Mutant of glutamate decarboxylase as well as recombinant thallus and application thereof

Abstract

The invention discloses a mutant of glutamate decarboxylase as well as a recombinant thallus and application thereof, and belongs to the field of protein engineering. According to the invention, a glutamate decarboxylase mutant M5 is obtained through a gene engineering method; the optimal temperature of the enzyme is increased by 10 DEG C while the thermal stability of the glutamate decarboxylase mutant is improved, and the mutant can play a very good catalytic effect without being in a buffer salt solution, so that an effective way is provided for industrial production of gamma-aminobutyric acid by an enzyme method; meanwhile, the problem that the product yield is low under the conventional production condition due to low thermal stability or too low optimal catalytic temperature when the glutamate decarboxylase is applied is also solved to a great extent.

Description

Technical Field

[0001] The invention belongs to the technical field of protein engineering, and specifically relates to a mutant of glutamate decarboxylase, a recombinant bacterial cell thereof, and application of the mutant in producing gamma-aminobutyric acid. Background Art

[0002] γ-aminobutyric acid (GABA) is a non-protein amino acid and an important inhibitory neurotransmitter in the central nervous system of mammals. It has the functions of calming, anti-anxiety, anti-epileptic, promoting sleep, improving menopausal or senile mental disorders, enhancing liver and kidney function, lowering blood pressure, effectively reducing weight, and promoting alcohol metabolism. It was approved as a new resource food by the Ministry of Health in 2009 and is widely used in medicine, health care, planting, feed, chemical industry, food and other industries. Most of the GABA in the body is produced by glutamate decarboxylation catalyzed by glutamate decarboxylase (GAD), and its coenzyme is 5-pyridoxal phosphate. The preparation methods of GABA as a principle of medicine or health care products mainly include chemical synthesis, separation and extraction, and biosynthesis. Since its biosynthesis method has the advantages of mild reaction conditions, simple processing procedures, high product yield and selectivity, and energy saving and environmental protection, the use of this method for the biological preparation of GABA has important industrial production application value.

[0003] GAD is a key enzyme in the biosynthesis of GABA. It uses 5'-pyridoxal phosphate (PLP) as a coenzyme and can specifically and irreversibly catalyze the decarboxylation of glutamate to synthesize GABA and CO2. Its activity directly affects the ability of microorganisms to synthesize GABA. GAD from microbial sources mainly includes Lactobacillus brevis, Lactobacillus plantarum, Escherichia coli, Streptomyces, Bacillus megaterium, etc. However, GAD from these sources has the disadvantages of poor thermal stability, narrow pH stability range, and low affinity with substrates, which makes it difficult to meet the needs of industrial applications. In 2019, Fang Hui's team introduced proline into the GAD of L.brevis CGMCC No.1306, which enhanced the hydrophobic interaction around the 364 site and greatly improved the thermal stability of G364P. In 2020, Zhang Qingfei's research group significantly improved the thermal stability of GAD1407 by introducing a disulfide bond. The efficient expression and high enzyme activity of glutamate decarboxylase are the key to the whole-cell catalytic production of GABA. In 2019, Yang Yuan'e and others constructed a recombinant Escherichia coli glutamate decarboxylase expression strain. By optimizing the induction conditions, the expression of soluble protein was improved, and the GAD enzyme activity reached 41.2U / mL, an increase of 11.1%. In 2020, Qiu Ling and others introduced GAD from Escherichia coli for expression in Bacillus subtilis. After optimizing the optimal temperature and pH, they introduced pyridoxal oxidase (PdxH), and the recombinant bacterial enzyme activity reached a maximum of 31.86U / mL. In 2023, Rao Zhiming's team selected 9 sites for site-directed mutagenesis and combined mutagenesis based on the surface charge modification of enzyme protein, which broadened the enzyme activity at a neutral pH of 6.0. At 40°C, PLP concentration of 0.1mM, and bacterial cell volume OD 600 Under the condition of 20, the engineered bacteria C.glutamicum E01 / pXMJ19-LpgadS24R / D88R / Y309K was initially added with 100 g / L of conversion solution in a 5L tank-scaled conversion system. A total of 1000 g of glutamate was added in batches within 14 hours to efficiently synthesize γ-aminobutyric acid with a yield of up to 402.8 g / L, but the molar conversion rate was only 52.3%.

[0004] Although the existing research on glutamate decarboxylase (GAD) has made some progress, including improving the thermal stability and enzyme activity of the enzyme through genetic engineering, there are still some shortcomings. For example, although most of the GAD mutants reported so far have improved the properties of the enzyme to a certain extent, they still face problems such as insufficient thermal stability, limited pH adaptation range, and the need for specific buffered salt solutions in industrial applications. These problems limit the application efficiency and cost-effectiveness of GAD in the large-scale production of γ-aminobutyric acid (GABA) process. In addition, while the existing GAD mutants improve the enzyme activity, they are often accompanied by a lower molar conversion rate, which not only increases the consumption of raw materials, but also affects the yield and purity of the final product. Therefore, it is of great significance to develop a glutamate decarboxylase mutant that has high thermal stability, a wide pH adaptation range, high activity without a specific buffered salt solution, and high molar conversion rate for achieving efficient and low-cost industrial production of GABA. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present invention obtains a glutamate decarboxylase mutant through a genetic engineering method, which not only improves the thermal stability of the glutamate decarboxylase mutant, but also increases the optimum temperature of the enzyme by about 10°C. In addition, the mutant can exert a good catalytic effect without the need for a buffered salt solution, thereby providing an effective way for the industrial production of gamma-aminobutyric acid by enzymatic method.

[0006] In a first aspect, the present invention provides a glutamate decarboxylase mutant, wherein the amino acid sequence of the mutant has at least 96% homology with SEQ ID NO. 4; more preferably, has at least 98% homology.

[0007] For the technical solution described above, in a further preferred case, the mutant has the catalytic activity of glutamate decarboxylase, and the amino acid positions 122, 133, 205, and 247 of the reference sequence SEQ ID NO.2 are replaced by cysteine, i.e., S122C, L133C, I205C, and A247C; in the core functional region, the amino acid sequence outside the mutation site has at least 98% homology with the corresponding core functional region in the reference sequence SEQ ID NO.4, and more preferably has at least 99% homology; and the amino acid sequence in the non-core functional region may be different, allowing certain sequence variations, and no strict homology requirements. Under the premise of not affecting the core enzyme activity, this part of the sequence may have a certain degree of change or variation. The glutamate decarboxylase mutant described above is modified based on the glutamate decarboxylase of Lactobacillus brevis. By replacing specific amino acids, it is possible not only to enhance the performance of the enzyme, but also to make the host strain taxonomically close to the closely related species of Lactobacillus brevis. Regardless of the specific taxonomy of the host strain, the present invention encompasses all mutant enzymes that may be assigned to species related to Lactobacillus brevis due to specific amino acid substitutions.

[0008] The above-mentioned "homology" refers to the degree of similarity between two or more protein sequences.

[0009] The core functional region of an enzyme is a region with a specific three-dimensional structure that can specifically bind to a substrate and catalyze the conversion of the substrate into a product. This region is called the active center or active site of the enzyme. The active center usually contains some essential groups that are crucial to the catalytic activity of the enzyme.

[0010] Essential groups within the active center: These groups are responsible for binding to the substrate, helping to form the enzyme-substrate complex, and catalytic groups that directly participate in the chemical conversion of the substrate and promote the reaction.

[0011] Essential groups outside the active center:

[0012] Although these groups are not directly involved in the catalytic reaction, they are necessary to maintain the spatial conformation of the enzyme active center and serve as binding sites for regulators.

[0013] The active center of an enzyme is highly specific and can recognize and bind to specific substrate molecules, catalyzing the chemical reaction of the substrate and converting it into a product. This specificity and high efficiency of the enzyme is achieved through the precise structure of its active center and the synergistic effect of essential groups.

[0014] For the technical solution described above, in a further preferred case, the amino acid sequence of the mutant is as shown in SEQ ID NO.4; that is, the glutamate decarboxylase mutant M5 obtained in the embodiment of the present invention.

[0015] For the technical solution described above, in a further preferred case, the mutant is derived from glutamate decarboxylase (gadB) of Lactobacillus brevis.

[0016] For the technical solution described above, in a further preferred case, the mutant has the catalytic activity of glutamate decarboxylase; based on the reference sequence SEQ ID NO.1, the mutant is replaced by TGC at nucleotide positions 366, 399, 615, and 741, respectively, resulting in changes in S122C, L133C, I205C, and A247C in the amino acid sequence. In its core functional region, except for the above mutation sites, the remaining nucleotide sequences have at least 98% homology with the core functional region corresponding to the reference sequence SEQ ID NO.3; more preferably, at least 99% homology; and the nucleotide sequences in the non-core functional regions may differ, and sequence variations within a certain range are allowed, and no strict requirements are made on the homology of this part.

[0017] The above-mentioned "homology" refers to the degree of identity and similarity between two or more nucleotide sequences.

[0018] For the technical solution described above, in a further preferred case, the coding gene sequence of the mutant is as shown in SEQ ID NO.3.

[0019] For the technical solution described above, in a further preferred case, the mutant exhibits a catalytic efficiency of at least 1-2 times that of the wild-type glutamate decarboxylase at pH 4.0-4.5 (more preferably pH 4.0) and 40-55°C (more preferably 45-50°C), and a half-life of at least 2-2.5 times that of the wild-type glutamate decarboxylase.

[0020] A recombinant bacterium, characterized in that: the recombinant bacterium comprises a gene expression vector encoding the above-mentioned glutamate decarboxylase mutant, the gene expression vector is selected from one of pET28(a), pUC19, pACYC, pHT254, pHT254-WapA, pXMJ19 or pEC-XK99E; the expression host cell of the recombinant bacterium is selected from one of Escherichia coli (E. coli), Bacillus subtilis (B. subtilis) or Corynebacterium glutamicum (C. glutamicum).

[0021] For the technical solution described above, in a further preferred case, the use of the recombinant bacteria in the preparation of γ-aminobutyric acid (GABA) is characterized in that the recombinant bacteria carry out a biotransformation process under the conditions of pH 4.0-4.5 (more preferably pH 4.0) and 40-55°C (more preferably 45-50°C).

[0022] For the technical solution described above, in a further preferred case, the catalytic system of the recombinant bacteria in use comprises 4-6M glutamate substrate, 0.03-0.07mM pyridoxal 5-phosphate and 10-25g / L (wet weight) of recombinant bacterial cells for reaction.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The γ-glutamyl methylamine synthetase mutant obtained by the genetic engineering method of the present invention has significantly improved properties compared with the wild strain, which is reflected in the following aspects:

[0025] (1) The optimum temperature of the mutant was 10°C higher than that of the original bacteria; this means that M5 can maintain efficient catalytic activity at higher temperatures and improve production efficiency.

[0026] (2) The production intensity of M5 under optimal conditions is 1.62 times that of the original bacteria; this significant improvement means that within the same production time, the production efficiency and economic benefits are greatly improved.

[0027] (3) The thermal stability of the enzyme was significantly improved. At 40°C, the half-life of the M5 mutant was 2.19 times that of the original bacteria; at 50°C, the half-life increased to 2.46 times the original. This is of great significance for continuous production and long-term storage in high-temperature industrial environments.

[0028] (4) It reduces the reaction cost, simplifies the subsequent purification process, shortens the production cycle, and reduces industrial costs.

[0029] (5) By comparative analysis, when the mutation sites (S122C, L133C, I205C, A247C) unique to the M5 strain were added to other mutants, these mutants had a significant improvement in the production efficiency of γ-aminobutyric acid. Similar trends can be observed in all tested mutants, reflecting the non-obviousness of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The optimum pH of the original bacteria and mutants;

[0031] Figure 2 Optimum temperature of the original bacteria and mutants. DETAILED DESCRIPTION

[0032] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments.

[0033] In the present invention, unless otherwise specified, percentages and percentage contents are all by mass. Unless otherwise specified, the experimental methods used are all conventional methods, and the materials and reagents used can be purchased from commercial sources.

[0034] Example 1 Construction of mutants

[0035] The glutamate decarboxylase gene gadB from Lactobacillus brevis was fully synthesized by a gene synthesis company after codon optimization, and the base sequence was shown in SEQ ID NO.1. It was connected into the plasmid pET28(a) and transferred into E. coli BL21(DE3) to obtain the original bacteria E. coli BL21(DE3)-pET28(a)-gadB named WT.

[0036] The method for obtaining a glutamate decarboxylase mutant comprises the following steps:

[0037] 1. Follow QuickMutation TM Gene random mutation kit designs primers and random mutations. The primer sequences are:

[0038] random-F:gatatacatatgataaataacgtagatctag; SEQ ID NO.5;

[0039] random-R: ggtggtggtgctcgagactgcgcactgtgg; SEQ ID NO.6;

[0040] 2. Random Mutation PCR Reaction

[0041] Random mutation PCR reaction Refer to the following table to set up the random mutation PCR reaction system:

[0042] Table 1 Random mutation PCR reaction system

[0043]

[0044] Set up the PCR instrument according to the following parameters:

[0045] Table 2 PCR instrument parameter settings

[0046]

[0047] 3. Transformation of Competent Cells

[0048] Take 10 μL of PCR product and detect it with 1% agarose. After the target band is observed, add 1 μL of DpnI enzyme to the remaining PCR product and incubate at 37°C for 1 hour. Add 2-5 μL of digestion product to 50 μL competent cells, mix well and place on ice for 30 minutes, then heat shock in a 42°C water bath for 45 seconds, and immediately put on ice for 2-5 minutes. Then add 250 μL of LB medium, culture at 200 rpm and 37°C for 1 hour, take 100-200 μL of bacterial solution and culture overnight on a kanamycin-resistant plate. Multiple mutants were obtained, among which the mutant with improved thermal stability and optimal temperature was named M5, and the amino acid sequence is shown in SEQ ID NO.2. M5 mutants S122C, L133C, I205C, A247C;

[0049] 4. Expression of glutamate decarboxylase:

[0050] The original bacteria and mutants were cultured in LB medium (kanamycin 50 mg / L) at 37°C, 200 rpm overnight, and inoculated into the fermentation medium at 5% inoculum for expansion. 600 =0.4~1.0, add 0.3mM IPTG, induce at low temperature overnight, and collect wet cells of glutamate decarboxylase by centrifugation as catalyst.

[0051] The seed culture medium and fermentation culture medium are: 5g / L yeast extract, 10g / L peptone, 10g / L NaCl, sterilized at 121°C for 20min, and after cooling, kanamycin with a final concentration of 10-100mg / mL is added.

[0052] Example 2 Effect of pH on Enzyme Properties

[0053] Enzyme reactions have their optimal pH range. Too high or too low pH values ​​will affect the activity of enzyme catalytic reactions. This experiment will simultaneously determine the optimal reaction pH of the unmutated WT and mutant M5. Prepare several groups of 100mL reaction solutions, the reaction system contains 50mM glutamate, 0.05mM 5-pyridoxal phosphate, and 5g / L glutamate decarboxylase wet bacteria. Adjust the pH value to 3.0-6.0 respectively, place it at 40℃ for 30min, and measure the changes of γ-aminobutyric acid in the reaction solution by HPLC at regular intervals. The unmutated catalytic yield measured at pH = 5.0 is used as the control and recorded as 100%. The relative enzyme activity at other pH values ​​is calculated in this way.

[0054] Enzyme activity of glutamate decarboxylase (U): Unit enzyme activity is defined as the amount of enzyme required to catalyze glutamate to produce 1 μmol of γ-aminobutyric acid per minute at 40°C and pH 5.0.

[0055] Relative enzyme activity of glutamate decarboxylase (U / mg): the enzyme activity per milligram of glutamate decarboxylase.

[0056] The results are as follows Figure 1 As shown, the optimal pH of mutant M5 is reduced, the optimal pH of WT is 5.0-5.5, and the optimal pH of mutant M5 is 4.0-4.5. Mutant M5 exhibits higher enzyme activity at lower pH values, which indicates that mutant M5 has a wider pH adaptation range and is suitable for a wider range of industrial application conditions. This feature makes mutant M5 more advantageous in actual production, especially in environments where reactions need to be carried out at lower pH values.

[0057] Example 3 Effect of temperature on enzyme properties

[0058] Temperature can change the speed of enzyme catalytic reaction and also lead to reduced or inactivated enzyme protein activity. The optimal reaction temperature of unmutated WT and mutant M5 was determined at the same time. Reacted at 35, 40, 45, 50, and 55°C for 30 minutes. In the respective optimal pH solutions, the reaction system contained 50mM glutamate, 0.05mM 5-pyridoxal phosphate, and 5g / L glutamate decarboxylase wet bacteria. HPLC was used to regularly measure the changes in γ-aminobutyric acid in the reaction solution, and the enzyme activity value of WT measured at 40°C was taken as 100%, and the relative enzyme activity at other temperatures was calculated.

[0059] The results are as follows Figure 2 As shown, the optimal temperature of WT is 40°C, while that of mutant M5 reaches 50°C.

[0060] The unmutated WT and mutant M5 were incubated at 40 and 50°C, and the enzyme activity without incubation was 100%. The residual enzyme activity at different incubation times was measured and the half-life was calculated. The results are shown in Table 3. It can be seen that at 40°C, the half-life of mutant M5 is 2.19 times that of WT; at 50°C, the half-life of mutant M5 is 2.46 times that of WT. This shows that M5 has higher thermal stability and is suitable for industrial application conditions at higher temperatures.

[0061] Table 3 Comparison of half-life between the original bacteria and mutant M5

[0062] Half-life / h 40℃ 50℃ WT 5.98 4.03 M5 13.08 9.90

[0063] Example 4 Effect of different carriers

[0064] The recombinant plasmids of WT and M5 were constructed on different vectors (pUC19 and pACYC vectors) using the In-Fusion cloning technique and transformed into competent Escherichia coli cells. The bacterial solution was spread on the corresponding resistance plates and cultured overnight to obtain engineered bacteria, and the effects of different vectors on the activity of glutamate decarboxylase were evaluated.

[0065] E.coliBL21(DE3) / pUC19-gadB-WT、

[0066] E.coliBL21(DE3) / pUC19-gadB-M5、

[0067] E.coliBL21(DE3) / pACYC-gadB-WT、

[0068] E.coliBL21(DE3) / pACYC-gadB-M5,

[0069] They were named WT-1, M5-1 and WT-2, M5-2 respectively.

[0070] Use LB medium to culture the engineered bacteria (pUC19 ampicillin 100 mg / L or pACYC chloramphenicol 50 mg / L) and wait until the cell OD 600 =0.4-1.0, add 0.3 mM IPTG, induce at low temperature overnight, and collect wet cells of glutamate decarboxylase by centrifugation as a catalyst.

[0071] The seed culture medium and fermentation culture medium are: 5g / L yeast extract, 10g / L peptone, 10g / L NaCl, sterilized at 121°C for 20min, and after cooling, kanamycin with a final concentration of 10-100mg / mL is added.

[0072] The WT-1 and WT-2 engineered bacteria in Example 4 were used to convert the glutamate substrate with the original bacteria WT. In a 100 mL reaction system (containing 50 mM glutamate, 0.05 mM pyridoxal 5-phosphate, and 5 g / L of glutamate decarboxylase wet bacteria), the reaction was carried out at 40°C and pH 5.0-5.5 for 30 min. The change of γ-aminobutyric acid in the reaction solution was measured by HPLC at regular intervals. The production level of WT measured under these conditions was taken as 100%, and the relative production levels of WT-1 and WT-2 were 98.9% and 99.2%, respectively.

[0073] The engineering bacteria M5-1 and M5-2 in Example 4 were subjected to glutamate substrate conversion with the original bacteria mutant M5. In a 100 mL reaction system (containing 50 mM glutamate, 0.05 mM pyridoxal 5-phosphate, and 5 g / L of glutamate decarboxylase wet bacteria), the reaction was carried out at 50° C. and pH 4.0-4.5 for 30 min, and the change of γ-aminobutyric acid in the reaction solution was measured by HPLC at regular intervals. The production level of M5 measured under these conditions was taken as 100%, and the relative production levels of M5-1 and M5-2 were 99.6% and 99.4%, respectively.

[0074] This indicates that the M5 mutant has little effect on the expression and activity of glutamate decarboxylase in different vectors (pUC19 and pACYC), and the performance of WT and M5 on the two vectors is similar. Both have good versatility and application potential.

[0075] Example 5 Effects of different hosts

[0076] According to conventional molecular manipulation methods, pHT254 and pHT254-WapA were used to express WT and M5 in Bacillus subtilis. The engineered bacteria were obtained respectively:

[0077] B.subtilis168-pHT254-P grac100 -gadB-WT,

[0078] B.subtilis168-pHT254-P grac100 -gadB-M5,

[0079] B.subtilis168-pHT254-P grac100 -WapA-gadB-WT,

[0080] B. subtilis 168-pHT254-P grac100 -WapA-gadB-M5,

[0081] They were named WT-3, M5-3 and WT-4, M5-4 respectively.

[0082] According to conventional molecular manipulation methods, the glutamate decarboxylase gene (gadB) of WT and M5 was expressed in Corynebacterium glutamicum using pXMJ19 and pEC-XK99E. The following engineered bacteria were obtained respectively to evaluate the effect of different hosts on the activity of glutamate decarboxylase.

[0083] Corynebacterium glutamicumATCC 13002 / pXMJ19-gadB-WT,

[0084] Corynebacterium glutamicumATCC 13002 / pXMJ19-gadB-M5,

[0085] Corynebacterium glutamicumATCC 13002 / pEC-XK99E-gadB-WT,

[0086] Corynebacterium glutamicumATCC 13002 / pEC-XK99E-gadB-M5,

[0087] They were named WT-5, M5-5 and WT-6, M5-6 respectively.

[0088] Bacillus subtilis was cultured in 2×YT medium (chloramphenicol 10 mg / L) at 37°C, 200 rpm overnight, inoculated into the fermentation medium at 5% inoculum, and cultured until the cell OD 600 =0.5-0.8, 1 mM IPTG was added, induced at low temperature overnight, and the wet cells of glutamate decarboxylase were collected by centrifugation of WT-3 and M5-4 respectively as catalysts. The supernatant of glutamate decarboxylase was collected by centrifugation of WT-4 and M5-4 respectively as catalysts.

[0089] 2×YT seed culture medium and fermentation medium: yeast extract powder 10 g / L, peptone 16 g / L, NaCl 5 g / L, sterilize at 121°C for 20 min, add chloramphenicol with a final concentration of 10-50 mg / mL after cooling.

[0090] Corynebacterium glutamicum was cultured in LBB medium (pEC-XK99E kanamycin 50 mg / L or pXMJ19 chloramphenicol 20 mg / L) at 37°C, 200 rpm overnight, and inoculated into the fermentation medium at a 5% inoculum for expansion. 600 =0.4-0.6, 0.1 mM IPTG was added, induced at low temperature overnight, and the whole cells were harvested by centrifugation as catalyst.

[0091] LBB seed medium and fermentation medium: yeast extract 5g / L, peptone 10g / L, NaCl 10g / L, brain heart extract 10g / L, sterilize at 121℃ for 20min, add chloramphenicol with a final concentration of 10-50mg / mL after cooling.

[0092] The WT-3, WT-4, WT-5, and WT-6 engineered bacteria in Example 5 were subjected to glutamate substrate conversion with the original bacteria WT. In a 100 mL reaction system (containing 50 mM glutamate, 0.05 mM 5-pyridoxal phosphate, and 5 g / L glutamate decarboxylase cells), the reaction was carried out at 50° C. and pH 4.0-4.5 for 30 min, and the HPLC was used to regularly measure the change of γ-aminobutyric acid in the reaction solution. The production level of WT measured under these conditions was taken as 100%, and the relative production levels of WT-3, WT-4, WT-5, and WT-6 were 99.5%, 99.3%, 99.0%, and 99.6%, respectively.

[0093] The engineering bacteria M5-3, M5-4, M5-5, and M5-6 in Example 5 were subjected to glutamate substrate conversion with the original bacteria mutant M5. In a 100 mL reaction system (comprising 50 mM glutamate, 0.05 mM 5-phosphate pyridoxal, and 5 g / L glutamate decarboxylase cells), the reaction was carried out at 50° C. and pH 4.0-4.5 for 30 min, and the change of gamma-aminobutyric acid in the reaction solution was determined by HPLC at regular intervals. The production level of M5 determined under these conditions was taken as 100%, and the relative production levels of M5-3, M5-4, M5-5, and M5-6 were 99.1%, 99.7%, 99.2%, and 99.5%, respectively.

[0094] This indicates that the M5 mutant has little effect on the expression and activity of glutamate decarboxylase in different hosts (Bacillus subtilis and Corynebacterium glutamicum), and the performance of WT and M5 on the two hosts is similar, showing good versatility and application potential.

[0095] Example 6 Scale-up Production Evaluation

[0096] WT, WT-1, WT-2, WT-3, WT-5, and WT-6 wet bacteria were used as biocatalysts and glutamate was used as substrate to prepare γ-aminobutyric acid by biotransformation. The catalytic system was 10 L, and the catalytic system contained 5M glutamate, 0.05mM 5-phosphate pyridoxal, and 20g / L wet bacteria. The reaction system was reacted in an aqueous solution at 40°C and pH=5.0-5.5. After the reaction, the cells were centrifuged to remove the cells, and the sample was filtered with a 0.22μm membrane and then HPLC was used to detect the yield of γ-aminobutyric acid.

[0097] Using M5, M5-1, M5-2, M5-3, M5-5, and M5-6 wet bacteria as biocatalysts and glutamate as substrate, γ-aminobutyric acid was prepared by biotransformation. The catalytic system was 10 L, and the catalytic system contained 5M glutamate, 0.05mM 5-phosphate pyridoxal, and 20g / L wet bacteria. The reaction system was reacted in an aqueous solution at 50°C and pH=4.0. After the reaction, the cells were removed by centrifugation, and the sample was filtered with a 0.22μm membrane and then HPLC was used to detect the yield of γ-aminobutyric acid.

[0098] WT-4 extracellular supernatant was used as a biocatalyst and glutamate was used as a substrate for bioconversion to prepare γ-aminobutyric acid. The catalytic system was 10 L, and the catalytic system contained 5M glutamate, 0.05mM pyridoxal 5-phosphate, and 20g / L wet bacteria. The reaction system was carried out in an aqueous solution at 40°C and pH=5.0-5.5. After the reaction, the cells were removed by centrifugation, and the sample was filtered with a 0.22μm membrane and then HPLC was used to detect the yield of γ-aminobutyric acid.

[0099] Using M5-4 extracellular supernatant as biocatalyst and glutamate as substrate, γ-aminobutyric acid was prepared by biotransformation. The catalytic system was 10L, which contained 5M glutamate, 0.05mM pyridoxal 5-phosphate, and 20g / L wet bacteria. The reaction system was carried out in an aqueous solution at 50°C and pH=4.0. After the reaction was completed, the sample was centrifuged and filtered with a 0.22μm membrane and then HPLC was used to detect the yield of γ-aminobutyric acid.

[0100] The results are shown in Table 4. The maximum yield of γ-aminobutyric acid produced by mutant M5 catalyzed substrate is close to 5M, which is 512g / L. The reaction time is 13h and the production intensity is 39.38g / L / h, which is 1.62 times that of the original bacteria. The production intensity of the engineered bacteria with replaced vectors, the original bacteria WT and mutant M5 is 100%, the relative production intensity of WT-1, WT-2, WT-3, WT-4, WT-5, and WT-6 are 99.8%, 99.9%, 99.9%, 99.9%, 100%, and 99.8%, respectively. The relative production intensity of M5-1, M5-2, M5-3, M5-4, M5-5, and M5-6 are 99.7%, 99.9%, 99.8%, 99.9%, 99.9%, 99.9%, and 99.9%, respectively.

[0101] The catalytic abilities of WT expressed by the engineered bacteria with replaced vectors and hosts were similar to those of the original bacteria WT, and the catalytic abilities of M5 expressed by the engineered bacteria with replaced vectors and hosts were similar to those of the mutant M5, indicating that the M5 mutant had stable high catalytic efficiency under different conditions and had broad prospects for industrial application.

[0102] Table 4 Comparison of catalytic ability of engineered bacteria with replacement of vector and host

[0103]

[0104]

[0105] The maximum yield of γ-aminobutyric acid produced by mutant M5 catalyzed by substrate was close to 5M, equivalent to 512g / L. The reaction time was 13h and the production intensity was 39.38g / L / h, which was 1.62 times that of the original bacteria.

[0106] The catalytic abilities of other engineered bacteria with replaced vectors and hosts were similar to those of the original bacteria WT and mutant M5, indicating that the M5 mutant had stable high catalytic efficiency under different conditions.

[0107] This suggests that the M5 mutant has significant advantages in large-scale production and is suitable for industrial applications.

[0108] Comparative Example 1 Transformation Effects of Other Mutants:

[0109] The wet bacteria of other mutants obtained in Example 1 were used as biocatalysts to prepare γ-aminobutyric acid by bioconversion. The catalytic system was 100 mL, and the reaction system contained 50 mM glutamate, 0.05 mM 5-pyridoxal phosphate, and 5 g / L glutamate decarboxylase cells. The reaction system was reacted in an aqueous solution at 50°C, pH = 4.0. After 30 minutes of reaction, the cells were removed by centrifugation. The sample was filtered with a 0.22 μm membrane and then HPLC was used to detect the yield of γ-aminobutyric acid. The mutation sites of the mutants and the catalytic ability of γ-aminobutyric acid are shown in Table 5. The results show that the mutation effects of other mutants are not as good as M5, but on the basis of them, combined with the mutation sites of M5, their catalytic abilities have been greatly improved compared with before;

[0110] Table 5 Comparison of catalytic ability of other mutants

[0111]

[0112]

[0113] Note: The underlined ones are the mutation sites of the M5 strain screened in this patent.

[0114] In summary, through the comparative analysis of the comparative examples and examples of the present application in Table 5, it can be seen that when the mutation sites (S122C, L133C, I205C, A247C) unique to the M5 strain are added to other mutants, these mutants have a significant improvement in the production efficiency of γ-aminobutyric acid. For example, when the mutants Q65N&D106C&K155I&G287A&F338C are used alone, the γ-aminobutyric acid production is 309.4 g / L, and the reaction time is 20 hours; after combining with the mutation sites of M5, the production is increased to 458.2 g / L, and the reaction time is shortened to 15 hours. Similar trends can be observed in all mutants tested. These mutants all contain the key mutation sites S122C, L133C, I205C, and A247C, and maintain high homology in the core functional region. The obtained mutants can significantly improve the production intensity in the process of γ-aminobutyric acid synthesis, while not all similar mutations can achieve the ideal effect. The combination of these specific mutation sites plays an important role in improving the activity of glutamate decarboxylase.

[0115] The above is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by a person skilled in the art within the technical scope disclosed in the present invention should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A glutamate decarboxylase mutant, characterized in that: The amino acid sequence of the mutant has at least 98% homology with SEQ ID NO.

4.

2. The glutamate decarboxylase mutant according to claim 1, characterized in that: The mutant has the catalytic activity of glutamate decarboxylase, and cysteine ​​is replaced at amino acid positions 122, 133, 205 and 247 of the reference sequence SEQ ID NO.2 respectively; in its core functional region, the amino acid sequence except the above mutation sites has at least 98% homology with the corresponding core functional region in the reference sequence SEQ ID NO.

4.

3. The glutamate decarboxylase mutant according to claim 2, characterized in that: The amino acid sequence of the mutant is shown in SEQ ID NO.

4.

4. The glutamate decarboxylase mutant according to claim 1, characterized in that: The mutant is derived from glutamate decarboxylase gadB of Lactobacillus brevis.

5. The glutamate decarboxylase mutant according to claim 1, characterized in that: The mutant has the catalytic activity of glutamate decarboxylase, and cysteine ​​is replaced at amino acid positions 122, 133, 205 and 247 of the reference sequence SEQ ID NO.2 respectively; in its core functional region, the nucleotide sequence except the above mutation sites has at least 98% homology with the corresponding core functional region in the reference sequence SEQ ID NO.

3.

6. The glutamate decarboxylase mutant according to claim 5, characterized in that: The coding gene sequence of the mutant is shown in SEQ ID NO.

3.

7. A recombinant bacterial cell, characterized in that: The recombinant bacterium comprises a gene expression vector encoding the glutamate decarboxylase mutant according to claim 1, wherein the gene expression vector is selected from one of pET28(a), pUC19, pACYC, pHT254, pHT254-WapA, pXMJ19 or pEC-XK99E; the expression host cell of the recombinant bacterium is selected from one of Escherichia coli, Bacillus subtilis or Corynebacterium glutamicum.

8. Use of the recombinant bacterial cell according to claim 7 in the preparation of γ-aminobutyric acid, characterized in that: The recombinant bacteria undergo a biotransformation process under the conditions of pH 4.0-4.5 and 40-55°C.

9. The use according to claim 8, characterized in that: The catalytic system of the recombinant bacteria in the biological transformation process includes: 4-6M glutamate substrate, 0.03-0.07mM 5-phosphate pyridoxal and 10-25g / L recombinant bacteria cells for reaction.

Images