CYP2D6 gene rapid detection kit and method

Abstract

The invention discloses a CYP2D6 gene rapid detection kit and method, and belongs to the technical field of gene detection.The kit is subpackaged in a PCR tube in a freeze-drying mode and comprises a nucleic acid releasing agent, a freeze-drying reagent for specifically detecting CYP2D65 and CYP2D610 genotypes, a correction product, a positive reference substance and a negative reference substance. The nucleic acid releasing agent is composed of sodium hydroxide, Tween 20, PEG2000, Tris-HCl and water, and nucleic acid in a whole blood sample can be rapidly released. The detection method comprises the steps of nucleic acid release, freeze-drying reagent redissolution, sample adding and detection, PCR reaction program setting, result analysis and the like. The detection can be completed within 1.5 hours through the specific primer and the probe in combination with the fluorescent quantitative PCR technology. According to the invention, the operation process is simplified, the detection cost is reduced, and the detection efficiency and accuracy are improved.

Description

Technical Field

[0001] The invention belongs to the technical field of gene detection, and specifically relates to a CYP2D6 gene rapid detection kit and method. Background Art

[0002] Cytochrome P450 (CYP450) is an important class of oxidative metabolic enzymes, widely distributed in the body, and involved in the metabolism of endogenous and exogenous substances. As a member of the CYP450 family, CYP2D6 plays a key role in drug metabolism. The CYP2D6 enzyme is mainly expressed in the liver, but it is also found in other tissues such as the kidney, placenta, and brain.

[0003] The CYP2D6 gene is highly polymorphic, which leads to differences in drug metabolism between individuals, manifested as ultra-rapid metabolizers (UMs), rapid metabolizers (EMs), intermediate metabolizers (IMs) and slow metabolizers (PMs). This polymorphism of CYP2D6 enzyme activity has a significant impact on drug efficacy and safety, especially when using drugs metabolized by CYP2D6, such as antidepressants, antiarrhythmics, antipsychotics and analgesics.

[0004] Although the importance of CYP2D6 in drug metabolism has been widely recognized, existing technologies still have some limitations in CYP2D6 genotype detection and drug metabolism research, specifically:

[0005] Current CYP2D6 genotype detection methods usually require professional laboratory equipment and technicians, and the detection process is cumbersome, which is not conducive to rapid diagnosis and widespread application. The existing technology takes a long time to complete CYP2D6 genotype detection, which is not conducive to rapid medical decision-making and individualized treatment.

[0006] Therefore, it is of great significance to design a CYP2D6 gene rapid detection kit and method to solve the above problems. Summary of the invention

[0007] In order to solve the problems existing in the background technology, the present invention provides a CYP2D6 gene rapid detection kit, the entire kit is packaged in a PCR tube in a freeze-dried form, and the kit comprises:

[0008] A nucleic acid release agent, comprising sodium hydroxide, Tween20, PEG2000, Tris-HCl and water;

[0009] A CYP2D6*5 lyophilized reagent for specifically detecting the CYP2D6*5 genotype, i.e., the deletion mutation of the CYP2D6 gene, comprising specific primers and probes, hot start Taq enzyme, UNG enzyme, d(U)NTP, and lyophilization protective agent;

[0010] A CYP2D6*10 lyophilized reagent for specifically detecting the CYP2D6*10 genotype, i.e., a specific single nucleotide polymorphism of the CYP2D6 gene, comprising specific primers and probes, hot start Taq enzyme, UNG enzyme, d(U)NTP, and lyophilization protective agent;

[0011] CYP2D6*5 calibrator for correcting the difference in amplification efficiency between the CYP2D6 gene and the internal reference gene in the detection system;

[0012] Also included are CYP2D6*5 positive control, CYP2D6*10 positive control and negative control.

[0013] In a preferred embodiment, the nucleic acid releaser is used to quickly release nucleic acids in a whole blood sample, and comprises the following components:

[0014] Sodium hydroxide, concentration range 0.5-5mM;

[0015] Tween20, concentration range 0.5%-2%;

[0016] PEG2000, concentration range 1%-10%;

[0017] Tris-HCl, concentration range 2-20 mM;

[0018] And water.

[0019] In a preferred embodiment, the CYP2D6*10 lyophilized reagent comprises primers and probes for specifically detecting the CYP2D6*10 genotype, and the sequences of the primers and probes are:

[0020] CYP2D6*10 upstream primer F (5′-3′): ACCTGATGCACCGGCG;

[0021] CYP2D6*10 downstream primer R (5′-3′): TGGAAGTCCACATGCAGCAG;

[0022] CYP2D6*10 wild-type detection probe Pc (5'-3'): FAM-ACGCTACCCACCAGGCC-MGB;

[0023] CYP2D6*10 mutant detection probe Pt (5'-3'): CY5-CGCTACTCACCAGGCCC-MGB;

[0024] As well as the buffer, Mg ions, hot-start Taq enzyme, UNG enzyme and dUNTPs required for PCR reaction.

[0025] In a preferred embodiment, the CYP2D6*5 lyophilized reagent comprises primers and probes for specifically detecting the CYP2D6*5 genotype, and primers and probes for detecting the internal reference gene RPP40, and the sequences of the primers and probes are:

[0026] CYP2D6*5 upstream primer F (5′-3′): TTACCACTGACCTCACCAAGTCC;

[0027] CYP2D6*5 downstream primer R (5′-3′): GACTCTGTACCTCCTATCCACGTCA;

[0028] CYP2D6*5 probe P (5′-3′): FAM-CCAGCCTCCACCCTCTCTCCTTGC-BHQ1;

[0029] RPP40 upstream primer F (5′-3′): GATGCACTGCTGTTGAAGATGTG;

[0030] RPP40 downstream primer R (5′-3′): TGCTCTGTGAACAGTAGCTGTG;

[0031] RPP40 probe P (5′-3′): VIC-TCGGGAGACCAACCCTCTGAGACAGCT-BHQ1;

[0032] As well as the buffer, Mg ions, hot-start Taq enzyme, UNG enzyme and dUNTPs required for PCR reaction.

[0033] In a preferred embodiment, the composition of the CYP2D6*5 calibrator is a plasmid solution in which the copy number ratio of the CYP2D6 gene to the internal reference gene is 1:1.

[0034] In a preferred embodiment, the components of the CYP2D6*5 positive control include a plasmid solution in which the copy number ratio of the CYP2D6 gene to the internal reference gene is 1:2.

[0035] In a preferred embodiment, the components of the CYP2D6*10 positive control include a plasmid mixture containing CYP2D610C / CYP2D610T / internal reference genes.

[0036] In a preferred embodiment, the components of the negative control include TE buffer.

[0037] The method for detecting using the CYP2D6 gene rapid test kit comprises the following steps:

[0038] S1. Prepare a nucleic acid release agent: prepare a nucleic acid release agent comprising sodium hydroxide, Tween 20, PEG 2000, Tris-HCl and water, wherein the concentration of sodium hydroxide is in the range of 0.5-5 mM, the concentration of Tween 20 is in the range of 0.5%-2%, the concentration of PEG 2000 is in the range of 1%-10%, and the concentration of Tris-HCl is in the range of 2-20 mM;

[0039] S2. Prepare nucleic acid release sample: take 2 μl of anticoagulant whole blood sample, add it to 200 μl of nucleic acid release agent described in step a; vortex for 15-20 seconds to fully mix the sample and release agent; let it stand at room temperature for 10 minutes to fully release nucleic acid from the whole blood sample;

[0040] S3. Prepare freeze-dried reagents: provide CYP2D610 freeze-dried reagent and CYP2D65 freeze-dried reagent for CYP2D610 and CYP2D65 genotypes respectively, each freeze-dried reagent contains specific primers, probes, PCR reaction buffer, Mg ions, hot start Taq enzyme, UNG enzyme and dUNTPs, and is pre-installed in a PCR reaction tube;

[0041] S4, sample addition and detection: Take 25 μl of the nucleic acid release sample prepared in step S2, and add it to the PCR reaction tubes containing the CYP2D610 lyophilized reagent and the CYP2D65 lyophilized reagent respectively; vortex for 5-10 seconds to fully dissolve and mix the reagents; after centrifugation to remove bubbles, place the PCR reaction tubes into a fluorescent quantitative PCR instrument for detection;

[0042] S5. Set up the PCR reaction program: including the pre-denaturation stage, denaturation stage, annealing / extension stage and cycle settings. The fluorescent channel selection should include FAM, VIC and CY5 to monitor the fluorescent signals of different probes;

[0043] S6. Analyze the test results: Based on the amplification curve and Ct value output by the fluorescence quantitative PCR instrument, combined with the test results of the internal reference gene RPP40, determine the presence or absence of CYP2D610 and CYP2D65 genotypes in the sample and their specific types.

[0044] In the preferred solution, step S5 includes the following process:

[0045] Pre-denaturation stage: pre-denaturation is performed at a temperature range of 94°C to 98°C for 1 to 5 minutes, during which the template DNA is completely denatured and the hot-start Taq enzyme is activated;

[0046] Denaturation stage: In each PCR cycle, denaturation is performed at a temperature range of 94°C to 98°C for 10 to 30 seconds to denature the DNA template into a single strand to facilitate primer binding;

[0047] Annealing / extension phase: Annealing and extension are performed at a temperature range of 50°C to 70°C for a duration of 10 seconds to 2 minutes, allowing the primers to bind to the template DNA and extending the DNA chain under the action of the Taq enzyme;

[0048] Cycle setting: Repeat the above denaturation stage and annealing / extension stage for 25 to 45 cycles to achieve exponential amplification of DNA;

[0049] Fluorescence channel selection: During the PCR reaction, select FAM, VIC and CY5 fluorescence channels for monitoring to correspond to different detection probes respectively, and record and analyze the fluorescence signal changes of different probes during PCR amplification in real time.

[0050] The beneficial effects achieved by the present invention are:

[0051] The entire test kit of the present invention is packaged in PCR tubes in a freeze-dried form, which greatly facilitates the storage and transportation of the test kit, simplifies the user's operating steps, and improves the detection efficiency. The test kit integrates a nucleic acid releaser, does not require complex sample extraction and purification steps, and can directly release nucleic acids from whole blood samples, saving time and cost. The test kit contains freeze-dried reagents for specific detection of CYP2D65 genotypes and CYP2D610 genotypes, as well as calibration products, positive controls, and negative controls, providing a comprehensive detection solution. The nucleic acid releaser can quickly and effectively release nucleic acids from whole blood samples, reducing the risk of nucleic acid degradation and improving the accuracy and sensitivity of the test. By precisely controlling the concentration of each component, the optimal performance of the nucleic acid releaser is ensured, while avoiding the interference of impurities with subsequent molecular biology experiments.

[0052] The primers and probes in the CYP2D610 lyophilized reagent are highly specific and can accurately detect the CYP2D610 genotype, avoiding the occurrence of false positives and false negatives. It contains all the components required for the PCR reaction, ensuring the efficient PCR reaction and improving the reliability and repeatability of the test. The CYP2D65 lyophilized reagent can not only detect the CYP2D65 genotype, but also the internal reference gene RPP40, providing internal quality control for the experiment and ensuring the accuracy of the test results.

[0053] The present invention corrects the difference in amplification efficiency between the CYP2D6 gene and the internal reference gene in the detection system by introducing a calibration product, further improving the accuracy and reliability of the detection. The component of the CYP2D6*5 calibration product is a plasmid solution with a copy number ratio of 1:1 between the CYP2D6 gene and the internal reference gene, which can accurately correct the difference in amplification efficiency in the detection system and ensure the accuracy of the detection result. The CYP2D6*5 positive control product contains a specific ratio of the CYP2D6 gene and the internal reference gene plasmid solution, which can verify the normal working state of the detection system and improve the reliability of the detection. The CYP2D610 positive control product contains a plasmid mixture of CYP2D610C / CYP2D610T / internal reference gene, which can comprehensively cover various possible variations of the CYP2D610 genotype and improve the sensitivity and specificity of the detection. The negative control product contains TE buffer, which can verify whether there is nonspecific amplification or contamination in the detection process and ensure the accuracy of the detection result.

[0054] The detection method of the present invention simplifies the operation process through the whole blood direct amplification scheme and the pre-installed lyophilized reagent, reduces the complexity of sample processing and reagent preparation, and reduces the operation difficulty and time cost; the fluorescent quantitative PCR technology is used to achieve rapid detection within one and a half hours, thereby improving the detection efficiency; the specific primers and probes are designed, and combined with the internal reference gene monitoring, the accuracy and reliability of the detection are enhanced; the lyophilized reagent and pre-installed design reduce the contamination risk in the operation and improve the consistency and repeatability of the detection; the high degree of pertinence and practicality of the kit promotes its wide application in the Chinese population, helps to promote individualized treatment and clinical rational drug use, while the simplified operation process and efficient detection time reduce the detection cost and improve the utilization rate of medical resources; finally, the rapid and accurate CYP2D6 genotype detection provides an important basis for individualized medicine, helps doctors to formulate more accurate medication plans, improves the treatment effect and reduces adverse drug reactions. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 represents the amplification curve and Ct value of *5 calibrator in Example 2;

[0056] Figure 2 Represents the amplification curve and Ct value of *5 positive quality control product in Example 2;

[0057] Figure 3 It represents the amplification curve and Ct value of *5 negative control product in Example 2;

[0058] Figure 4 It shows the amplification curve, Ct value and genotype determination result of sample S1 in Example 2;

[0059] Figure 5The amplification curve, Ct value and genotype determination result of sample S2 in Example 2 are shown;

[0060] Figure 6 The amplification curve, Ct value and genotype determination result of sample S3 in Example 2 are shown;

[0061] Figure 7 It shows the amplification curve, Ct value and genotype determination result of *10 positive quality control products in Example 2;

[0062] Figure 8 It shows the amplification curve, Ct value and genotype determination result of *10 negative quality control products in Example 2;

[0063] Fig. 9 The amplification curve, Ct value and genotype determination result of sample S4 in Example 2 are shown;

[0064] Fig.10 The amplification curve, Ct value and genotype determination result of sample S5 in Example 2 are shown;

[0065] Fig.11 It shows the amplification curve, Ct value and genotype determination result of sample S6 in Example 2. DETAILED DESCRIPTION

[0066] The technical solution of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the present invention. In addition, the forms of the various structures recorded in the following embodiments are merely illustrative, and the present invention is not limited to the various structures recorded in the following embodiments. All other embodiments obtained by ordinary technicians in this field without making creative work belong to the scope of protection of the present invention.

[0067] First, the present invention provides a whole blood nucleic acid releaser, in particular, a whole blood nucleic acid releaser that can quickly release nucleic acids (DNA and RNA) in whole blood samples without complicated nucleic acid extraction steps, and make them suitable for downstream molecular biology detection, such as real-time fluorescence quantitative PCR. The whole blood nucleic acid releaser comprises the following components: sodium hydroxide, Tween20, PEG2000, Tris-HCl and water.

[0068] Specifically, the whole blood nucleic acid sample release agent includes the following components: 0.5-5 mM sodium hydroxide, 0.5%-2% Tween20, 1%-10% PEG2000, 2-20 mm Tris-HCl and water.

[0069] The whole blood nucleic acid sample release agent includes the following components: 25 mm NaOH, 1.5% Tween 20, 2% PEG 2000, and 10 mm Tris-HCl. This solution has the best technical effect.

[0070] The difficulties in developing the whole blood nucleic acid sample releaser are: Cell lysis efficiency: It is necessary to ensure that all cell types in the whole blood can be effectively lysed to release nucleic acids while avoiding nucleic acid degradation. Nucleic acid protection: During the lysis process, nucleic acids are susceptible to degradation by endogenous or exogenous nucleases. Therefore, it is necessary to design a formula that can protect nucleic acids from damage. Reducing interference from impurities: There are a large number of proteins, red blood cell fragments and other impurities in the blood, which may interfere with subsequent molecular biology experiments. The nucleic acid releaser needs to be able to effectively reduce the interference of these impurities. The ingredients in the nucleic acid releaser cannot inhibit downstream molecular biology experiments.

[0071] The sodium hydroxide in the nucleic acid releaser component is a strong base, and its main function in the nucleic acid releaser is to provide an alkaline environment, which helps to promote the release of nucleic acids. It can help release nucleic acids by destroying the outer protein and lipid structure of cells or viruses, and accelerate the cleavage and denaturation of impurities such as proteins. Furthermore, preferably, the glycerol in the nucleic acid releaser component can increase the viscosity of the reagent, help protect the integrity of the nucleic acid, and reduce damage during mechanical operation.

[0072] Tween 20 in the nucleic acid releaser component is a non-ionic surfactant used to enhance the permeability of cell membranes and assist in nucleic acid release.

[0073] The PEG2000 in the nucleic acid releaser component is a high molecular weight polymer, which helps to reduce the degradation of nucleic acids and improve the stability of nucleic acids.

[0074] The Tris-HCl in the nucleic acid releaser component mainly plays a role in maintaining the stability of pH value.

[0075] The present invention provides a primer and a probe for specifically detecting the genotype of CYP2D6*10. The detection principle is: according to the sequence of the polymorphic gene site, specific wild-type and mutant probes are designed respectively. When the probe and its corresponding allele are completely matched, the probe and the template can be combined, and the corresponding fluorescent signal is generated after hydrolysis. The detection of different genotypes is achieved by judging the amplification curve and the Ct value. At the same time, the internal reference gene RPP40 is detected as a monitoring of the normal operation of the entire reaction system.

[0076] The primer and probe sequences for CYP2D6*10 are:

[0077] CYP2D6*10F 5'-3':ACCTGATGCACCGGCG

[0078] CYP2D6*10R 5'-3':TGGAAGTCCACATGCAGCAG

[0079] CYP2D6*10Pc 5'-3': FAM-ACGCTACCCACCAGGCC-MGB

[0080] CYP2D6*10Pt 5'-3':CY5-CGCTACTCACCAGGCCC-MGB

[0081] The primer and probe sequences for the internal reference gene RPP40 are:

[0082] RPP40F 5'-3': GATGCACTGCTGTTGAAGATGTG

[0083] RPP40R 5'-3':TGCTCTGTGAACAGTAGCTGTG

[0084] RPP40P 5'-3': VIC-TCGGGAGACACAACCCTCTGAGACAGCT-BHQ1

[0085] The present invention also provides a primer and probe for specific detection of CYP2D6*5 genotype, and the detection principle is: specific primers and probes are designed for CYP2D6 gene and internal reference gene (copy number is determined, no variation exists), and the difference between the Ct value of CYP2D6 gene and the Ct value of internal reference gene is calculated to determine whether the CYP2D6 gene has a deletion mutation. In order to reduce the difference in amplification efficiency of two different genes, the difference caused by the threshold line delineation, and the influence of the operation difference of different instruments and the difference between different operations of the same instrument on the Ct value, the kit also introduces a calibration product with a constant ratio of CYP2D6 to the internal reference gene copy number of 1:1, and the Ct value difference of the test sample is corrected to ensure the accuracy of the detection.

[0086] The primer and probe sequences for the CYP2D6 gene are:

[0087] CYP2D6*5F 5'-3':TTACCACTGACCTCACCAAGTCC

[0088] CYP2D6*5R 5'-3': GACTCTGTACCTCCTATCCACGTCA

[0089] CYP2D6*5P 5'-3': FAM-CCAGCCTCCACCCTCTCTCCTTGC-BHQ1

[0090] The single-copy gene RPP40 was selected as the internal reference gene, and its primer and probe sequences were:

[0091] RPP40F 5'-3': GATGCACTGCTGTTGAAGATGTG

[0092] RPP40R 5'-3':TGCTCTGTGAACAGTAGCTGTG

[0093] RPP40P 5'-3': VIC-TCGGGAGACACAACCCTCTGAGACAGCT-BHQ1

[0094] In the present invention, the detection of CYP2D6*10 and CYP2D6*5 is carried out in two different systems, respectively. The detection system of CYP2D6*10 includes the primers and probes of CYP2D6*10, the primers and probes of the internal reference gene RPP40, PCR reaction buffer, Mg ions, hot start Taq enzyme, UNG enzyme, dUNTPs, lyophilization protective agent, etc. The detection system of CYP2D6*5 includes the primers and probes of CYP2D6*5, the primers and probes of the internal reference gene RPP40, PCR reaction buffer, Mg ions, hot start Taq enzyme, UNG enzyme, dUNTPs, lyophilization protective agent, etc.

[0095] The structural composition of the kit of the present invention is shown in Table 1.

[0096] Table 1 Structure and composition of the kit

[0097] Component name Main ingredients Nucleic acid release agent Sodium hydroxide, Tween20, PEG2000, sodium chloride, etc. CYP2D6*5 Lyophilized Reagent Specific primers and probes, hot start taq enzyme, UNG enzyme, d(U)NTP, etc. CYP2D6*10 Lyophilized Reagent Specific primers and probes, hot start taq enzyme, UNG enzyme, d(U)NTP, etc. CYP2D6*5 Calibrator Plasmid solution with a 1:1 ratio of CYP2D6 gene to internal reference gene copy number CYP2D6*5 positive control Plasmid solution with a copy number ratio of CYP2D6 gene to internal reference gene of 1:2 CYP2D6*10 positive control Plasmid mixture containing CYP2D6*10C / CYP2D6*10T / reference gene Negative Control TE buffer

[0098] The method of using the present invention has simple operation steps, which are specifically described as follows:

[0099] Each reaction system is packaged in PCR tubes in a freeze-dried form and can be taken out when needed, saving users the tedious reagent preparation and packaging process.

[0100] Preparation process of nucleic acid release sample: Take 2ul anticoagulant whole blood sample and add it to 200ul whole blood nucleic acid release agent, vortex for 15-20s, and let it stand at room temperature for 10 minutes.

[0101] Sample addition process: Add 25ul of the above nucleic acid release sample to each freeze-dried PCR tube. The reagent reconstitution and sample addition process are completed in one step. Vortex and shake for 5-10s to fully dissolve and mix the reagent. Centrifuge to remove bubbles and then test on the machine.

[0102] The entire reagent preparation, sample processing and machine testing can be completed within 1.5 hours.

[0103] In a sixth aspect, the method for determining the detection result of the detection scheme of the present invention is as follows:

[0104] Test kit validity determination:

[0105] CYP2D6*5 calibrator: Ct values ​​of FAM and VIC channels are ≤35, and the amplification curve has an obvious exponential growth period.

[0106] CYP2D6*5 positive control: Ct values ​​of FAM and VIC channels are ≤35, and the amplification curve has an obvious exponential growth period.

[0107] CYP2D6*10 positive control: Ct values ​​of FAM, VIC, and CY5 channels are ≤35, and the amplification curve has an obvious exponential growth period.

[0108] 3) Negative control: There is no amplification curve in the FAM, VIC, and CY5 channels, or the amplification curve is a straight line or a slightly oblique line, with no obvious exponential growth period, no Ct value, or a Ct value ≥ 38.

[0109] 2. Determination of sample validity:

[0110] 1) Internal reference gene: The Ct value of the VIC channel in all samples tested was ≤35, and the amplification curve had an obvious exponential growth period.

[0111] 3. Determination of test results: Determine the sample test results by referring to Table 2 and Table 3 to determine the sample gene polymorphism.

[0112] Table 2 Test results comparison table 1

[0113]

[0114] Note: The calculation method of △△Ct is:

[0115] △△Ct=(△Ct sample FAM-△Ct sample VIC)-(△Ct correction FAM-△Ct correction VIC).

[0116] Table 3 Test results comparison table 2

[0117]

[0118]

[0119] Example 1, preparation of the kit: Design of primers and probes: Based on the CYP2D6 sequence information published in the NCBI database, primers and probes for specific detection of the CYP2D6 gene are designed to detect whether there is a CYP2D6 gene deletion in the nucleic acid sample, that is, the CYP2D6*5 genotype. After screening, optimization, and a large number of experimental verifications, the primer and probe sequences are as follows:

[0120] Primer and probe sequences for detecting the presence of the CYP2D6*5 genotype, i.e., CYP2D6 gene deletion:

[0121] (1) CYP2D6*5 upstream primer F (5'-3'): TTACCACTGACCTCACCAAGTCC

[0122] (2) CYP2D6*5 downstream primer R (5'-3'): GACTCTGTACCTCCTATCCACGTCA

[0123] (3) CYP2D6*5 probe P (5'-3'): FAM-CCAGCCTCCACCCTCTCTCCTTGC-BHQ1

[0124] According to the sequence information of CYP2D6*10 published in the NCBIdbSNP database (https: / / www.ncbi.nlm.nih.gov / SNP / ), the detection primers and probes of the polymorphic sites were designed. After screening, optimization, and a large number of experimental verifications, the primer and probe sequences were obtained as follows:

[0125] Primer and probe sequences for CYP2D6*10SNP site gene polymorphism detection:

[0126] (1) CYP2D6*10 upstream primer F (5'-3'): ACCTGATGCACCGGCG

[0127] (2) CYP2D6*10 downstream primer R (5'-3'): TGGAAGTCCACATGCAGCAG

[0128] (3) CYP2D6*10 wild-type detection probe Pc (5'-3'): FAM-ACGCTACCCACCAGGCC-MGB

[0129] (4) CYP2D6*10 mutant detection probe Pt (5'-3'): CY5-CGCTACTCACCAGGCCC-MGB

[0130] According to the RPP40 sequence information published in the NCBI database (https: / / www.ncbi.nlm.nih.gov / gene / ), primers and probes for specific detection of the RPP40 gene were designed. As an internal reference gene, it is used to perform internal quality control of the PCR reaction system and experimental operation process, and to detect the quality of the sample to avoid missing the test sample. After screening, optimization, and a large number of experimental verifications, the primer and probe sequences were obtained as follows:

[0131] RPP40 upstream primer F (5'-3'): GATGCACTGCTGTTGAAGATGTG

[0132] RPP40 downstream primer R (5'-3'): TGCTCTGTGAACAGTAGCTGTG

[0133] (3) RPP40 probe P (5'-3'): VIC-TCGGGAGACCAACCCTCTGAGACAGCT-BHQ1

[0134] 2. Preparation of the kit:

[0135] The kit includes the following components: primer probes of each gene and internal reference gene designed in the previous step, PCR reaction buffer, Mg ions, hot start Taq enzyme, UNG enzyme, dUNTPs, lyophilization protective agent, etc. In addition, it also includes: calibration products, positive control products and negative controls.

[0136] The positive control of CYP2D6*5 is a plasmid solution with a copy number ratio of 1:2 between the CYP2D6*5 gene and the internal reference gene; the CYP2D6*5 calibrator is a plasmid solution with a copy number ratio of 1:1 between the CYP2D6 gene and the internal reference gene. The negative control is TE buffer.

[0137] 3. Preparation of lyophilized reagents:

[0138] (1) Preparation of freeze-dried reagents

[0139] The formula of 2× lyophilized protective agent is trehalose 6%, hydroxypropyl β-cyclodextrin 2%, dextran 1%, and 0.02% carrageenan.

[0140] (2) Freeze-drying process

[0141] Pre-freezing stage, primary drying stage and secondary drying stage.

[0142] During the pre-freezing stage, the temperature was maintained at -40°C for 2 hours.

[0143] In the primary drying stage, the vacuum was evacuated to 5 Pa and maintained for 5 hours. The internal temperature of the freeze dryer was adjusted to -25 °C and maintained for 1 hour, and then adjusted to -5 °C and maintained for 1 hour.

[0144] In the secondary drying stage, the vacuum is evacuated to 5 Pa, and the temperature of the layer is raised to 25-35 ° C and maintained for 5 hours.

[0145] 4. Method of using the kit: including the following steps:

[0146] (1) Take 2ul of each whole blood sample, calibrator, positive control, and negative control and add them to 200ul of nucleic acid releaser. Vortex for 15-20s and let stand at room temperature for 10 minutes.

[0147] (2) After the release, take 25ul of the *5 test sample and *5 calibration product, *5 positive quality control product, and negative quality control product and add them to the CYP2D6*5 lyophilized reagent. After the release, take 25ul of the *10 test sample and *10 positive quality control product and negative quality control product and add them to the CYP2D6*10 lyophilized reagent. Vortex for 5-10s to fully dissolve and mix the reagents, centrifuge to remove bubbles, and load onto the machine.

[0148] Instrument model: ABI7500; reaction program: 95℃2min; 95℃10s; 62℃31s; number of reaction cycles: 45; fluorescence channel selection: FAM, VIC and CY5.

[0149] (3) The test result determination method is as follows:

[0150] A. Determination of the effectiveness of the kit:

[0151] CYP2D6*5 calibrator: Ct values ​​of FAM and VIC channels are ≤35, and the amplification curve has an obvious exponential growth period.

[0152] CYP2D6*5 positive control: Ct values ​​of FAM and VIC channels are ≤35, and the amplification curve has an obvious exponential growth period.

[0153] CYP2D6*10 positive control: Ct values ​​of FAM, VIC, and CY5 channels are ≤35, and the amplification curve has an obvious exponential growth period.

[0154] Negative control: There is no amplification curve in the FAM, VIC, and CY5 channels, or the amplification curve is a straight line or a slightly oblique line, with no obvious exponential growth period, no Ct value, or a Ct value ≥ 38.

[0155] B. Determination of sample validity:

[0156] 1) Internal reference gene: The Ct value of the VIC channel in all samples tested was ≤35, and the amplification curve had an obvious exponential growth period.

[0157] C. Determination of test results:

[0158] The sample test results were judged by referring to Table 2 and Table 3 to determine the sample gene polymorphism.

[0159] Example 2, sample detection:

[0160] 1. Experimental samples: The experimental sample type is EDTA anticoagulated venous whole blood;

[0161] 2. Experimental method: Detection was performed according to the method in Example 1;

[0162] 3. Experimental results and analysis:

[0163] Six anticoagulated whole blood samples were sequenced by Sanger sequencing, and the genotypes are shown in Table 4 ;

[0164] Table 4 Sanger sequencing results of anticoagulated whole blood samples

[0165] Sample name Sample Type genotype Identification methods S1 Anticoagulated whole blood CYP2D6 non-deletion Sanger sequencing S2 Anticoagulated whole blood *5 Heterozygous (CYP2D6 haploid deletion type) Sanger sequencing S3 Anticoagulated whole blood *5 Homozygous (CYP2D6 complete deficiency) Sanger sequencing S4 Anticoagulated whole blood CYP2D6*10C / C (wild type) Sanger sequencing S5 Anticoagulated whole blood CYP2D6*10C / T (heterozygous) Sanger sequencing S6 Anticoagulated whole blood CYP2D6*10T / T (homozygous mutant) Sanger sequencing

[0166] (1)*5 The amplification curve and Ct value of the calibration product are as follows Figure 1 As shown;

[0167] (2)*5 The amplification curve and Ct value of the positive control product are as follows Figure 2 As shown;

[0168] (3)*5 The amplification curve and Ct value of the negative control product are as follows Figure 3 As shown;

[0169] (4) Amplification curve, Ct value and genotype determination of sample S1 are as follows Figure 4 As shown in the table;

[0170] (5) Amplification curve, Ct value and genotype determination of sample S2 are as follows Figure 5 As shown in the table;

[0171] (6) Amplification curve, Ct value and genotype determination of sample S3 are as follows Figure 6 As shown;

[0172] (7) Amplification curve, Ct value and genotype determination of *10 positive quality control products Figure 7 As shown;

[0173] (8)*10 Amplification curves, Ct values ​​and genotype determination of negative control products Figure 8 As shown;

[0174] (9) Amplification curve, Ct value and genotype determination of sample S4 are as follows Fig. 9 As shown;

[0175] (10) Amplification curve, Ct value and genotype determination of sample S5 are as follows Fig.10 As shown;

[0176] (11) Amplification curve, Ct value and genotype determination of sample S6 are as follows Fig.11 As shown;

[0177] Example 3, optimization of nucleic acid sample release agent;

[0178] 1. This experiment evaluates the performance of 4 different nucleic acid sample release agent formulations, the formulations are shown in Table 5;

[0179] Table 5 Performance evaluation of four different nucleic acid sample release agent formulations

[0180]

[0181]

[0182] Using 1 *5 heterozygous whole blood sample and 1 *10 heterozygous whole blood sample, and using lyophilized reagent *5 and lyophilized reagent *10 respectively, the performance of the above 4 release agent formulations was evaluated. The detection method was the same as the above embodiment, and each test was performed in parallel 3 times. The experimental results are shown in Table 6:

[0183] Table 6 Performance evaluation of four release agent formulations

[0184]

[0185] Experimental conclusion: Based on the above experimental results, formula 4 is the best choice for performance.

[0186] Compare the blood direct amplification method of the present invention with the traditional nucleic acid extraction method;

[0187] Sample preparation:

[0188] The whole blood samples showed CYP2D6*5 wild type, heterozygous deletion and homozygous deletion genotypes.

[0189] There were 1 whole blood sample each with the wild type, heterozygous mutation, and homozygous mutation genotype of CYP2D6*10.

[0190] The genotypes of a total of 6 whole blood samples are detailed in Table 7 below;

[0191] Table 7 Genotype list of 6 whole blood samples

[0192]

[0193] Sample processing

[0194] Direct amplification group: 2ul whole blood sample was added to 200ul nucleic acid releaser, vortexed for 15-20s, and allowed to stand at room temperature for 10 minutes.

[0195] Nucleic acid extraction group: Genomic DNA of whole blood samples was extracted according to the whole blood genomic nucleic acid extraction kit (manufacturer: Beijing Quanshijin Biotechnology Co., Ltd., catalog number: EE121).

[0196] Sample addition method

[0197] Direct amplification group: Take 25ul of the released sample and add it directly into the freeze-dried reagent, vortex and oscillate for 5-10S to mix the reagent thoroughly, centrifuge to remove bubbles, and wait for loading on the machine.

[0198] Nuclear extraction group: First add 23ul of deionized water to each freeze-dried reagent test tube, then add 2ul of nucleic acid to extract genomic DNA. Vortex for 5-10S to mix the reagents thoroughly, centrifuge to remove bubbles, and wait for loading.

[0199] The on-machine detection method is the same as the above embodiment, and each detection is performed 3 times in parallel.

[0200] Experimental results:

[0201] Table 8 Experimental results Table 1

[0202]

[0203]

[0204] Table 9 Experimental results Table 2

[0205]

[0206] Experimental conclusion: Compared with the traditional nucleic acid extraction method, the whole blood sample nucleic acid extraction-free method adopted in the present invention has no significant difference in Ct value, and the genotype judgment is consistent. It can completely replace the nucleic acid extraction method, significantly reduce the detection time, and save detection costs.

[0207] Example 4, comparison of the effects of primer and probe sets;

[0208] 1. Experimental plan:

[0209] This experiment provides kits of Comparative Example 1 and Comparative Example 2. The difference between these two kits and the kit of Example 1 is that different primer-probe compositions are used, as shown in Table 1. The fluorescent probes on each primer probe of each control group refer to Example 1 for comparative analysis, and the preparation method of the kit is the same as that of the aforementioned example.

[0210] Table 10 Primer probe list of control group

[0211]

[0212] The kit prepared in Example 1 of the present application, the kit prepared in control group 1 and the kit prepared in control group 2 were respectively used to conduct experiments on the same sample, and the experimental effects of each kit were compared.

[0213] 2. Sample preparation:

[0214] The whole blood samples showed CYP2D6*5 wild type, heterozygous deletion and homozygous deletion genotypes.

[0215] There were 1 whole blood sample each with the wild type, heterozygous mutation, and homozygous mutation genotype of CYP2D6*10.

[0216] Table 11 Genotype list of 6 whole blood samples

[0217]

[0218] 3. Experimental methods:

[0219] Same as the above embodiment.

[0220] Experimental results and analysis:

[0221] Table 12 Experimental results and analysis Table 1

[0222]

[0223]

[0224] Table 13 Experimental results and analysis Table 2

[0225]

[0226] The comparative experimental results show that the primer-probe combination disclosed in the kit of the present invention has a more advanced Ct value and is significantly better than the primer-probe combination provided in Comparative Examples 1 and 2 in terms of performance.

[0227] Example 5, comparison of different detection methods:

[0228] In this example, the kit of the invention was used to perform typing and identification on 48 clinical whole blood samples, and Sanger sequencing was used as the gold standard method to evaluate the conformity rate of the kit.

[0229] Experimental methods:

[0230] Fluorescence quantitative PCR method: the same as the above example.

[0231] Sanger sequencing method: Nucleic acid was extracted from whole blood samples (extraction kit manufacturer: Beijing Quanshijin Biotechnology Co., Ltd., catalog number: EE121). After amplification with sequencing primers, Sanger sequencing was performed by Shanghai Bioengineering to identify the genotype.

[0232] Table 14 Experimental results

[0233]

[0234]

[0235]

[0236] Result analysis: The qPCR test results of this kit were 100% consistent with the Sanger sequencing test results.

[0237] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A CYP2D6 gene rapid test kit, characterized in that: The entire kit is packaged in PCR tubes in a lyophilized form and contains: A nucleic acid release agent, comprising sodium hydroxide, Tween20, PEG2000, Tris-HCl and water; A CYP2D6*5 lyophilized reagent for specifically detecting the CYP2D6*5 genotype, i.e., the deletion mutation of the CYP2D6 gene, comprising specific primers and probes, hot start Taq enzyme, UNG enzyme, d(U)NTP, and lyophilization protective agent; A CYP2D6*10 lyophilized reagent for specifically detecting the CYP2D6*10 genotype, i.e., a specific single nucleotide polymorphism of the CYP2D6 gene, comprising specific primers and probes, hot start Taq enzyme, UNG enzyme, d(U)NTP, and lyophilization protective agent; CYP2D6*5 calibrator for correcting the difference in amplification efficiency between the CYP2D6 gene and the internal reference gene in the detection system; Also included are CYP2D6*5 positive control, CYP2D6*10 positive control and negative control.

2. The CYP2D6 gene rapid detection kit according to claim 1, characterized in that: Nucleic acid release agent contains the following ingredients: Sodium hydroxide, concentration range 0.5-5mM; Tween20, concentration range 0.5%-2%; PEG2000, concentration range 1%-10%; Tris-HCl, concentration range 2-20 mM; And water.

3. The CYP2D6 gene rapid detection kit according to claim 1, characterized in that: CYP2D6*10 lyophilized reagent, comprising primers and probes for specific detection of CYP2D6*10 genotype, the sequences of the primers and probes are: CYP2D6*10 upstream primer F (5′-3′): ACCTGATGCACCGGCG; CYP2D6*10 downstream primer R (5′-3′): TGGAAGTCCACATGCAGCAG; CYP2D6*10 wild-type detection probe Pc (5'-3'): FAM-ACGCTACCCACCAGGCC-MGB; CYP2D6*10 mutant detection probe Pt (5'-3'): CY5-CGCTACTCACCAGGCCC-MGB; As well as the buffer, Mg ions, hot-start Taq enzyme, UNG enzyme and dUNTPs required for PCR reaction.

4. The CYP2D6 gene rapid detection kit according to claim 1, characterized in that: The CYP2D6*5 lyophilized reagent comprises primers and probes for specifically detecting the CYP2D6*5 genotype, and primers and probes for detecting the internal reference gene RPP40, wherein the sequences of the primers and probes are: CYP2D6*5 upstream primer F (5′-3′): TTACCACTGACCTCACCAAGTCC; CYP2D6*5 downstream primer R (5′-3′): GACTCTGTACCTCCTATCCACGTCA; CYP2D6*5 probe P (5′-3′): FAM-CCAGCCTCCACCCTCTCTCCTTGC-BHQ1; RPP40 upstream primer F (5′-3′): GATGCACTGCTGTTGAAGATGTG; RPP40 downstream primer R (5′-3′): TGCTCTGTGAACAGTAGCTGTG; RPP40 probe P (5′-3′): VIC-TCGGGAGACCAACCCTCTGAGACAGCT-BHQ1; As well as the buffer, Mg ions, hot-start Taq enzyme, UNG enzyme and dUNTPs required for PCR reaction.

5. The CYP2D6 gene rapid detection kit according to claim 1, characterized in that: The composition of the CYP2D6*5 calibrator is a plasmid solution with a 1:1 copy number ratio of the CYP2D6 gene to the internal reference gene.

6. The CYP2D6 gene rapid detection kit according to claim 1, characterized in that: The composition of the CYP2D6*5 positive control includes a plasmid solution with a copy number ratio of CYP2D6 gene to internal reference gene of 1:

2.

7. The CYP2D6 gene rapid detection kit according to claim 1, characterized in that: The composition of the CYP2D6*10 positive control includes a plasmid mixture containing CYP2D610C / CYP2D610T / internal reference genes.

8. The CYP2D6 gene rapid detection kit according to claim 1, characterized in that: The negative control consists of TE buffer.

9. A method for detecting using the CYP2D6 gene rapid detection kit according to any one of claims 1 to 8, characterized in that: It includes the following steps: S1. Prepare a nucleic acid release agent: prepare a nucleic acid release agent comprising sodium hydroxide, Tween 20, PEG 2000, Tris-HCl and water, wherein the concentration of sodium hydroxide is in the range of 0.5-5 mM, the concentration of Tween 20 is in the range of 0.5%-2%, the concentration of PEG 2000 is in the range of 1%-10%, and the concentration of Tris-HCl is in the range of 2-20 mM; S2. Prepare nucleic acid release sample: take 2 μl of anticoagulant whole blood sample, add it to 200 μl of nucleic acid release agent described in step a; vortex for 15-20 seconds to fully mix the sample and release agent; let it stand at room temperature for 10 minutes to fully release nucleic acid from the whole blood sample; S3. Prepare freeze-dried reagents: provide CYP2D610 freeze-dried reagent and CYP2D65 freeze-dried reagent for CYP2D610 and CYP2D65 genotypes respectively, each freeze-dried reagent contains specific primers, probes, PCR reaction buffer, Mg ions, hot start Taq enzyme, UNG enzyme and dUNTPs, and is pre-installed in a PCR reaction tube; S4, sample addition and detection: Take 25 μl of the nucleic acid release sample prepared in step S2, and add it to the PCR reaction tubes containing the CYP2D610 lyophilized reagent and the CYP2D65 lyophilized reagent respectively; vortex for 5-10 seconds to fully dissolve and mix the reagents; after centrifugation to remove bubbles, place the PCR reaction tubes into a fluorescent quantitative PCR instrument for detection; S5. Set up the PCR reaction program: including the pre-denaturation stage, denaturation stage, annealing / extension stage and cycle settings. The fluorescent channel selection should include FAM, VIC and CY5 to monitor the fluorescent signals of different probes; S6. Analyze the test results: Based on the amplification curve and Ct value output by the fluorescence quantitative PCR instrument, combined with the test results of the internal reference gene RPP40, determine the presence or absence of CYP2D610 and CYP2D65 genotypes in the sample and their specific types.

10. The method according to claim 8, characterized in that In step S5, The process includes: Pre-denaturation stage: pre-denaturation is performed at a temperature range of 94°C to 98°C for 1 to 5 minutes, during which the template DNA is completely denatured and the hot-start Taq enzyme is activated; Denaturation stage: In each PCR cycle, denaturation is performed at a temperature range of 94°C to 98°C for 10 to 30 seconds to denature the DNA template into a single strand to facilitate primer binding; Annealing / extension phase: Annealing and extension are performed at a temperature range of 50°C to 70°C for a duration of 10 seconds to 2 minutes, allowing the primers to bind to the template DNA and extending the DNA chain under the action of the Taq enzyme; Cycle setting: Repeat the above denaturation stage and annealing / extension stage for 25 to 45 cycles to achieve exponential amplification of DNA; Fluorescence channel selection: During the PCR reaction, select FAM, VIC and CY5 fluorescence channels for monitoring to correspond to different detection probes respectively, and record and analyze the fluorescence signal changes of different probes during PCR amplification in real time.

Images