InDel molecular marker for detecting radish clubroot resistance as well as acquisition method and application of InDel molecular marker

Abstract

The invention discloses an InDel molecular marker for detecting radish clubroot resistance as well as an acquisition method and application thereof, and belongs to the technical field of molecular breeding. The invention discloses an anti-clubroot QTL (quantitative trait locus) RsCr5g. 1 located in a radish chromosome 5, the maximum LOD (limit of death) value of the anti-clubroot QTL reaches 66.94, and the credibility is high; the disease-resistant QTL locus has high contribution rate to clubroot resistance, can explain 64.3% of phenotypic variation, and has high utilization value in radish clubroot-resistant breeding. The genetic distance between the molecular marker GZ012 disclosed by the invention and the clubroot-resistant QTL site RsCr5g. 1 is only 0.36 cM, the molecular marker GZ012 and the clubroot-resistant QTL site RsCr5g. 1 are closely linked, and the marker GZ012 is used for carrying out clubroot-resistant molecular marker-assisted selection, so that the accuracy of disease resistance prediction is high, the efficient and accurate development of disease-resistant molecular breeding is facilitated, and the molecular marker GZ012 has important significance in the prevention and control research of radish clubroot.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular breeding, and in particular relates to an InDel molecular marker for detecting radish clubroot resistance, and an acquisition method and application thereof. Background Art

[0002] Clubroot is a serious threat to the cruciferous vegetable industry, and breeding disease-resistant varieties is the core means of preventing and controlling clubroot. Clubroot is a worldwide soil-borne disease caused by Plasmodiophora brassicae Woron. It is a specialized parasite of cruciferous plants. The disease is extremely stubborn. Once infected, the pathogen can harm cruciferous crops for a long time, reducing crop yields by up to 10-15%, and in severe cases, losses of up to 60% or even total crop failure. At present, the incidence of radish clubroot is becoming more and more serious, and the prevention and control of radish clubroot is urgent.

[0003] The means of prevention and control of clubroot are generally crop rotation, the use of chemical agents or biological agents, etc. Although these measures have played a role in preventing and controlling clubroot to a certain extent, they still cannot fundamentally solve the serious problems faced by cruciferous crops in cultivation. In addition, chemical control has high costs and serious soil pollution, and biological control is not ideal. Disease-resistant breeding has the advantages of being economical, pollution-free, safe and efficient, and is the best method for preventing and controlling clubroot.

[0004] The first prerequisite for disease-resistant breeding is to discover disease-resistant genes or loci, and then to achieve rapid and accurate transfer of resistance through molecular markers. There has been some progress in the genetic research of radish resistance to clubroot, and 6 major QTL loci have been reported, which are relatively concentrated on chromosomes 8 and 9 of radish, but the specific clubroot resistance gene has not yet been precisely located. Due to the diversity and rapid variation of the physiological subspecies of root-root fungi, it is necessary to explore more disease-resistant genes in order to cultivate new radish varieties with strong resistance, broad spectrum and sustained stability. Therefore, targeted QTL positioning of the clubroot resistance of the radish inbred line Wr30 and the development of molecular markers will play an important role in promoting radish breeding for clubroot resistance, which is of great significance to the prevention and control of radish clubroot and the development of related industries. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide an InDel molecular marker for detecting radish clubroot disease resistance and an acquisition method and application thereof, so as to solve the technical problem of inaccurate prediction of radish clubroot disease resistance.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is: to provide an InDel molecular marker for detecting radish clubroot resistance, the QTL site of radish clubroot resistance is RsCr5g.1, and the RsCr5g.1 is located in the 5th linkage group of radish, and the physical position is 35826907-49559736bp.

[0007] On the basis of the above technical solution, the present invention can also be improved as follows:

[0008] Furthermore, the InDel molecule was labeled as GZ012.

[0009] Furthermore, the front primer sequence of the InDel molecular marker is SEQ ID NO.1, and the rear primer sequence is SEQ ID NO.2.

[0010] Furthermore, the InDel molecular marker was located on chromosome 5 of radish, with a physical position of 48554971-48556155 bp.

[0011] The present invention also discloses a method for obtaining an InDel molecular marker for detecting radish clubroot resistance, comprising the following steps:

[0012] S1, deriving F2 population from parental hybridization and constructing genetic population;

[0013] S2, identification of the clubroot resistance phenotype of the genetic population;

[0014] S3, extracting DNA from the genetic population for genome sequencing, subjecting the sequencing data to quality control, data filtering, comparison with the reference genome and polymorphism screening between parents to obtain SNP sites, and constructing a genetic map;

[0015] S4. QTL analysis of radish resistance to clubroot based on genetic map;

[0016] S5. Development and screening of InDel molecular markers.

[0017] On the basis of the above technical solution, the present invention can also be improved as follows:

[0018] Furthermore, the female parent in S1 is the disease-resistant material Wr30, and the male parent is the disease-susceptible material Rc19-92A2.

[0019] The radish inbred line Wr30 originated from the Chongqing local variety "Bai Fen Tuan". In 2011, germplasm resources were collected in Chongqing, and single plants were selected for self-pollination and seed preservation. Then, an excellent inbred line was bred through pedigree method. The inbred line has stable traits, round fleshy roots, white skin and white flesh. Wr30 is an inbred line with medium and high resistance to clubroot disease in round white radish. It has strong disease resistance and is very stable. Phenotypic observations have been carried out in Chongqing, Sichuan and other epidemic areas for many years, and they are all immune to local clubroot disease. Therefore, using Wr30 as a disease-resistant resource, exploring its clubroot disease resistance loci through QTL and other means, and screening closely linked molecular markers can not only provide a reliable source of resistance for radish material creation, resistance transfer and other disease-resistant breeding work, but also provide the accuracy and breeding efficiency of disease-resistant breeding through molecular marker-assisted selection technology, thereby greatly improving the disease-resistant breeding ability of radish.

[0020] The radish inbred line Rc19-92A2 originated from the local variety "Chuanxin Red Radish" in Zaozhuang, Shandong. Germplasm resources were collected in Zaozhuang, Shandong in 2018, and single plants were selected for self-pollination and seed preservation, and then the excellent inbred line was bred through pedigree method. The inbred line has stable traits, long stick-shaped flesh, dark red skin and white flesh. Rc19-92A2 is highly susceptible to clubroot in the clubroot epidemic areas of Chongqing and Sichuan.

[0021] Furthermore, during S3 sequencing, the average information collection depth of F2 offspring was 11.82X, and the average information collection volume was ≥5Gb; the parental resequencing depth was 31.66X, and the information collection volume was ≥16Gb.

[0022] Furthermore, data filtering in S3 is specifically as follows: filtering out marker sites with missing values ​​in the parents, filtering out marker sites with sample genotype missing rates > 50%, or filtering out genotype sites with skewed segregation in the offspring.

[0023] Furthermore, S3 filtered out the genotype sites with skewed segregation in the offspring by screening the chi-square test with a significance level of P < 0.001.

[0024] Furthermore, S4 is specifically as follows: performing QTL positioning and effect detection on the clubroot resistance phenotype of the genetic population obtained in S2, and when the LOD value is greater than 5.59, it is used as a basis for the existence of a QTL for the clubroot resistance trait.

[0025] The invention also discloses the application of an InDel molecular marker for detecting radish clubroot resistance in detecting radish clubroot resistance or radish molecular marker-assisted breeding.

[0026] The beneficial effects of the present invention are:

[0027] 1. The present invention discloses a QTL locus RsCr5g.1 for resistance to clubroot disease located on chromosome 5 of radish. The LOD value of the QTL locus for resistance to clubroot disease is greater than 5.59, with a maximum value of 66.94, and a high degree of credibility. The QTL locus for resistance to clubroot disease has a high contribution rate and can explain 64.3% of the phenotypic variation. The QTL locus has a high utilization value in breeding radish for resistance to clubroot disease.

[0028] 2. The present invention discloses a molecular marker GZ012 of the QTL site RsCr5g.1 of the clubroot disease resistance of the radish inbred line WR30. The marker is an InDel-type co-dominant molecular marker, which can accurately distinguish genotypes such as disease-resistant homozygous, disease-resistant heterozygous and disease-susceptible homozygous. The genotypes can be distinguished by agarose gel electrophoresis. The detection is convenient and fast, the method is simple, and the amplification results are stable.

[0029] 3. The genetic distance between the molecular marker GZ012 disclosed in the present invention and the clubroot resistance QTL site RsCr5g.1 is only 0.36 cM, and the two are closely linked. The use of marker GZ012 to carry out molecular marker-assisted selection for clubroot resistance has high accuracy in disease resistance prediction, which is conducive to the efficient and accurate development of disease-resistant molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is a physical picture of the radish inbred lines Wr30 and Rc19-92A2 at the early stage (15 days) after inoculation;

[0031] Figure 2 This is a physical picture of the radish inbred lines Wr30 and Rc19-92A2 at the late stage (28 days) after inoculation;

[0032] Figure 3 constructing processes for separating groups;

[0033] Figure 4 The results of identification of clubroot resistance of some F2 progeny;

[0034] Figure 5 It is the SNP genetic map;

[0035] Figure 6 The QTL mapping result of radish Wr30 resistance to clubroot disease;

[0036] Figure 7 Results for molecular marker development for clubroot resistance;

[0037] Figure 8 is the amplification effect of molecular marker GZ012 in the F2 segregating population;

[0038] Fig. 9 This is the amplification effect of the molecular marker GZ012 in the Rr64BC1 resistance-transfected population. DETAILED DESCRIPTION

[0039] The specific embodiments of the present invention are described below to facilitate the understanding of the present invention by those skilled in the art. If the specific conditions are not specified in the examples, the methods are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturers are not specified in the reagents or instruments used, they are all conventional products that can be purchased commercially. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention defined and determined by the attached claims, these changes are obvious, and all inventions and creations using the concept of the present invention are protected.

[0040] Example 1 Development of molecular markers tightly linked to the clubroot resistance QTL locus RsCr5g.1

[0041] A method for obtaining an InDel molecular marker for detecting radish clubroot resistance comprises the following steps:

[0042] S1. Use parental hybridization to derive the F2 population and construct a genetic population, specifically:

[0043] S101. Identify the clubroot resistance phenotype of the parents: Seeds with full grains were selected, and 20 seeds from each of the two lines (the female parent was the inbred line Wr30 that had been self-pollinated for 8 consecutive generations and was immune to clubroot, and the male parent was the inbred line Rc19-92A2 that had been self-pollinated for 8 consecutive generations and was highly susceptible to clubroot) were sown in floating trays (50 holes) filled with seedling medium. After absorbing water and germinating for 7 days, root knot fungi were inoculated at an effective spore concentration of 10 8 / g, and the root disease was observed 15d and 28d after inoculation. Figure 1 As shown in the figure, both parents, Wr30 and Rc19-92A2, were able to grow normally before and at the early stage (15 days) after inoculation, and their roots showed no pathological characteristics. Figure 2 As shown in the figure, 28 days after inoculation, the root system of the disease-resistant strain Wr30 developed normally, and no disease characteristics were observed; the susceptible strain Rc19-92A2 showed obvious disease characteristics, with abnormal swelling of lateral roots and taproots, and a large number of lateral roots disappeared, which affected nutrient absorption and caused yellowing of leaves. The above shows that there is a significant difference in the resistance of the two parental strains to clubroot, which can be used for subsequent research.

[0044] S102. Construction of F2 genetic population: The construction process of F2 segregation population of Wr30×Rc19-92A2 is as follows: Figure 3As shown, by hybridizing the parents, the unopened buds of Wr30 were artificially emasculated during the flowering period, and the pollen of the flowers opened on the same day of Rc19-92A2 was smeared on the stigma of the female flowers of Wr30, and the seeds were bagged and isolated for 1 week to complete the pollination. After they matured, F1 hybrid seeds were obtained; the F1 plants were self-pollinated and the F2 population seeds were obtained, and the F2 population and the parents were used as the genetic population.

[0045] Identification of clubroot resistance of S2 and F2 plants: First, 900 F2 seeds with full grains were selected and sown in a floating tray (50 holes) filled with seedling medium. After 7 days of water absorption and germination, the floating bacterial liquid inoculation method was used to inoculate clubroot fungi. The effective spore concentration of clubroot fungi was 10 8 / g, 15 days after inoculation, transplanted to the clubroot disease nursery and continued to grow for 45 days, and then pulled out to observe the resistance phenotype of each individual plant to clubroot disease ( Figure 4 The F2 population showed segregation in terms of clubroot resistance phenotype. The resistant plants grew normally, while the susceptible plants had multiple abnormally enlarged protrusions on their fleshy roots.

[0046] S3. The DNA of young leaves of the genetic population was extracted using the CTAB method, and the genome was sequenced using illumina PE150. The average information collection depth of the F2 progeny during sequencing was 11.82X, and the average information collection volume was ≥5Gb; the parent resequencing depth was 31.66X, and the information collection volume was ≥16Gb; the sequenced data was quality controlled, filtered, compared to the reference genome and the polymorphism screening between the parents to obtain SNP sites, and the genetic map was constructed using Lepmap3 software ( Figure 5 ), specifically:

[0047] S301. 150 disease-resistant and disease-susceptible F2 plants identified in S2 were selected for resequencing. 0.1 g of young leaves were taken from each plant to extract total DNA. The average sequencing depth of each plant was about 10×. At the same time, the two parents were resequenced to a depth of about 30×. The steps for extracting total DNA from the genetic population are as follows:

[0048] (1) Take about 0.1 g of leaves and place them in a 2 mL centrifuge tube. Add 5 mm diameter steel balls and shake and grind.

[0049] (2) Add 500 μL of 2× CTAB extract preheated at 65°C, shake to mix, and incubate at 65°C for 30 min, inverting and mixing every 10 min;

[0050] (3) Centrifuge at 12000 × g for 10 min at room temperature and collect the supernatant;

[0051] (4) Add an equal volume of mixed solution (phenol: chloroform: isoamyl alcohol = 25:24:1, v:v), mix by inversion, let stand for 10 min, centrifuge at 12000 × g for 10 min at room temperature, and aspirate the upper liquid phase;

[0052] (5) Add an equal volume of isopropanol, mix by inversion, precipitate DNA at -20°C for 10 min, centrifuge at 4°C, 12,000 × g for 10 min, and remove the supernatant;

[0053] (6) The precipitate was washed with pre-cooled anhydrous ethanol, centrifuged at 12000 × g for 10 min at room temperature, and washed once more. The supernatant was removed and allowed to dry naturally for 10 min.

[0054] (7) Add 100 μL of double distilled water and dissolve to obtain DNA.

[0055] S302. Construction of a high-density SNP genetic map of radish: The data obtained by sequencing were quality controlled, and the marker sites with missing parents were filtered out, the marker sites with sample genotype missing rate>50% were filtered out, or the genotype sites with skewed segregation in the offspring were filtered out by screening the significance level of P<0.001 chi-square test. The SNP sites were obtained by comparing the sequencing results to the reference genome and the polymorphism screening between the parents, and the genetic map was constructed using Lepmap3 software ( Figure 5 ).

[0056] S4. QTL analysis of radish resistance to clubroot was performed based on the genetic map. The genetic map and the clubroot resistance phenotype of 300 F2 plants were used to locate the QTL. MapQTL software was used to locate the QTL and detect the effect of the clubroot resistance phenotype of the genetic population. The LOD value of 5.59 was used as the threshold. When the LOD value was greater than 5.59, it was considered as the basis for the existence of a QTL for the clubroot resistance trait. Based on this standard, a major effect locus ( Figure 6 ), the highest LOD value in this interval was 66.94, and the physical position was chr5: 35826907-49559736bp. This QTL can explain 64.3% of the phenotypic variation and was named RsCr5g.1.

[0057] S5. Molecular marker development: Based on the resequencing results of the two parents, the sequence differences between the two were analyzed, and the segments with 100-400bp insertions or deletions between the two parents in the located disease resistance QTL region were screened as target sequences, and InDel primers were designed. Disease-resistant and susceptible strains of the F2 population were selected for PCR amplification, and the genotypes were detected by 1% agarose gel electrophoresis. The PCR reaction system is shown in Table 1.

[0058] Table 1 Molecular marker PCR amplification reaction system

[0059] Element Dosage (μL) 2×PCR Mix 5 <![CDATA[ddH2O]]> 3.5 Forward primer (10 μM) 0.5 Reverse primer (10 μM) 0.5 Total DNA (100 ng / μL) 0.5

[0060] The PCR reaction program is shown in Table 2.

[0061] Table 2 Molecular marker PCR amplification reaction program

[0062]

[0063] Development and screening of S501 and InDel molecular markers: Sequence analysis was performed in the interval chr5: 35826907-49559736bp where the clubroot resistance gene is located, and sequence segments with a length of 100-400bp inserted or deleted between the genomes of the two parents were found. Specific primer pairs were designed at both ends of the differential sequences as candidate InDel molecular markers. Each pair of primers was used to amplify the parents Wr30 and Rc19-92A2, and the PCR products were separated by agarose gel electrophoresis. The primer pairs with different band sizes between the PCR products of the two parents were used for subsequent research, and the primer pairs with no difference or no bands were eliminated. The primer pairs showing polymorphism were used to identify the genotype of the F2 single plants. The band type was the same as that of the parent Wr30 as "A", the band type was the same as that of the parent Rc19-92A2 as "B", and the band type contained both parental bands as "H".

[0064] S502. Design 15 pairs of InDel markers in the QTL positioning interval, use the 15 pairs of InDel markers to screen the disease-resistant parents, susceptible parents and F1, and screen out a total of 9 pairs of polymorphic markers; use the 9 pairs of InDel markers to screen the DNA samples of 94 plants in the F2 population, and preliminarily screen out the most closely linked molecular markers GZ008, GZ012 and GZ017; further verify the molecular markers in 280 F2 plants, screen out the markers most closely linked to the clubroot resistance phenotype, and obtain the InDel marker GZ012 (SEQ ID NO.1 and SEQ ID NO.2) that can be used for molecular marker-assisted breeding. Figure 7 As shown, the molecular marker GZ012 was most closely linked to radish clubroot resistance, with one recombination exchange occurring in 280 F2 individuals. The genetic distance between this molecular marker and the clubroot resistance locus was 0.36 cM.

[0065] GZ012 consists of the front primer SEQ ID NO.1 (GZ012-F) and the rear primer SEQ ID NO.2 (GZ012-R). A 726bp gene fragment (SEQ ID NO.3) was amplified in the disease-resistant parent Wr30, and a 425bp amplified product (SEQ ID NO.4) was obtained in the susceptible parent Rc19-92A2. Compared with the parent Wr30, the parent Rc19-92A2 lacked 301bp in this region. The amplification effect of molecular marker GZ012 in the F2 segregation population is shown in Figure 2. Figure 8 shown.

[0066] The primer sequence of InDel marker GZ012 is as follows:

[0067] Forward primer sequence GZ012-F (SEQ ID NO.1): 5'-CCGTTCATTCTTCTTCGTCGTC-3'

[0068] Rear primer sequence GZ012-R (SEQ ID NO. 2): 5'-CTTCTGGTGTCTAATTTGTCTGATG-3'

[0069] The gene fragment obtained by amplifying GZ012 from the disease-resistant parent Wr30 is as follows (SEQ ID NO.3):

[0070] The gene fragment amplified from the susceptible parent Rc19-92A2 (where "-" in the sequence represents a deleted base) is as follows (SEQ ID NO.4): CCGTTCATTCTTCTTCGTCGTCTCCGTTAGAGCGTCGCCGAGGAAATTGATAAGTTTCTTATACATTTTGTTTGACCGTTTTGCTTGTGACGGAGGAACCCGAAACTTTCTTTAATCTCGTCCGGTTATCTCTAGATTCGGGTTTATACCGGTTTTCTAAAAGTGATTTAATTCCTGATTTCCCGGTTTACTTGTCAAACTGAGAATAAATAGTGTACGTTACATTTTTGTTTTTGCCCGGTAATTAGTTAATTGAGCATAAACAGTTTACATTATTTGCTTTGCTCCTTTATGTTATGATATTGGGCATGGAATTAGTGTAGAAATGTATTATATTATCTTCACTGAAGTTCTTTCCATTCTCACTAATCATGTTAGGTGACAGATGTTTCAATGCAAAAAACATCGGTTTGCTTTTTGGATATGGTTTTGTTCACATATACAAGTGAGAATAACAAAGAACCGAACATAAAAAAAAAACAAAATATTCGATCCCAGTCCTCCTACATATAGCATAAGAGATTTCAACCAGTTAAAACTTGTAAATTACAAAGTTTTTCTTCAGTTCTCAACAACATACAAGTTCGGTGATATGAGGCTCTCTATGGACATATGAGTCTCAAAACCTCCACTGAGGTTTGCCCCGCTAATTCGCAGATTCCTCCTTGCATCAGTTTTAAAATTGTACAATACTATGTCTTCATCAGACAAATTAGACACCAGAAGGZ012

[0071] CCGTTCATTCTTCTTCGTCGTCTCCGTTAGAGCGTCGCCGAGGAAATGGATAAGTTTCTTGTACATTTTGTTTGACCGTTTTGCTTGCGACGGAGGAACCCGAAACTTTTCTTTAATCTCGTCCGGTTAACTCTAGATTCGGGTTTATACCGGTTTTCTAAAAGTGATTTAATTCCTGATTTCCCGGTTTACTTGTCAAACTGAGAATAAATC--------------------------------------------------------------------------------------------- -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CAACAACATACAAGTTCGGTGATACGAGGCTCTCTATGGACATATGAGTCTCAAACCCTCCACTGAGGTTTTGCCCCGCTAATTCGCAGATTCCTCCTTGCATCAGTTTTAAAATTGTACAATACTATGTCTTCATCAGACAAATTAGACACCAGAAG

[0072] Example 2 Application of GZ012 in the selection of clubroot resistance QTL RsCR5g.1

[0073] 1. Transfer of clubroot resistance from Wr30 to Rr64

[0074] Radish inbred line Rr64 originated from Chongqing local variety "Four Seasons Red Radish". Germplasm resources were collected in Chongqing in 2010, and single plants were selected for self-pollination and then selected by pedigree method to breed excellent inbred line Rr64. The inbred line has stable traits, red skin and white flesh. The inbred line is highly susceptible to root knot fungus. In order to obtain resistance to root knot disease, the main effect QTL locus of Wr30 for resistance to root knot disease was transferred to Rr64 using molecular marker GZ012.

[0075] The susceptible inbred line Rr64 was used as the female parent and the clubroot-resistant inbred line Wr30 was used as the male parent to obtain the hybrid F1 generation. The F1 generation was used as the female parent and Rr64 was used as the male parent for backcrossing to obtain the first backcross generation Rr64BC1. 45 Rr64BC1 plants were randomly selected for molecular identification, resistance prediction and field clubroot resistance identification.

[0076] 2. Molecular identification of the clubroot resistance marker GZ012

[0077] Rr64BC1 seeds were sown in the field, and total DNA of each plant was extracted by sampling at the seedling stage. PCR amplification was performed using the primers of molecular marker GZ012. The PCR reaction system is shown in Table 1, and the reaction procedure is shown in Table 2. The electrophoresis pattern of molecular marker GZ012 detected in the Rr64BC1 transgenic backcross population is shown in Fig. 9 As shown, the resistant parent Wr30 amplified a single band of about 750bp, and the susceptible parent Rr64 amplified a single band of about 450bp. Among the individual plants of Rr64BC1, 24 amplified a single band of 450bp, which was predicted to be susceptible to clubroot; 21 amplified two bands, that is, the bands of 750bp and 450bp coexisted, which was predicted to be resistant to clubroot.

[0078] 3. Field identification of clubroot resistance and verification of molecular marker identification results

[0079] According to the genotypes of the 45 Rr64BC1 plants identified by GZ012, the resistance of each plant to clubroot was predicted. At the same time, the resistance of these Rr64BC1 plants was identified in the clubroot nursery. The correspondence between the identification results and the genotypes identified by GZ012 and their predicted resistance is shown in Table 3. The genotypes and predicted disease resistance of the Rr64BC1 plants identified by the molecular marker GZ012 completely correspond to the disease resistance results actually identified in the disease nursery.

[0080] Table 3 Comparison of identification results of the Rr64BC1 clubroot resistance molecular marker GZ012 and field disease resistance identification results

[0081]

[0082]

[0083]

[0084] Note: B means the genotype identified by GZ012 is the same as Rr64; H means the genotype identified by GZ012 is heterozygous.

[0085] As can be seen from Table 3, 21 plants with the band of the GZ012 allele of the Wr30 inbred line were all resistant to clubroot, and 24 plants with the band of the GZ012 allele of the Rr64 inbred line were all susceptible to clubroot. The field disease resistance identification results were consistent with the expected results of the molecular marker identification, indicating that the clubroot resistance QTL RsCr5g.1 in the present invention does show resistance to clubroot, indicating that the molecular marker GZ012 can be used to accurately track and screen the clubroot resistance QTL site RsCr5g.1, and can accurately predict the resistance of the tested plants to clubroot.

Claims

1. An InDel molecular marker for detecting resistance to radish clubroot, characterized in that: The QTL locus for radish clubroot resistance is RsCr5g.1, and RsCr5g.1 is located in the 5th linkage group of radish, with a physical position of 35826907-49559736bp.

2. The InDel molecular marker for detecting radish clubroot resistance according to claim 1, characterized in that: The InDel molecule is labeled GZ012.

3. The InDel molecular marker for detecting radish clubroot resistance according to claim 1 or 2, characterized in that: The front primer sequence of the InDel molecular marker is SEQ ID NO.1, and the rear primer sequence is SEQ ID NO.

2.

4. The InDel molecular marker for detecting radish clubroot resistance according to claim 1 or 2, characterized in that: The InDel molecular marker is located on the fifth chromosome of radish, and its physical position is 48554971-48556155 bp.

5. The method for obtaining the InDel molecular marker for detecting radish clubroot resistance according to any one of claims 1 to 4, characterized in that: The following steps are involved: S1, deriving F2 population from parental hybridization and constructing genetic population; S2, identification of the clubroot resistance phenotype of the genetic population; S3, extracting DNA from the genetic population for genome sequencing, subjecting the sequencing data to quality control, data filtering, comparison with the reference genome and polymorphism screening between parents to obtain SNP sites, and constructing a genetic map; S4. QTL analysis of radish resistance to clubroot based on genetic map; S5. Development and screening of InDel molecular markers.

6. The method for obtaining InDel molecular markers for detecting radish clubroot resistance according to claim 5, characterized in that: The female parent in S1 is the disease-resistant material Wr30, and the male parent is the disease-susceptible material Rc19-92A2.

7. The method for obtaining InDel molecular markers for detecting radish clubroot resistance according to claim 5, characterized in that: During the S3 sequencing, the average information collection depth of the F2 offspring was 11.82X, and the average information collection amount was ≥5Gb; the parent resequencing depth was 31.66X, and the information collection amount was ≥16Gb.

8. The method for obtaining InDel molecular markers for detecting radish clubroot resistance according to claim 5, characterized in that: The data filtering in S3 is specifically as follows: filtering out marker sites with missing values ​​in the parents, filtering out marker sites with sample genotype missing rates > 50%, or filtering out genotype sites with skewed segregation in offspring.

9. The method for obtaining InDel molecular markers for detecting radish clubroot resistance according to claim 5, characterized in that: The S4 is specifically as follows: performing QTL positioning and effect detection on the clubroot resistance phenotype of the genetic population obtained in S2, and when the LOD value is greater than 5.59, it is used as a basis for the existence of a QTL for the clubroot resistance trait.

10. Use of the InDel molecular marker for detecting radish clubroot resistance according to any one of claims 1 to 4 in detecting radish clubroot resistance or radish molecular marker-assisted breeding.

Images