Method for detecting sheep TPH2 gene mutation through HRM
Detection of TPH2 gene mutations in sheep through HRM technology has solved the problem of cumbersome and high cost in the existing technology, and achieved rapid, economical and highly sensitive mutation detection effect.
Patent Information
- Application Number
- CN202510071516.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-15
- Publication Date
- 2025-03-21
AI Technical Summary
The prior art is difficult to detect mutations in the sheep TPH2 gene quickly and economically, resulting in cumbersome detection process, high cost and complex data interpretation.
Using high-resolution melting curve (HRM) technology, specific HRM primer pairs were designed, blood genomic DNA was extracted through the kit method, HRM detection system was prepared, mutation site scanning was performed, HRM curves were obtained and genotype was judged.
It has achieved rapid screening of mutations in the TPH2 gene in sheep, which is simple to operate, low cost, fast detection speed and high sensitivity, and is suitable for large-scale mutation detection.
Smart Images
Figure CN119662789A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of biotechnology, in particular to a method for detecting sheep TPH2 gene mutation by HRM. Background Art
[0002] The TPH2 (Tryptophan Hydroxylase 2) gene encodes tryptophan hydroxylase 2. Tryptophan hydroxylase 2 is a key enzyme that catalyzes the synthesis of 5-hydroxytryptamine (5-HT). In sheep, the TPH2 gene plays an important role:
[0003] 1. Influence on behavior and emotions: Serotonin is an important neurotransmitter that is involved in regulating animal emotions, behaviors, appetite, sleep and other physiological processes. In sheep, the normal expression of the TPH2 gene is very important for maintaining the normal emotional state and behavioral performance of sheep.
[0004] 2. Participate in physiological regulation: 5-HT also plays a regulatory role in the physiological processes of the animal's digestive system, cardiovascular system, etc. In the sheep's digestive system, 5-HT can regulate gastrointestinal motility and secretion, affecting the sheep's digestive function and absorption of nutrients. In the cardiovascular system, 5-HT may participate in the contraction and relaxation of blood vessels, affecting the blood pressure and blood circulation of sheep.
[0005] 3. Potential impact on reproduction: Although there are relatively few studies on the direct impact of the sheep TPH2 gene on reproduction, in other animals, there is a certain correlation between the serotonin system and reproductive function.
[0006] Therefore, the sheep TPH2 gene may also have a potential impact on the sheep's reproductive behavior, secretion of reproductive hormones and reproductive organ function by affecting the neuroendocrine system. A missense mutation in the second exon of the TPH2 gene may have some effects on the serotonin pathway, thereby affecting some phenotypes. Studying the sheep TPH2 gene is of great significance for a deep understanding of the sheep's physiological mechanisms, behavioral characteristics and health status, and may provide a theoretical basis for sheep breeding management, disease prevention and control, and breed improvement.
[0007] There are many existing methods for detecting gene mutations. So far, the more common nucleic acid diagnostic methods include: nucleic acid molecular hybridization technology, gene sequencing technology, biochip technology, polymerase chain reaction technology, etc. The following are some common existing mutation detection technologies and their shortcomings:
[0008] Sanger sequencing: It is a traditional DNA sequencing technology. The principle is to terminate the extension of the chain through dideoxynucleotides during DNA replication, and read the DNA sequence through operations such as electrophoresis. It can be used to detect known and unknown mutations with high accuracy; but the throughput is low, and it is suitable for key gene detection of a small number of samples.
[0009] Next-generation sequencing technology: including whole genome sequencing (WGS), whole exome sequencing (WES), etc. It can sequence a large number of DNA fragments at the same time, with high throughput and fast speed, and can detect various types of mutations. It is widely used in cancer research, genetic disease diagnosis, etc.; however, data interpretation is complex and the cost is high.
[0010] Real-time fluorescence quantitative PCR: Add fluorescent dyes or probes to the PCR reaction system, and monitor DNA amplification in real time by detecting fluorescent signals. It can detect mutations in specific genes and can quantitatively analyze mutant genes in samples. It has high sensitivity and is easy to operate. It is often used for mutation detection in pathogen detection and gene expression analysis. However, it can only detect gene fragments with known sequences. It is difficult to detect mutations in unknown sequences, and there are certain false positives and false negatives.
[0011] Digital PC: distributes samples to a large number of tiny reaction units for PCR amplification, and determines whether there is target DNA in each reaction unit through the end-point fluorescence signal. It can absolutely quantitatively detect low-abundance mutant genes, which is very advantageous in the field of trace mutation detection such as tumor liquid biopsy; however, due to the large amount of data, data analysis is complicated and there are quality issues of droplets / reaction units;
[0012] Comparative genomic hybridization chip: can detect the copy number changes of chromosome DNA at the whole genome level, and determine the variation of gene copy number by comparing the fluorescence signal intensity of the test sample and the control sample, and is used for the detection of tumor cell chromosome abnormalities, etc.; but the resolution is limited, and it can only detect copy number changes. It cannot detect other types of mutations such as point mutations and gene fusions;
[0013] SNP chip: mainly used to detect changes in single nucleotide polymorphism (SNP) sites. It can detect a large number of SNP sites at the same time and play a role in population genetics, disease association research, etc.; but it can only detect known SNP sites, and there are problems with the accuracy, and the data interpretation is also somewhat complex.
[0014] The main problems with the above technologies are "difficult to detect in large quantities", "cumbersome process", "high cost" and "complex data interpretation". Therefore, it is urgent to find a new detection method that can quickly screen mutations in the sheep TPH2 gene. Summary of the invention
[0015] The object of the present invention is to provide a method for detecting sheep TPH2 gene mutation by HRM to solve the problems raised in the prior art.
[0016] To achieve the above object, the present invention provides the following technical solutions:
[0017] A method for detecting sheep TPH2 gene mutation by HRM specifically comprises the following steps:
[0018] Step 1: Design HRM primer pairs;
[0019] Step 2: Extracting genomic DNA from the blood of the sheep to be tested using a kit method;
[0020] Step 3: Prepare the HRM detection system, scan the mutation sites, obtain the HRM curve, and determine the genotype of the sheep to be tested.
[0021] Wherein, the HRM primer pair in step 1 includes TPH2F1 / R1 and TPH2F2 / R1.
[0022] Preferably, the TPH2F1 / R1 primer pair includes an upstream primer TPH2F1, whose nucleotide sequence is AAATAAAACTAACTCTGGCA; and a downstream primer TPH2R1, whose nucleotide sequence is TCAAGGAGAATACAACCG.
[0023] Preferably, the TPH2F2 / R1 primer pair includes an upstream primer TPH2F2, whose nucleotide sequence is CTAAATAAAACTAACTCTGGCA; and a downstream primer TPH2R1, whose nucleotide sequence is TCAAGGAGAATACAACCG.
[0024] Preferably, in step 3, the HRM detection system uses blood genomic DNA as a template, performs HRM amplification on it using the primers in step 1 to obtain an amplified product, and then performs HRM analysis on the amplified product.
[0025] The reaction process of the HRM amplification includes: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 10 s, annealing at 50°C for 10 s, and extension at 72°C for 10 s, for a total of 40 cycles.
[0026] The HRM analysis procedure includes: denaturation at 95° C. for 5 min, renaturation at 40° C. for 1 min to form a hybrid; heating from 70° C. to 95° C. to collect fluorescence signals, and collecting signals 25 times per second.
[0027] Preferably, in step 3, the HRM curves are analyzed and compared to determine the genotype of the sheep breed to be tested.
[0028] Preferably, the HRM detection system includes 12.5 μL rTaq enzyme, 0.5 μL TPH2F1, 0.5 μL TPH2R1, 0.8 μL LCgreen fluorescent dye, 1 μL blood genomic DNA and 9.7 μL ddH2O.
[0029] Preferably, the HRM detection system includes 12.5 μL rTaq enzyme, 0.5 μL TPH2F2, 0.5 μL TPH2R1, 0.8 μL LCgreen fluorescent dye, 1 μL blood genomic DNA and 9.7 μL ddH2O.
[0030] Compared with the prior art, the present invention has the following beneficial effects:
[0031] The present invention provides a method for detecting mutations of the sheep TPH2 gene. The detection method can be used to quickly screen mutations of the sheep TPH2 gene, thereby obtaining corresponding sheep mutants and accelerating the breeding of sheep varieties. Compared with the prior art, the advantages are:
[0032] 1. Easy to operate. The operation process of HRM is relatively simple, and it can be detected on a conventional real-time quantitative PCR instrument as long as the instrument has the HRM analysis function;
[0033] 2. Lower cost. Compared with some high-throughput sequencing technologies or gene chip technologies, HRM does not require expensive reagents and consumables. It mainly relies on conventional PCR reagents and fluorescent dyes, and does not require the use of special probes, which reduces the detection cost to a certain extent and is more suitable for large-scale screening of known mutation sites under limited budgets;
[0034] 3. Fast detection speed. Because of its simple process, the whole process from sample amplification to obtaining melting curve can be completed in a short time;
[0035] 4. High sensitivity. HRM can detect low-level heterozygous mutations and can find even a single base difference, thus providing a more sensitive means for detecting gene variation; BRIEF DESCRIPTION OF THE DRAWINGS
[0036] Figure 1 The enzyme cutting phenotyping diagram of some Junken white sheep in Example 3;
[0037] Figure 2 The enzyme cutting phenotyping diagram of some Junken white sheep in Example 3;
[0038] Figure 3 The TPH2 genotyping map of some Junken sheep detected by the HRM method in Example 1;
[0039] Figure 4The TPH2 genotyping map of some Junken sheep detected by the HRM method in Example 1;
[0040] Figure 5 The TPH2 genotyping map of some Junken sheep detected by the HRM method in Example 1;
[0041] Figure 6 The TPH2 genotyping map of some Junken sheep detected by the HRM method in Example 1;
[0042] Figure 7 The TPH2 genotyping patterns of some Black-headed Suffolk sheep and some Junken White sheep detected by the HRM method in Example 1;
[0043] Figure 8 The TPH2 genotyping patterns of some Black-headed Suffolk sheep and some Junken White sheep detected by the HRM method in Example 1;
[0044] Fig. 9 This is the TPH2 genotyping map of Junken sheep detected by the HRM method in Example 2. DETAILED DESCRIPTION
[0045] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0046] The PCR primers and HRM primers used in the experiment are shown in Table 1
[0047] Table 1
[0048] Primer name Primer sequences Annealing temperature / ℃ TPH2T1F TGTATGCTTGCTAAGGATTC 50 TPH2T1R TCACATTCACCTGGAAGAG 50 TPH2F1 AAATAAAAC TAAC TC TGGCA 50 TPH2R1 TCAAGGAGAATACAACCG 50 TPH2F2 CTAAATAAAACTAACTCTGGCA 50 TPH2R1 TCAAGGAGAATACAACCG 50
[0049] Example 1: This example provides a method for detecting sheep TPH2 gene mutation by HRM, and the specific steps are as follows:
[0050] Step 1: Use a blood / cell / tissue genomic DNA extraction kit to extract blood genomic DNA from the sheep to be tested:
[0051] The kit model is DP304, purchased from Tiangen Biochemical Technology Co., Ltd.;
[0052] The sheep breeds to be inspected are Black-headed Suffolk sheep and Junken White sheep, both from the Xinjiang Academy of Agricultural Reclamation Sciences Huayu Base Sheep Farm; among them, there are 76 Junken White sheep and 24 Black-headed Suffolk sheep; among the 76 Junken White sheep, there are three lambs;
[0053] Step 2: Prepare the HRM detection system, use the extracted sheep blood genomic DNA as a template, and perform HRM amplification on it using HRM primers:
[0054] The HRM detection system includes: 12.5 μL rTaq enzyme, 0.5 μL TPH2F1, 0.5 μL TPH2R1, 0.8 μL LCgreen fluorescent dye, 1 μL blood genomic DNA and 9.7 μL ddH2O;
[0055] The reaction process of HRM amplification includes: pre-denaturation at 95°C for 10 minutes; denaturation at 95°C for 10 seconds, annealing at 50°C for 10 seconds, and extension at 72°C for 10 seconds, for a total of 40 cycles; amplifying the above HRM detection system to obtain HRM amplification products;
[0056] Step 3: Perform HRM analysis on the HRM amplification products on the LightCycler 480 platform:
[0057] The HRM analysis procedure includes: denaturation at 95℃ for 5 minutes, renaturation at 40℃ for 1 minute to form a hybrid; heating from 70℃ to 95℃ to collect fluorescence signals, collecting 25 signals per second; cooling to 40℃ after collection, and performing HRM data analysis using the LightCycler480 built-in software. The results are as follows: Figure 3-8 .
[0058] Example 2: Referring to Example 1, the difference is that the HRM detection system is adjusted; the parameters of other steps remain the same.
[0059] The breed of sheep to be tested is Junken White Sheep, which comes from the Huayu Base Sheep Farm of Xinjiang Academy of Agricultural Reclamation Sciences;
[0060] The HRM detection system included 12.5 μL rTaq enzyme, 0.5 μL TPH2F2, 0.5 μL TPH2R1, 0.8 μL LCgreen fluorescent dye, 1 μL blood genomic DNA and 9.7 μL ddH2O.
[0061] The results of HRM data analysis are as follows Fig. 9 shown.
[0062] Example 3: As a result verification of Examples 1 and 2, the specific steps are as follows:
[0063] The blood genomic DNA of the sheep to be tested was used as a template, and a PCR amplification system was established using PCR primers to perform PCR amplification to obtain an amplified product; wherein the PCR amplification system is as follows: each 20 μL reaction solution includes 10 μL rTaq enzyme, 0.5 μL TPH2T1F, 0.5 μL TPH2TIR, 1 μL DNA and 8 μL ddH2O;
[0064] The enzyme digestion identification system was prepared with the PCR amplification product. Each 20 μL reaction solution included 10 μL PCR amplification product, 0.3 μL BsrBI restriction endonuclease, 2 μL CutSmart buffer and 7.7 μL ddH2O.
[0065] Enzyme digestion was performed, and some results were as follows Figure 1 As shown in Figure 2, the enzyme cutting result typing diagram GG is the wild type, which is completely cut into two bands of 194bp+83bp; AG is the heterozygous type, which is incompletely cut into three bands of 277bp+194bp+83bp; AA is the mutant type, which cannot cut into a single band of 277bp.
[0066] Conclusion: Based on the comparison and analysis of the HRM curve and the enzyme digestion results, the HRM curve shows that the AA mutant type is concentrated in the middle, the GG wild type is concentrated in the upper part, and the AG heterozygous type is mainly distributed in the lower part. The genotypes are shown in Tables 2, 3, and 4, where Tables 2 and 3 are the test results of Example 1, and the green background in the table is lamb; Table 4 is the test results of Example 2.
[0067] The enzyme digestion result was the same as the HRM curve analysis result of the present invention, which proved the accuracy and feasibility of the detection method of the present invention.
[0068] Table 2
[0069]
[0070] Table 3
[0071] Black-headed Suffolk sheep Restriction genotype HRM genotype 1 GG GG 2 GG GG 3 GG GG 4 GG GG 5 GG GG 6 GG GG 7 GG GG 8 GG GG 9 GG GG 10 GG GG 11 GG GG 12 GG GG 13 GG GG 14 GG GG 15 GG GG 16 GG GG 17 GG GG 18 GG GG 19 GG GG 20 GG GG 21 GG GG 22 GG GG 23 GG GG 24 GG GG
[0072] Table 4
[0073]
[0074] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.
Claims
1. A method for detecting sheep TPH2 gene mutation by HRM, characterized in that: The method comprises the following steps: Step 1: Design HRM primer pairs; Step 2: Extracting genomic DNA from the blood of the sheep to be tested; Step 3: Prepare the HRM detection system, obtain the HRM amplification product, and then perform HRM analysis to determine the genotype of the sheep to be tested.
2. The method for detecting sheep TPH2 gene mutation by HRM according to claim 1, characterized in that: The HRM primer pair in step 1 includes an upstream primer TPH2F1, whose nucleotide sequence is AAATAAAACTAACTCTGGCA; and a downstream primer TPH2R1, whose nucleotide sequence is TCAAGGAGAATACAACCG.
3. The method for detecting sheep TPH2 gene mutation by HRM according to claim 1, characterized in that: The HRM primer pair in step 1 includes an upstream primer TPH2F2, whose nucleotide sequence is CTAAATAAAACTAACTCTGGCA; and a downstream primer TPH2R1, whose nucleotide sequence is TCAAGGAGAATACAACCG.
4. The method for detecting sheep TPH2 gene mutation by HRM according to claim 1, characterized in that: In the step 3, the HRM detection system uses the blood genomic DNA as a template, performs HRM amplification on it using the primers in step 1, obtains the amplified product, and then performs HRM analysis on the amplified product.
5. The method for detecting sheep TPH2 gene mutation by HRM according to claim 4, characterized in that: The reaction process of the HRM amplification includes: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 10 s, annealing at 50°C for 10 s, and extension at 72°C for 10 s, for a total of 40 cycles.
6. The method for detecting sheep TPH2 gene mutation by HRM according to claim 4, characterized in that: The HRM analysis procedure includes: denaturation at 95° C. for 5 min, renaturation at 40° C. for 1 min to form a hybrid; heating from 70° C. to 95° C. to collect fluorescence signals, and collecting signals 25 times per second.
7. The method for detecting sheep TPH2 gene mutation by HRM according to claim 1, characterized in that: In step 3, the HRM curves are analyzed and compared to determine the genotype of the sheep breed to be tested.
8. The method for detecting sheep TPH2 gene mutation by HRM according to claim 2, characterized in that: The HRM detection system consisted of 12.5 μL rTaq enzyme, 0.5 μL TPH2F1, 0.5 μL TPH2R1, 0.8 μL LCgreen fluorescent dye, 1 μL blood genomic DNA and 9.7 μL ddH2O.
9. The method for detecting sheep TPH2 gene mutation by HRM according to claim 3, characterized in that: The HRM detection system consisted of 12.5 μL rTaq enzyme, 0.5 μL TPH2F2, 0.5 μL TPH2R1, 0.8 μL LCgreen fluorescent dye, 1 μL blood genomic DNA and 9.7 μL ddH2O.