 μL of supernatant and add 200 μL of 1M Na 2 CO 3 -NaHCO 3Buffer, 100 μL of 80 g / L dansyl chloride-acetonitrile solution and 600 μL of distilled water were mixed and derivatized at 80 °C for 40 minutes in the dark, followed by the addition of 100 μL of 10% acetic acid to stop the reaction. Finally, centrifuge at 12000 rpm for 5 minutes, take 500 μL of supernatant and filter it through a 0.22 μm pore size filter membrane, and place it in a liquid phase bottle for testing. The chromatographic separation column is Agilent Zorbax Eclipse Plus C18 (250 mm × 4.6 mm, 5 μm); detection conditions: UV detector wavelength 254 nm, column temperature 30 °C, injection volume 20 μL, flow rate 1 mL / min; mobile phase: mobile phase A is tetrahydrofuran: methanol: 50 mM sodium acetate = 5: 75: 420, mobile phase B is 100% methanol, and the mobile phase gradient setting is shown in the following table.

[0075] The results of liquid phase detection showed that the recombinant strain DW2::fxpK H480K / pHY-P 43 -gadB Ec The γ-aminobutyric acid production of DW2::fxpK / pHY-P was 1.42 g / L, which was similar to that of DW2::fxpK / pHY-P 43 -gadB Ec and DW2 / pHY-P 43 -gadB Ec Compared with the previous results, the difference was 23.48% and 61.36% respectively.

[0076]

Claims

1. A phosphoketolase mutant protein H480K, the amino acid sequence of which is shown in SEQ ID NO.

4.

2. A fusion protein obtained by fusing the mutant protein according to claim 1 with a protein tag.

3. A gene encoding the mutant protein according to claim 1 or the fusion protein according to claim 2.

4. An expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the coding gene according to claim 3.

5. Use of the mutant protein according to claim 1, the fusion protein according to claim 2, the encoding gene according to claim 3, the expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell according to claim 4 in preparing metabolites.

6. A method for improving the activity of phosphoketolase, comprising the following steps: mutating the phosphoketolase as follows: mutating the histidine H at position 480 of SEQ ID NO.4 to lysine K.

7. A method for preparing metabolites, comprising the following steps: preparing metabolites by culturing the recombinant microorganism according to claim 5.

8. The use according to claim 5, the method according to claim 6 or 7, wherein the metabolite is: bacitracin and / or an amino acid derivative derived from acetyl-CoA.

9. The use according to claim 8, wherein the amino acid derivative derived from acetyl-CoA is ectoine and / or γ-aminobutyric acid.

10. The use according to claim 5, wherein the recombinant microorganism is recombinant Bacillus licheniformis.

Images