Mouse hippocampal neuron cell strain for overexpressing APPswe695 as well as construction method and application of mouse hippocampal neuron cell strain

Abstract

The invention belongs to the technical field of stably transfected cell strains, and particularly relates to an APPswe695-overexpressed mouse hippocampal neuron cell strain as well as a construction method and application thereof, the mouse hippocampal neuron cell strain HT22-APPswe695 is preserved in the China Center for Type Culture Collection, the preservation number is CCTCC No: C2024239, and the preservation number is CGMCC No: C2024239. The construction method of the cell strain disclosed by the invention comprises the following steps: constructing plasmids of the overexpressed APPswe695 gene and transfecting the plasmids of the overexpressed APPswe695 gene; the method comprises the following steps of: harvesting, concentrating and purifying lentivirus, and screening by using puromycin after lentivirus infection to obtain a cell strain HT22-APPswe695 overexpressing the APPswe695 gene; the HT22-APPswe695 stably transfected cell strain constructed in the invention has Alzheimer's disease cell level molecular expression characteristics and strong cell viability, and can be used as a tool for in-depth research on the molecular mechanism of Alzheimer's disease and intervention research.

Description

Technical Field

[0001] This invention belongs to the field of stable cell line technology, specifically relating to a mouse hippocampal neuron cell line overexpressing APPswe695, its construction method, and its application. Background Art

[0002] Alzheimer's disease (AD) cell models allow for the study of AD pathogenesis at the microscopic level. The human neuroblastoma cell line SH-SY5Y and the mouse hippocampal neuronal cell line HT22 exhibit neuronal-like growth characteristics in vitro and possess pluripotency in neuronal enzyme expression. Genetic engineering techniques can be used to construct AD cell models and, to some extent, improve the accuracy of cellular pathological expression. Furthermore, HT22 cells, due to their high transfection efficiency and stability, are particularly suitable for long-term pathological studies and complex genetic engineering operations. This stability is especially crucial when constructing AD models, effectively supporting research on amyloid precursor protein (APP) and its mutant forms. The Swedish mutation of amyloid precursor protein (APPswe) is one of the earliest gene mutations discovered to be associated with familial Alzheimer's disease (AD). In APPswe695, lysine at position 595 and methionine at position 596 are mutated to aspartic acid and leucine, respectively (KM595 / 596NL). This enhances the cleavage of β-secretase at the amyloid precursor protein (APP) hydrolysis site, leading to increased levels of amyloid β-protein (Aβ). Constructing cell lines expressing the APP mutant that secrete high levels of Aβ is expected to be applied to research on the pathogenesis of AD and drug screening. Summary of the Invention

[0003] To address the aforementioned issues, this invention discloses a mouse hippocampal neuronal cell line overexpressing APPswe695, its construction method, and its applications.

[0004] The technical solutions of the present invention are as follows:

[0005] A mouse hippocampal neuron cell line overexpressing APPswe695, characterized in that the mouse hippocampal neuron cell line is deposited at the China Center for Type Culture Collection, with accession number CCTCC No: C2024239.

[0006] Furthermore, the aforementioned mouse hippocampal neuron cell line overexpressing APPswe695, which is constructed from HT22 cells, is capable of withstanding further plasmid transfection and exhibits high activity.

[0007] Furthermore, the aforementioned mouse hippocampal neuron cell line overexpressing APPswe695, wherein APPswe695 is derived from a mutation in a human Alzheimer's disease family, with NCBI accession number NM_201414(K595N,M596L).

[0008] This invention discloses a method for constructing a mouse hippocampal neuron cell line overexpressing APPswe695, the method comprising:

[0009] (1) Using GV513 as a vector, a plasmid overexpressing the APPswe695 gene was constructed;

[0010] (2) The constructed overexpression plasmid GV513-APPswe695 was amplified;

[0011] (3) Transfect the plasmid obtained in step (2) using pHelper 2.0 and harvest, concentrate and purify the lentivirus;

[0012] (4) After infecting HT22 cells with HitransGA infection solution, the cell line HT22-APPswe695, which overexpresses the APPswe695 gene, was obtained by screening with puromycin. This is the mouse hippocampal neuron cell line that overexpresses APPswe695.

[0013] Furthermore, in the above-mentioned method for constructing a mouse hippocampal neuron cell line overexpressing APPswe695, the primers used in step (1) for constructing the plasmid overexpressing the APPswe695 gene include:

[0014] APP(83741-1)-p1:

[0015] AGGTCGACTCTAGAGGATCCCGCCACCATGCTGCCCGGTTTGGCACTG;

[0016] APP(83741-1)-p2:

[0017] ACCGTAAGTTATGTGCTAGCCTAGTTCTGCATCTGCTCAAAGAACTTG TAGG.

[0018] This invention also discloses the application of mouse hippocampal neurons overexpressing APPswe695 in the preparation of a mouse-derived Alzheimer's disease cell model with strong cell viability.

[0019] The present invention also discloses a murine Alzheimer's disease cell model with strong cell viability, including mouse hippocampal neurons overexpressing APPswe695 as described above.

[0020] The present invention also discloses the application of the above-mentioned Alzheimer's disease cell model in the preparation of drugs for treating / alleviating Alzheimer's disease.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] This invention discloses a mouse hippocampal neuron cell line overexpressing APPswe695, its construction method, and its application. The cell line possesses the molecular expression characteristics at the Alzheimer's disease cell level and has strong cellular activity, and can be used as a tool for in-depth research on the molecular mechanisms of Alzheimer's disease and intervention studies.

[0023] The preservation information for the strain is as follows:

[0024] Name of depositary institution: China Center for Type Culture Collection;

[0025] Address of the depository: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province;

[0026] Deposit date: July 23, 2024

[0027] Accession number: CCTCC No: C2024239

[0028] Taxonomic nomenclature: Mouse hippocampal neuron (Mus musculus) HT22-APPswe695 Attached Figure Description

[0029] Figure 1 This is a schematic diagram of the patent.

[0030] Figure 2 The plasmid map of the original vector GV513;

[0031] Figure 3 HT22 cells were transfected with APPswe695 lentivirus. (A) Image of HT22 cells under a phase contrast microscope (200×), (B) Image of cells transfected with APPswe695 lentivirus under a fluorescence inverted microscope (200×).

[0032] Figure 4The results of screening HT22 cells with different concentrations of puromycin are shown in (A) screening results of HT22 cells with a concentration of 2.5 μg / mL puromycin, (B) screening results of HT22 cells with a concentration of 3.0 μg / mL puromycin, and (C) screening results of HT22 cells with a concentration of 3.5 μg / mL puromycin, n = 6.

[0033] Figure 5 The qPCR amplification cycle number for the APPswe695 gene in each group is represented by Con: blank control group, NC: empty plasmid transfection control group, and APP: APPswe lentivirus positive group. n = 6, Mean ± SEM;

[0034] Figure 6 To investigate the effects of APPswe695 gene transfection on the viability and cytotoxicity of HT22 cells, (A) CCK8 assay was used to detect cell viability in each group, and (B) LDH assay was used to detect cytotoxicity in each group. Compared with the Con group, *p<0.05, ****p<0.0001; compared with the NC group, #####p<0.0001; n=6, Mean±SEM. Con: blank control group, NC: empty plasmid transfection control group, APP: APPswe lentivirus positive group;

[0035] Figure 7 The effect of the APPswe695 gene on the transcription level of bdnf in HT22 cells was investigated. Compared with the Con group, *p<0.05, ****p<0.0001; compared with the NC group, #####p<0.0001; n=6, Mean±SEM. Con: blank control group, NC: empty plasmid transfection control group, APP: APPswe lentivirus positive group;

[0036] Figure 8 The ELISA results for Aβ42 content in HT22-APPswe cells showed that compared with the Con group, p < 0.0001; compared with the NC group, p < 0.001; n = 3, Mean ± SEM. Con: blank control group, NC: empty plasmid transfection control group, APP: APPswe lentivirus positive group;

[0037] Figure 9 Western blot results of HT22-APPswe cell AD cell model indicators: (A) WB band and expression level analysis of PSD95 in each group of cells; (B) WB band and expression level analysis of CDK5 in each group of cells; (C) WB band and expression level analysis of GSK3β in each group of cells. Compared with the Con group, ** p<0.01, *** p<0.001; compared with the NC group, #p<0.05, ### p

[0038] <0.001; n=6, Mean±SEM. Con: blank control group, NC: empty plasmid transfection control group, APP: APPswe lentivirus positive group. Detailed Implementation

[0039] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0040] I. Reagents and Instruments

[0041] 1.1 Main reagents and consumables

[0042] Table 1 Main Reagents and Consumables

[0043]

[0044]

[0045] 1.2 Main Experimental Instruments

[0046] Table 2 Main Experimental Instruments

[0047]

[0048] II. Experimental Methods

[0049] 1. APPswe695 lentivirus construction

[0050] (1) APPswe695, gene sequence: NM_201414(K595N,M596L). The construction and synthesis of the lentivirus used in the experiment were entrusted to Shanghai Jikai Gene Medical Technology Co., Ltd., and overexpressing lentivirus vector solution and negative control virus solution were obtained.

[0051] (2) Carrier information

[0052] Original vector name: GV513

[0053] Component sequence: Ubi-MCS-CBh-gcGFP-IRES-puromycin

[0054] Cloning site: BamHI / NheI

[0055] Plasmid map: Vector map:

[0056] http: / / www.genechem.com.cn / index / supports / tool_search.html?keywords=GV513 Figure 2 As shown.

[0057] (3) The primers used to construct the vector overexpressing the APPswe695 gene include:

[0058] SEQ ID No.1=APP(83741-1)-p1:

[0059] AGGTCGACTCTAGAGGATCCCGCCACCATGCTGCCCGGTTTGGCACTG; SEQ ID No.2=APP(83741-1)-p2:

[0060] ACCGTAAGTTATGTGCTAGCCTAGTTCTGCATCTGCTCAAAGAACTTG TAGG.

[0061] (4) APPswe695 gene sequence

[0062] The synthesized APPswe695 gene sequence is shown in SEQ ID No. 3.

[0063] TGGCCGTTTTTGGCTTTTTTGTTAGACGAAGCTTGGGCTGCAGGTCGACT

[0064] CTAGA GGATCC CGCCACCATGCTGCCCGGTTTGGCACTGCTCCTGCTGG

[0065] CCGCCTGGACGGCTCGGGCGCTGGAGGTACCCACTGATGGTAATGCTG

[0066] GCCTGCTGGCTGAACCCCAGATTGCCATGTTCTGTGGCAGACTGAACAT

[0067] GCACATGAATGTCCAGAATGGGAAGTGGGATTCAGATCCATCAGGGAC

[0068] CAAAACCTGCATTGATACCAAGGAAGGCATCCTGCAGTATTGCCAAGA

[0069] AGTCTACCCTGAACTGCAGATCACCAATGTGGTAGAAGCCAACCAACC

[0070] AGTGACCATCCAGAACTGGTGCAAGCGGGGCCGCAAGCAGTGCAAGAC

[0071] CCATCCCCACTTTGTGATTCCCTACCGCTGCTTAGTTGGTGAGTTTGTAA

[0072] GTGATGCCCTTCTCGTTCCTGACAAGTGCAAATTCTTACACCAGGAGAG

[0073] GATGGATGTTTGCGAAACTCATCTTCACTGGCACACCGTCGCCAAAGAG

[0074] ACATGCAGTGAGAAGAGTACCAACTTGCATGACTACGGCATGTTGCTGC

[0075] CCTGCGGAATTGACAAGTTCCGAGGGGTAGAGTTTGTGTGTTGCCCACT

[0076] GGCTGAAGAAAGTGACAATGTGGATTCTGCTGATGCGGAGGAGGATGA

[0077] CTCGGATGTCTGGTGGGGCGGAGCAGACACAGACTATGCAGATGGGAG

[0078] TGAAGACAAAGTAGTAGAAGTAGCAGAGGAGGAAGAAGTGGCTGAGG

[0079] TGGAAGAAGAAGAAGCCGATGATGACGAGGACGATGAGGATGGTGAT

[0080] GAGGTAGAGGAAGAGGCTGAGGAACCCTACGAAGAAGCCACAGAGAG

[0081] AACCACCAGCATTGCCACCACCACCACCACCACCACAGAGTCTGTGGA

[0082] AGAGGTGGTTCGAGTTCCTACAACAGCAGCCAGTACCCCTGATGCCGTT

[0083] GACAAGTATCTCGAGACACCTGGGGATGAGAATGAACATGCCCATTTC

[0084] CAGAAAGCCAAAGAGAGGCTTGAGGCCAAGCACCGAGAGAGAATGTC

[0085] CCAGGTCATGAGAGAATGGGAAGAGGCAGAACGTCAAGCAAAGAACTT

[0086] GCCTAAAGCTGATAAGAAGGCAGTTATCCAGCATTTCCAGGAGAAAGT

[0087] GGAATCTTTGGAACAGGAAGCAGCCAACGAGAGACAGCAGCTGGTGGA

[0088] GACACACATGGCCAGAGTGGAAGCCATGCTCAATGACCGCCGCCGCCT

[0089] GGCCCTGGAGAACTACATCACCGCTCTGCAGGCTGTTCCTCCTCGGCCT

[0090] CGTCACGTGTTCAATATGCTAAAGAAGTATGTCCGCGCAGAACAGAAG

[0091] GACAGACAGCACACCCTAAAGCATTTCGAGCATGTGCGCATGGTGGAT

[0092] CCCAAGAAAGCCGCTCAGATCCGGTCCCAGGTTATGACACACCTCCGTG

[0093] TGATTTATGAGCGCATGAATCAGTCTCTCTCCCTGCTCTACAACGTGCCT

[0094] GCAGTGGCCGAGGAGATTCAGGATGAAGTTGATGAGCTGCTTCAGAAA

[0095] GAGCAAAACTATTCAGATGACGTCTTGGCCAACATGATTAGTGAACCA

[0096] AGGATCAGTTACGGAAACGATGCTCTCATGCCATCTTTGACCGAAACGA

[0097] AAACCACCGTGGAGCTCCTTCCCGTGAATGGAGAGTTCAGCCTGGACG

[0098] ATCTCCAGCCGTGGCATTCTTTTGGGGCTGACTCTGTGCCAGCCAACAC

[0099] AGAAAACGAAGTTGAGCCTGTTGATGCCCGCCCTGCTGCCGACCGAGG

[0100] ACTGACCACTCGACCAGGTTCTGGGTTGACAAATATCAAGACGGAGGA

[0101] GATCTCTGAAGTGAATCTGGATGCAGAATTCCGACATGACTCAGGATAT

[0102] GAAGTTCATCATCAAAAATTGGTGTTCTTTGCAGAAGATGTGGGTTCAA

[0103] ACAAAGGTGCAATCATTGGACTCATGGTGGGCGGTGTTGTCATAGCGAC

[0104] AGTGATCGTCATCACCTTGGTGATGCTGAAGAAGAAACAGTACACATCC

[0105] ATTCATCATGGTGTGGTGGAGGTTGACGCCGCTGTCACCCCAGAGGAGC

[0106] GCCACCTGTCCAAGATGCAGCAGAACGGCTACGAAAATCCAACCTACA

[0107] AGTTCTTTGAGCAGATGCAGAACTAG GCTAGC ACATAACTTACGGTAAA

[0108] TGGCCCGCCTGG。

[0109] Using the vector GV513, primers, and gene APPswe695 described above, an overexpression plasmid GV513-APPswe695 was constructed.

[0110] (5) The constructed overexpression plasmid GV513-APPswe695 was amplified;

[0111] (6) Transfect the plasmid obtained in step (5) using pHelper 2.0 and harvest, concentrate and purify the lentivirus.

[0112] 2. Grouping and treatment of mouse hippocampal neuron cell lines.

[0113] 2.1.1 Cell grouping

[0114] Mouse hippocampal neurons HT22, passaged to the third generation, were divided into three groups: blank control (Con), empty plasmid transfection control (NC), and APPswe lentivirus positive (APP). The NC group was transfected with the negative control lentivirus, the APP group was transfected with APPswe695 lentivirus, and the Con group was added with an equal volume of complete culture medium.

[0115] 2.1.2 Lentiviral transfection

[0116] Discard the original culture medium in the HT22 cell culture dish, add 1 mL of trypsin-EDTA digestion solution (0.25%) to the dish, collect and resuspend the cells, and adjust the cell suspension density to 3 × 10⁻⁶ using a Bio-Rad TC20 automated cell counter. 4 Cells / mL. The adjusted cell suspension was seeded into 6-well plates, with 2 mL of cell suspension added to each well, followed by incubation with 1× HitransGA infection medium at a final concentration. After incubation at 37°C and 5% CO2 for 16–24 hours, the complete culture medium in each well was removed, and the cells were gently rinsed with PBS. This process was repeated twice, and 1 mL of complete culture medium was added to each well. Following an MOI of 50, the appropriate amount of virus was added to each well using the formula: Virus volume = (MOI × cell number) / virus titer. After incubation at 37°C and 5% CO2 for 16 hours, the original culture medium was removed, replaced with fresh complete culture medium, and the cells were cultured for another 72 hours. The infection efficiency was observed for subsequent experiments. Successfully transfected HT22 cells were named HT22-APPswe cells.

[0117] 2.1.3 Screening for stable lentiviral transfection strains using puromycin

[0118] (1) Wild-type HT22 cells were seeded into 24-well plates 24 hours in advance. The seeding density was about 70% after 24 hours. After the cells grew for 24 hours, different final concentrations of puromycin were added in sequence at 0 μg / mL, 0.5 μg / mL, 1 μg / mL, 1.5 μg / mL, 2 μg / mL, 2.5 μg / mL, 3 μg / mL, 3.5 μg / mL, 4 μg / mL, 4.5 μg / mL, 5 μg / mL, 5.5 μg / mL, 6 μg / mL, 6.5 μg / mL, 7 μg / mL, 7.5 μg / mL, 8 μg / mL, 8.5 μg / mL, 9 μg / mL, 9.5 μg / mL and 10 μg / mL.

[0119] (2) The 24-well plates were cultured for another 48 hours in a 37°C, 5% CO2 cell culture incubator. Microscopic observation revealed that all cells died when the final concentration of puromycin was as low as 3.0 μg / mL. After determining the working concentration of puromycin, lentivirus-transfected cells were cultured in a culture medium containing that concentration of puromycin. After 48 hours of screening, all untransfected lentivirus cells died, and the remaining cells were lentivirus-positive stable strains.

[0120] 2.2 qPCR

[0121] 2.2.1 Total RNA Extraction

[0122] (1) Discard the culture medium in the 100mm cell culture dish, rinse the cells twice with PBS, add 1mL of trypsin-EDTA digestion solution (0.25%), digest and collect the cell pellet;

[0123] (2) Add 700 μL of TRK lysis buffer to each cell pellet, vortex or use a micropipette to mix thoroughly.

[0124] (3) Insert the RNA homogenizer column into a 2mL collection tube, then transfer the fully lysed cell lysate into the RNA homogenizer column, centrifuge at 16000g for 2min, and collect the homogenized lysate.

[0125] (4) Add an equal volume of 70% ethanol to the collected lysate and vortex to mix thoroughly;

[0126] (5) Transfer the sample to an RNA mini centrifuge column, centrifuge at 10000g for 1 min, and discard the filtrate;

[0127] (6) Add 500 μL of RNA washing buffer I to the RNA mini centrifuge column, centrifuge at 10000g for 30 seconds, and discard the filtrate;

[0128] (7) Add 500 μL of RNA washing buffer II to the RNA mini centrifuge column, centrifuge at 10000g for 1 min, discard the filtrate, and repeat this step to perform a second RNA washing with RNA washing buffer II.

[0129] (8) Centrifuge at 16000g for 2 min, then transfer the RNA mini centrifuge column to a new sterile enzyme-free 1.5 mL EP tube, add 50 μL of sterile enzyme-free water, centrifuge at 16000g for 2 min, and store the eluted RNA at -70℃.

[0130] 2.2.2 RNA Reverse Transcription

[0131] The RNA concentration of each group of samples was detected using NanoDrop, and the RNA concentration of each group of samples was uniformly set to 500 ng / μL. The reverse transcription reaction system was prepared on ice according to the kit instructions, as shown in Table 3 below:

[0132] Table 3 RNA reverse transcription reaction system

[0133]

[0134] Place the prepared reverse transcription reaction system into the PCR instrument and set the program: 37℃ for 15 min, 85℃ for 5 sec to reverse transcribe the sample into cDNA.

[0135] 2.2.3 Real-time PCR detection

[0136] (1) Primer sequence

[0137] Table 4 Primer sequences

[0138]

[0139] (2) The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. According to the primer synthesis report, sterile enzyme-free water was added to the primer dry powder to prepare a 10μM working solution.

[0140] (3) Prepare the PCR reaction system on ice in the dark. The amplification system consisted of: 12.5 μL of TB Green Premix Ex Tap II (2×), 1 μL of upper primer, 1 μL of lower primer, 8.5 μL of sterile water, and 2 μL of cDNA. Reaction conditions: 95℃ pre-denaturation for 30 sec, followed by 94℃ denaturation for 5 sec and 58℃ annealing for 30 sec, with a cycle index of 40.

[0141] (4) Using GAPDH as an internal reference, use 2 -ΔΔCt Calculate the relative expression level of the target gene in each group of samples compared to the control group.

[0142] 2.3 Cell counting kit-8 (CCK8) was used to determine cell viability.

[0143] (1) Collect cells from each group by digestion with trypsin. In a 96-well plate, seed 3000 cells into each sample well and add 100 μL of complete culture medium to each well. Add the same amount of complete culture medium to the blank wells and incubate at 37°C for 24 hours.

[0144] (2) Add 10 μL of CCK-8 solution to each well, gently shake the 96-well plate to mix the liquid in the wells;

[0145] (3) Incubate the 96-well plate in a 37°C incubator for 1–4 hours;

[0146] (4) Measure the OD value of each group at a wavelength of 450 nm using an ELISA reader, and calculate the cell viability of each group according to the formula:

[0147] Cell viability (%) = [(Test wells - Blank wells) / (Control wells - Blank wells)] * 100%

[0148] 2.4 Lactate dehydrogenase (LDH) method for detecting cytotoxicity

[0149] (1) HT22 cell suspension (100 μL / well) was seeded in 96-well plates, with 3000 cells seeded in each well. The culture plates were pre-cultured in a 37°C cell culture incubator for 24 hours. The group settings are shown in Table 5 below.

[0150] Table 5 Group Settings

[0151]

[0152] (2) Add 10 μL of lysis buffer to the high control and high control blank wells, and add 10 μL of culture medium to the low control wells. Incubate in a cell culture incubator at 37°C for 30 min.

[0153] (3) Remove 50 μL of culture medium supernatant from each well, add 50 μL of working solution to each well, shake to mix, and incubate at room temperature in the dark for 30 min;

[0154] (4) After adding 50 μL of stop solution to each well, measure the OD value of each well at 490 nm using a microplate reader within 30 min, and calculate the cytotoxicity of each group according to the formula:

[0155] Cytotoxicity (%) = [(Sample wells - Low control wells) / (High control wells - High control blank wells - Low control wells + Blank background wells)] * 100%

[0156] 2.5 Western blot

[0157] 2.5.1 Extraction of proteins from mouse hippocampal neurons

[0158] (1) When HT22 cells reach 90% confluence, discard the culture medium, rinse twice with PBS, and collect the cells into sterile centrifuge tubes using a cell scraper.

[0159] (2) Prepare lysis buffer: Add 10 μL of phosphatase inhibitor, 1 μL of protease inhibitor and 5 μL of 100 mM PMSF to each 1 mL of cold Lysis Buffer and mix well;

[0160] (3) Add 200 μL of lysis buffer to the collected cells, mix vigorously with a vortex mixer for 30 seconds, and then let stand on ice for 4 minutes. Repeat 5 times.

[0161] (4) Centrifuge at 12000g for 5 minutes at 4℃, transfer the supernatant to a sterile 1.5mL EP tube, dispense, and store at -70℃.

[0162] 2.5.2 BCA protein concentration measurement

[0163] (1) According to the instructions, add standard protein solutions of different concentrations to the 96-well plate in sequence to plot the standard protein concentration curve;

[0164] (2) Add 19 μL of deionized water and 1 μL of sample protein solution to each of the remaining wells;

[0165] (3) Prepare the BCA working solution by mixing reagent A and reagent B in a 50:1 ratio, ensuring thorough mixing. Add 200 μL of the working solution to each well, and then shake at 800 rpm for 1 min on a plate shaker. Subsequently, incubate in a 37°C incubator for 30 min.

[0166] (4) The OD value of each well was measured at a wavelength of 562 nm using an ELISA reader. The protein concentration of the sample was calculated using the standard curve as a reference.

[0167] 2.5.3 Protein Electrophoresis

[0168] (1) Based on the measured protein concentration of the sample, mix the protein loading buffer with the sample at a ratio of 1:4, heat in a metal bath at 95°C for 10 min, and cool before use;

[0169] (2) Prepare 10% Tris-Glycine / SWE SDS-PAGE electrophoresis gel: Prepare the separating gel and stacking gel according to the table below. Use a 1.0 mm thick glass clamp, add the separating gel, and add anhydrous ethanol on top and press for 30 min.

[0170]

[0171] (2) Completely discard the anhydrous ethanol on top of the separating gel, add the stacking gel, insert the comb, let stand for 30 minutes, and set aside for use;

[0172] (3) Fix the prepared gel plate onto the clamp of the electrophoresis tank, pour in the prepared rapid electrophoresis solution, pull out the comb, and add the pre-stained protein marker and the cooked protein sample into the comb well.

[0173] (4) Set the voltage to 200V and the electrophoresis time to 35min.

[0174] 2.5.4 Transfer of film

[0175] (1) Activate the PVDF membrane with anhydrous ethanol in advance. After electrophoresis, remove and open the glass plate, gently lift the electrophoresis gel with a small spatula, cover the gel with the PVDF membrane, remove the air bubbles in each layer, and then clamp the transfer clamp.

[0176] (2) Insert the transfer clamp into the transfer tank, add the prepared transfer solution, place the transfer tank in ice, and transfer at 400mA for 1 hour.

[0177] 2.5.5 Closed

[0178] After the transfer process is complete, remove the PVDF membrane, place it in an incubation box, add 10 mL of protein-free rapid blocking solution, set the shaker to 60 rpm, and block at room temperature for 30 min.

[0179] 2.5.6 Protein immunoblotting imaging

[0180] (1) Take out the sealed PVDF membrane, add primary antibody PSD95 (1:1000), CDK5 (1:2000), GSK3β (1:1000), GAPDH (1:2000), ACTIN (1:2000), and incubate overnight at 4°C;

[0181] (2) Take out the incubation box, warm it at room temperature for 30 min, recover the primary antibody, place the incubation box on a shaker, add TBST to wash the PVDF membrane 3 times, set the shaker to 90 rpm, 10 min each time;

[0182] (3) After washing the membrane, add the fluorescent secondary antibody (1:2000), incubate at room temperature in the dark, and shake at 60 rpm for 2 hours;

[0183] (4) Recover the secondary antibody and wash the membrane three times using a TBST shaker for 10 minutes each time at a speed of 90 rpm.

[0184] (5) Expose the film using Odyssey dual-color infrared fluorescence imaging and read the strip grayscale values ​​using ImageJ software.

[0185] 2.6 Enzyme-linked immunosorbent assay (ELISA)

[0186] First, the culture supernatant of adherent cells was removed, and the cells were gently washed with pre-chilled PBS, followed by trypsin digestion. After centrifugation at 1000g for 5 min, the cells were collected and washed three times with pre-chilled PBS to ensure the removal of impurities. Then, each 1×10⁶ cells… 6 Resuspend the cells in 150 μL of PBS and lyse them by sonication. Then, centrifuge the extract at 1500 g for 10 min at 4 °C and collect the supernatant. For the preparation of the standard gradient working solution, first add 1 mL of universal diluent to the lyophilized standard, let stand for 15 min to allow it to completely dissolve, and then mix well (concentration 1000 pg / mL). Subsequently, dilute according to the preset concentration gradient: 1000 pg / mL, 500 pg / mL, 250 pg / mL, 125 pg / mL, 62.5 pg / mL, 31.2 pg / mL, 15.6 pg / mL, and 0 pg / mL. In the sample loading step, add 100 μL of sample or standard of different concentrations to each well, and add 100 μL of universal diluent to each blank well. Then, seal the plate with a sealing film and incubate at 37 °C for 1 hour. Next, add 100 μL of biotinylated antibody working solution to each well, cover with the sealing film again, and incubate at 37°C for 1 hour. Then, wash the plate, discarding the liquid, add 300 μL of 1× washing buffer to each well, let stand for 1 minute, then discard the washing buffer and pat dry on absorbent paper. Repeat this washing step 3 times. Next, add 100 μL of enzyme conjugate working solution to each well, cover with the sealing film, and incubate at 37°C for 30 minutes. Then, repeat the above steps 5 times. Next, add 90 μL of substrate (TMB) to each well, cover with the sealing film, and incubate at 37°C in the dark for 15 minutes. Finally, remove the ELISA plate, add 50 μL of stop solution directly to each well, and immediately measure the OD value of each well at 450 nm.

[0187] 2.7 Statistical Analysis

[0188] Graphpad 9.0 software was used to create graphs and charts. The data are expressed as mean ± standard error (Mean ± SEM), conforming to a normal distribution and having the same variance. One-way ANOVA was used for analysis, while multiple comparisons between groups were performed using the LSD-t test. For data that did not conform to a normal distribution, the Kruskal-Wallis H test was applied. α = 0.05, p < 0.05 was considered statistically significant.

[0189] Example 1

[0190] Schematic diagram

[0191] like Figure 1 As shown, APPswe695 lentivirus was transfected into HT22 cells, and HT22-APPswe cells were obtained by screening. The content of Aβ, CDK5 and GSK3β in these cells was increased, while the content of PSD95 was decreased.

[0192] Example 2

[0193] Plasmid map of the original vector GV513

[0194] Figure 2 The image shows the mass spectrum of the vector that overexpresses the APPswe695 gene, and the overexpression plasmid GV513-APPswe695 was successfully constructed.

[0195] Example 3

[0196] Transfection results of APPswe695 overexpression lentivirus

[0197] Figure 3 The results of APPswe695 lentivirus transfection into HT22 cells are presented. Fluorescence expression of APPswe695 lentivirus after transfection into HT22 cells was observed using an inverted fluorescence microscope. Strong fluorescence expression was observed within the cells, indicating successful expression of the transfected lentivirus.

[0198] Example 4

[0199] Screening results of puromycin on stable lentiviral transfection strains

[0200] like Figure 4 As shown, some cells still survived under the selection of 2.5 μg / mL puromycin, while no cells survived at concentrations of 3.0 μg / mL and 3.5 μg / mL. Therefore, the working concentration of puromycin was determined to be 3.0 μg / mL.

[0201] Example 5

[0202] Validation of APPswe695 gene expression

[0203] To verify whether the APPswe695 gene could be transcribed in transfected HT22 cells, we used qPCR to measure the mRNA of the APPswe695 gene. Figure 5 As shown, except for the APPswe lentivirus positive group where the APPswe695 gene was successfully amplified, the other two groups did not show APPswe695 gene expression.

[0204] Example 6

[0205] Effects of APPswe695 gene on HT22 cell viability and cell damage

[0206] like Figure 6 As shown, we investigated the potential effects of the APPswe695 gene on cell proliferation and cell damage. Cell viability was assessed using the CCK-8 assay. Results showed that compared to the Con group, cell viability in the NC group was slightly decreased (p<0.05), while cell viability in the APP group was significantly reduced (p<0.05).

[0207] <0.0001); further, compared with the NC group, the cell viability of the APP group also showed a significant decrease (p <0.0001);

[0208] <0.0001). Furthermore, cytotoxicity was assessed using a lactate dehydrogenase (LDH) release assay. The results showed that the APP group exhibited significantly increased cytotoxicity compared to the Con and NC groups (p<0.0001), while there was no significant difference in cytotoxicity between the Con and NC groups (p>0.05). The significant decrease in cell viability and increase in cytotoxicity in the APP group indicate that the APPswe695 gene has a negative impact on cell function.

[0209] Example 7

[0210] Effect of APPswe695 gene on cellular BDNF transcription level

[0211] The effect of the APPswe695 gene on the transcriptional level of bdnf in HT22 cells was detected using qPCR. Figure 7 The results showed that, compared with the Con group, the transcriptional level of bdnf in the NC group was slightly increased (p<0.05), while the transcriptional level of bdnf in the APP group was significantly decreased (p<0.0001). Furthermore, compared with the NC group, the transcriptional level of bdnf in the APP group was also significantly reduced (p<0.0001). The significant decrease in the transcriptional level of bdnf in the APP group suggests that the APPswe695 gene may participate in regulating the function and health of nerve cells by affecting the transcriptional level of bdnf in HT22 cells.

[0212] Example 8

[0213] ELISA results of Aβ42 content in HT22-APPswe cells

[0214] The content of Aβ42 in cells of each group was measured by ELISA. Figure 8Experimental data showed that the Aβ42 content in the APP group was significantly higher than that in the Con group (p<0.0001) and the NC group (p<0.001). This result indicates that HT22-APPswe cells successfully mimicked the overproduction and accumulation of Aβ42 in AD.

[0215] Example 9

[0216] Western blot results of HT22-APPswe cell AD cell model indicators

[0217] Western blot was used to detect the expression of key biomarkers in the AD model, including proteins such as PSD95, CDK5, and GSK3β. Figure 9 The results showed that, compared with the Con group, the expression level of PSD95 protein in the APP group was significantly decreased (p<0.01), while the expression levels of CDK5 and GSK3β protein were significantly increased (p<0.01, p<0.001). Furthermore, compared with the NC group, the expression of PSD95 in the APP group also showed a significant decrease (p<0.05), and the expression of CDK5 and GSK3β showed a significant increase (p<0.05, p<0.001). These results demonstrate the changes in the expression levels of key protein markers PSD95, CDK5, and GSK3β in HT22-APPswe cells, a phenomenon consistent with the biological characteristics of AD, further indicating the successful construction of an AD cell model.

[0218] The above are some limited preferred embodiments of the present invention, described in a relatively specific and detailed manner, but they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention.

Claims

1. A mouse hippocampal neuron cell line overexpressing APPswe695, characterized in that: The mouse hippocampal neuron cell line is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC No: C2024239.

2. The mouse hippocampal neuron cell line overexpressing APPswe695 according to claim 1, characterized in that: The mouse hippocampal neuron cell line overexpressing APPswe695 is constructed from HT22 cells.

3. The mouse hippocampal neuron cell line overexpressing APPswe695 according to claim 1, characterized in that: The APPswe695 is derived from a human Alzheimer's disease family mutation, and its NCBI accession number is NM_201414 (K595N, M596L).

4. The method for constructing a mouse hippocampal neuron cell line overexpressing APPswe695 according to any one of claims 1 to 3, characterized in that: The method comprises: (1) Using GV513 as a vector, construct a plasmid that overexpresses the APPswe695 gene; (2) Amplifying the constructed overexpression plasmid GV513-APPswe695; (3) using pHelper 2.0 to transfect the plasmid obtained in step (2) and to harvest, concentrate and purify the lentivirus; (4) After HT22 cells were infected with HitransGA infection fluid, puromycin was used to screen and obtain the cell line HT22-APPswe695 overexpressing the APPswe695 gene, which is a mouse hippocampal neuron cell line overexpressing APPswe695.

5. The method for constructing a mouse hippocampal neuron cell line overexpressing APPswe695 according to claim 4, characterized in that: In the step (1), the primers used to construct the plasmid for overexpressing the APPswe695 gene include: APP(83741-1)-p1: AGGTCGACTCTAGAGGATCCCGCCACCATGCTGCCCGGTTTGGCACTG; APP(83741-1)-p2: ACCGTAAGTTATGTGCTAGCCTAGTTCTGCATCTGCTCAAAGAACTTG TAGG.

6. Use of the mouse hippocampal neuronal cells overexpressing APPswe695 as described in any one of claims 1 to 3 in preparing a mouse-derived Alzheimer's disease cell model with strong cell activity, characterized in that: The cell model exhibits the following molecular markers: (1) Aβ42 content increased significantly, indicating excessive accumulation of amyloid protein; (2) PSD95 expression decreased, while CDK5 and GSK3β expressions increased, consistent with the neurodegenerative characteristics of AD; (3) The transcription level of bdnf is reduced, reflecting the abnormal regulation of neurotrophic factors.

7. Use of the mouse hippocampal neuronal cells overexpressing APPswe695 as described in any one of claims 1 to 3 in the preparation of a drug for treating / alleviating Alzheimer's disease.

8. A mouse-derived Alzheimer's disease cell model with strong cell activity, characterized in that: The invention comprises the mouse hippocampal neuron cells overexpressing APPswe695 as described in any one of claims 1 to 3.

9. Use of the Alzheimer's disease cell model as claimed in claim 8 in the preparation of a drug for treating / alleviating Alzheimer's disease.

Images