Lentivirus for treating craniopharyngeal tubuloma as well as preparation method and application of lentivirus

Abstract

The invention provides a lentivirus for treating craniopharyngeal tubuloma as well as a preparation method, application and a corresponding pharmaceutical composition of the lentivirus. The lentivirus carries an hTERT (human telomerase reverse transcriptase) promoter and a CDC6shRNA (complementary deoxyribonucleic acid) gene. According to the invention, an hTERT promoter and a CDC6shRNA gene sequence are inserted behind an enzyme cutting site of a vector, an obtained plasmid is transferred into an expression strain, the expression strain is cultured and screened to obtain a cloned strain, and the cloned strain is shaken and packaged to obtain the hTERT-CDC6shRNA lentivirus; when the lentivirus disclosed by the invention is inoculated into a tumor body of a patient with craniopharyngeal tubuloma, the result shows that the lentivirus can effectively inhibit proliferation of craniopharyngeal tubuloma cells and can induce self apoptosis of the craniopharyngeal tubuloma cells.

Description

Technical Field

[0001] The present application relates to the field of tumor gene therapy. Specifically, the present application provides a lentivirus for treating craniopharyngioma and a preparation method and application thereof. Background Art

[0002] Craniopharyngioma is a rare benign tumor formed by residual cells of the craniopharyngioma epithelium, which is usually located in the sellar region, above the pituitary gland at the base of the brain. Although craniopharyngioma is benign, its treatment faces major challenges due to its special location and proximity to many important and complex anatomical structures.

[0003] At present, the treatments for craniopharyngioma mainly include surgery, radiotherapy and drug therapy. Surgery is the preferred treatment for craniopharyngioma. However, due to the special location of craniopharyngioma, the surgical risk is high, which can easily lead to postoperative complications and damage important surrounding structures, such as the optic nerve and pituitary gland. Therefore, the operation is very difficult and the postoperative recurrence rate is high. Radiotherapy is suitable for patients with tumors that are difficult to remove surgically or those who relapse after surgery. For some patients, radiotherapy stimulates the growth of the tumor. Drug therapy is mainly used to improve the patient's endocrine dysfunction and alleviate the symptoms of increased intracranial pressure as an adjuvant treatment for craniopharyngioma.

[0004] According to the above three treatment methods, there is still no effective treatment method to inhibit the growth of craniopharyngioma. Therefore, finding new, efficient and safe treatment methods, especially gene therapy methods, is of great practical significance for the treatment of craniopharyngioma. Summary of the invention

[0005] The present invention provides a lentivirus for treating craniopharyngioma, a preparation method and application thereof. The lentivirus can effectively deliver therapeutic genes into craniopharyngioma cells to achieve the purpose of gene therapy.

[0006] On the one hand, the present application provides a lentivirus for treating craniopharyngioma, wherein the lentivirus carries the hTERT promoter and the CDC6 shRNA gene.

[0007] Furthermore, the hTERT promoter sequence is SEQ ID NO.2.

[0008] Furthermore, the CDC6shRNA gene sequence is SEQ ID NO.3.

[0009] Furthermore, the lentivirus carries the hTERT promoter-CDC6shRNA combination gene.

[0010] Furthermore, the hTERT promoter-CDC6shRNA combination gene sequence is SEQ ID NO.1.

[0011] On the other hand, the present application provides the use of the above-mentioned lentivirus in the preparation of a drug for treating craniopharyngioma.

[0012] Furthermore, the indication is cystic craniopharyngioma.

[0013] Furthermore, the indication is cystic ameloblastic craniopharyngioma.

[0014] On the other hand, the present application provides a pharmaceutical composition comprising the above-mentioned lentivirus for treating craniopharyngioma.

[0015] Furthermore, the pharmaceutical composition also includes a pharmaceutically acceptable excipient.

[0016] Furthermore, the pharmaceutical composition is in the form of an injection.

[0017] Furthermore, the pharmaceutical composition is in the form of an omega-3 capsule injection.

[0018] On the other hand, the present application provides a method for preparing the above-mentioned lentivirus for treating craniopharyngioma:

[0019] (1) inserting hTERT promoter and CDC6shRNA gene sequence after the restriction site of the vector to obtain a plasmid;

[0020] (2) transferring the plasmid into the expression strain, culturing and screening the successfully transferred strain;

[0021] (3) shaking the successfully transferred strain obtained in step (2) to obtain an hTERT-CDC6shRNA expression plasmid;

[0022] (4) Packaging the expression plasmid described in step (3) to obtain hTERT-CDC6shRNA lentivirus.

[0023] The strain can be homemade or commercially available Escherichia coli, yeast, etc., preferably competent cells of Escherichia coli are used. Various commercially available or documented packaging qualities and cells can be used for packaging, preferably mixed packaging plasmids pLP1, pLP / VSVG, pLP2 and 293F cells are used.

[0024] Those skilled in the art can select suitable excipients for the pharmaceutical composition involved in this application based on general knowledge in the pharmaceutical field. Available excipients include but are not limited to solvents, cosolvents, stabilizers, dispersants, viscosity modifiers, antioxidants, pH modifiers, sustained-release agents, fillers, sweeteners, adhesives, gas generators, coating agents, etc. Excipients suitable for injection are particularly preferred. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 is the electrophoresis diagram of plasmid hTERT-CDC6shRNA (lane 2);

[0026] Figure 2 For: CT images of recurrence after surgical treatment;

[0027] Figure 3 This is the CT image 3 months after the injection treatment.

[0028] Figure 4 This is the CT image 4 months after the injection treatment.

[0029] Figure 5 This is the CT image 5 months after the injection treatment.

[0030] Figure 6 This is the CT image 6 months after the injection treatment.

[0031] Figure 7 This is the CT image 8 months after the injection treatment.

[0032] Figure 8 This is the CT image 11 months after the injection treatment.

[0033] Fig. 9 This is the CT image 14 months after the injection treatment.

[0034] Fig.10 For: CT images 15 months after injection treatment. DETAILED DESCRIPTION

[0035] Example 1 Construction of hTERT-CDC6 shRNA overexpression clone

[0036] Relevant gene sequences were retrieved from Genbank, and CDC6 shRNA sequences were designed. The hTERT-CDC6 shRNA overexpression clone was constructed using the seamless cloning method.

[0037] Here are the steps:

[0038] Vector Plenty6.3 / V5-TOPO (abbreviated as D) (purchased from Thermo Fisher Scientific) was digested with restriction sites ClaI and MluI, upstream primers:

[0039] aattcaaaattttatcgataagacaattcacaaacacagccc (SEQ ID NO.4) downstream primer: actaaccggtacgcgttcagtctgagtcaggcccttc (SEQ ID NO.5), inserted hTERT promoter and CDC6shRNA gene sequence to obtain hTERT-CDC6shRNA plasmid.

[0040] step:

[0041] 1. Vector digestion

[0042] Enzyme digestion system preparation:

[0043]

[0044] (Note: Enzyme digestion reaction conditions: 37℃ / 3h)

[0045] 2. Seamless cloning connection

[0046]

[0047]

[0048] (Note: Seamless cloning and ligation reaction conditions: 37℃ / 30min)

[0049] 3. Transformation and coating of ligation products

[0050] Melt 50μl TOP10 competent cells on ice, take 5μl ligation product and competent cells and mix them; ice bath for 30min, heat shock in 42℃ water bath for 90sec, ice bath for 2min; transfer the transformation product to an EP tube containing 500μl non-resistant LB liquid culture medium, place in a shaker, and culture at 37℃, 180rpm for 30min; centrifuge the EP tube containing the transformed bacteria at 4000rpm for 2min; pour out the supernatant in the clean bench, leaving about 100μl culture medium to mix the precipitate, and evenly apply it on the LB resistance culture plate; turn the plate upside down and place it in a 37℃ bacterial incubator to culture overnight (12-16h). Pick a monoclonal colony from the above plate and place it in 6ml LB liquid culture medium, 37℃, 250rpm, and culture overnight (12-16h); extract plasmids, sequence and identify, and compare the sequencing results with the target gene sequence. The identification result is the correct plasmid.

[0051] The plasmid hTERT-CDC6shRNA was obtained (the electrophoresis diagram is shown in Figure 1 shown).

[0052] The gene sequences involved:

[0053] hTERT-CDC6 shRNA gene sequence, SEQ ID NO.1

[0054] agacaattcacaaacacagccctttaaaaaggcttagggatcactaaggggatttctagaagagcgacc

[0055] tgtaatcctaagtatttacaagacgaggctaacctccagcgagcgtgacagcccagggagggtgcgagg

[0056] cctgttcaaatgctagctccataaataaagcaatttcctccggcagtttctgaaagtaggaaaggttac

[0057] atttaaggttgcgtttgttagcatttcagtgtttgccgacctcagctacagcatccctgcaaggcctcg

[0058] ggagacccagaagtttctcgccccttagatccaaacttgagcaacccggagtctggattcctgggaagt

[0059] cctcagctgtcctgcggttgtgccggggccccaggtctggaggggaccagtggccgtgtggcttctact

[0060] gctgggctggaagtcgggcctcctagctctgcagtccgaggcttggagccaggtgcctggaccccgagg

[0061] ttgccctccaccctgtgcgggcgggatgtgaccagatgttggcctcatctgccagacagagtgccgggg

[0062] cccagggtcaaggccgttgtggctggtgtgaggcgcccggtgcgcggccagcaggagcgcctggctcca

[0063] tttcccaccctttctcgacgggaccgccccggtgggtgattaacagatttggggtggtttgctcatggt

[0064] ggggacccctcgccgcctgagaacctgcaaagagaaatgacgggcctgtgtcaaggagcccaagtcgcg

[0065] gggaagtgttgcagggaggcactccgggaggtcccgcgtgcccgtccagggagcaatgcgtcctcgggt

[0066] tcgtccccagccgcgtctacgcgcctccgtcctccccttcacgtccggcattcgtggtgcccggagccc

[0067] gacgccccgcgtccggacctggaggcagccctgggtctccggatcaggccagcggccaaagggtcgccg

[0068] cacgcacctgttcccagggcctccacatcatggcccctccctcgggttaccccacagcctaggccgatt

[0069] cgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggg

[0070] gaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagt

[0071] ggattcgcgggcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcaccc

[0072] gtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccggg

[0073] tccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctc

[0074] gcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccg

[0075] cgatgaattccccagctgattggtattgctaatacttcaagagagtattagcaataccaatcagctttt

[0076] ttg

[0077] hTERT promoter sequence, SEQ ID NO.2

[0078] agacaattcacaaacacagccctttaaaaaggcttagggatcactaaggggatttctagaagagcgacc

[0079] tgtaatcctaagtatttacaagacgaggctaacctccagcgagcgtgacagcccagggagggtgcgagg

[0080] cctgttcaaatgctagctccataaataaagcaatttcctccggcagtttctgaaagtaggaaaggttac

[0081] atttaaggttgcgtttgttagcatttcagtgtttgccgacctcagctacagcatccctgcaaggcctcg

[0082] ggagacccagaagtttctcgccccttagatccaaacttgagcaacccggagtctggattcctgggaagt

[0083] cctcagctgtcctgcggttgtgccggggccccaggtctggaggggaccagtggccgtgtggcttctact

[0084] gctgggctggaagtcgggcctcctagctctgcagtccgaggcttggagccaggtgcctggaccccgagg

[0085] ttgccctccaccctgtgcgggcgggatgtgaccagatgttggcctcatctgccagacagagtgccgggg

[0086] cccagggtcaaggccgttgtggctggtgtgaggcgcccggtgcgcggccagcaggagcgcctggctcca

[0087] tttcccaccctttctcgacgggaccgccccggtgggtgattaacagatttggggtggtttgctcatggt

[0088] ggggacccctcgccgcctgagaacctgcaaagagaaatgacgggcctgtgtcaaggagcccaagtcgcg

[0089] gggaagtgttgcagggaggcactccgggaggtcccgcgtgcccgtccagggagcaatgcgtcctcgggt

[0090] tcgtccccagccgcgtctacgcgcctccgtcctccccttcacgtccggcattcgtggtgcccggagccc

[0091] gacgccccgcgtccggacctggaggcagccctgggtctccggatcaggccagcggccaaagggtcgccg

[0092] cacgcacctgttcccagggcctccacatcatggcccctccctcgggttaccccacagcctaggccgatt

[0093] cgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggg

[0094] gaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagt

[0095] ggattcgcgggcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcaccc

[0096] gtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccggg

[0097] tccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctc

[0098] gcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccg

[0099] cgat

[0100] CDC6shRNA gene sequence, SEQ ID NO.3

[0101] Cccagctgattggtattgctaatacttcaagagagtattagcaataccaatcagc.

[0102] Example 2 Preparation and production process of lentivirus

[0103] The hTERT-CDC6shRNA plasmid of Example 1 was transformed into Stbl3 competent cells to screen for resistant monoclonal strains. The specific operation was as follows:

[0104] Take out competent cells Stbl3 (purchased from Thermo Fisher Scientific) and hTERT-CDC6shRNA plasmid from the -80℃ refrigerator and place on ice to thaw. Take 1μg of plasmid and add it to the competent cells, mix gently, and place it on ice for 25min. Quickly place the competent cells with the added plasmid in a preheated 42℃ water bath for heat shock for 45sec, and place it on ice again for 2min. Add 250μl LB liquid culture medium to the competent cells with the added plasmid, 220rpm / min, 37℃, and recover for 1h. Dry the LB solid culture medium completely, absorb 50μl of the recovered transformation bacterial liquid, add the prepared LB solid culture medium, spread it evenly with a coating rod, and seal the culture dish with a sealing film. Place the sealed LB solid culture medium upside down in a 37℃ incubator and culture for 12-16h to obtain a resistant monoclonal strain.

[0105] The above monoclonal strain was shaken to obtain hTERT-CDC6shRNA plasmid.

[0106] Select a typical single colony in a clean bench and place it in a 15ml sterile centrifuge tube (containing 5ml LB liquid culture medium) at 37℃, 220rpm / min, and culture for 12-16h, OD600 is 0.6-0.9. The next day, inoculate it into LB culture medium at a volume ratio of 1:100, culture at 37℃, 220rpm / min, and culture for 16h to extract the plasmid.

[0107] The plasmid extracted in the previous step is packaged with the mixed packaging plasmids pLP1, pLP / VSVG, and pLP2 to obtain hTERT-CDC6shRNA lentivirus. The specific packaging operation is as follows:

[0108] The packaging cells are 293F cells, and the cell transfection density is 4.0-4.5×10 6 / ml.

[0109] Cell transfection steps: A: Use 5% opti-MEM to dilute the plasmid, the total amount of plasmid is 2.5μg / ml, and the ratio of packaging plasmid pLP1, pLP / VSVG, pLP2 and lentiviral plasmid is 1:1:1:2. B: Use 5% opti-MEM to dilute the plasmid, the amount of transfection reagent (purchased from Thermo Fisher Scientific, catalog number: A35348) is 6μl / ml, and it is placed at room temperature for 1min. The diluted plasmid is added to the diluted transfection reagent, placed at room temperature for 15min, and then added to 293F cells and mixed thoroughly. After 4h, 5% supplement and 4% enhancer are added, and the supernatant is collected after 56h. After purification by purification column, it is concentrated and the liquid is replaced. First, concentrate 5 times, and then use 3 times the volume of filtration and replacement solution (buffer: 0.02M phosphate buffer pH7.2 with 1% glycerol, 20mg / ml sucrose, 1mg / ml L-arginine, 2mg / ml glycine, 2% PEG400) to obtain the lentivirus, which is then packaged and stored at -80°C.

[0110] The activity titer of lentivirus detected by QPCR was 5.39×10 7 TU / ml.

[0111] The steps for lentiviral activity detection are as follows:

[0112] 293T cells were used to detect the activity of lentivirus. The specific operation is as follows:

[0113] 1×10 5 293T cells were inoculated into 6-well plates. After 24 hours of plating, the cell density was B (approximately 2x10 5 / ml), 2ml of culture medium per well. The next day, discard the culture medium and replace it with 1ml / well fresh DMEM culture medium. Gently drop 50μl of lentivirus control (Shanghai Jikai Gene Technology) and 50μl of virus into the wells, and make a blank control at the same time. After 24h of infection, replace the culture medium with 2ml of fresh culture medium and continue to culture for 48h. Extract the cell genome to detect activity.

[0114] After the culture is completed, the cells are digested and the genome is extracted as follows:

[0115] The culture medium was aspirated, 1 ml of 1× PBS was added to each well to gently wash the cells and then discarded, the cells were digested with 0.5 ml of trypsin, and 1 ml of DMEM culture medium was added to resuspend the collected cells in a 1.5 ml centrifuge tube. Genomic DNA was extracted using a genome extraction kit (Tiangen Biochemical Technology (Beijing)), and the genomic DNA was eluted with 100 μl of Elution buffer; the dsDNA concentration and purity were detected by microplate reader.

[0116] Follow the steps to perform QPCR experiment to detect the activity of lentivirus. The specific steps are as follows:

[0117] Take the 293T cell reference gene DNA standard and dilute it 10× to a concentration of 1.0×10 8 copy-1.0×10 4 The target plasmid standard was diluted to a concentration of 1.0×10 8 copy-1.0×10 4 copy, and establish a standard curve.

[0118] Add 19 μl of the prepared PCR reaction system to the PCR reaction wells on the plate, and arrange the 293T cell reference gene DNA and target gene primers in an alternating pattern. Place the 293T cell reference gene DNA in rows A and B, and the target gene primers in rows C and D. Add 1 μl of DNA template to each reaction well, and set up a negative control in which enzyme-free water is used instead of the template;

[0119] The PCR reaction system was as follows, with two replicates for each sample:

[0120]

[0121]

[0122] PCR amplification procedure

[0123]

[0124] Results Analysis

[0125] Substitute the obtained Ct values ​​of the target gene and reference gene into the standard curve to obtain their respective copy numbers Q1 and Q2, and calculate the ratio of the target gene to the reference copy number Q1 / Q2. Then calculate the titer (transduction units per ml, TU / ml) according to the following formula:

[0126] TU / ml = (Q1 / Q2) × B × 2 × dilution factor × 1000 / added virus volume V (μL)

[0127] The 293T cell reference gene DNA primer probe sequences are as follows:

[0128] Forward primer TGC AGA TTT GGA CCT GCG AG(SEQ ID NO.6)

[0129] Reverse primer GAA TAG CCA AGG TGA GCG GC(SEQ ID NO.7)

[0130] Probe ACC TGA AGG CTC TGC GCG GAC TTG T(SEQ ID NO.8)

[0131] The target gene primer and probe sequences are as follows:

[0132] Forward primer GCT CCT TTC CGG GAC TTT CG(SEQ ID NO.9)

[0133] Reverse primer ATT GTC AGT GCC CAA CAG CC(SEQ ID NO.10)

[0134] Probe TCC CTA TTG CCA CGG CGG AAC TCA TCG(SEQ ID NO.11)

[0135] Example 3 Treatment Case

[0136] In the study of craniopharyngioma, in vitro culture of craniopharyngioma cells is an important link, but in practice it has been found that craniopharyngioma cells face many challenges in in vitro culture. Craniopharyngioma cells need to maintain their unique biological characteristics in in vitro culture, such as cell morphology, cell cycle and proliferation ability. However, due to the influence of factors such as the source and growth environment of craniopharyngioma cells, cells cultured in vitro cannot completely simulate the in vivo environment, resulting in changes in cell characteristics. Therefore, it is currently impossible to perform craniopharyngioma cell invasion experiments. In the study, we encountered a patient who had a postoperative recurrence of craniopharyngioma and still relapsed after radioactive isotope internal radiotherapy. After exhausting all other treatments and repeatedly recurring, the patient and his family implore the use of this lentivirus for experimental treatment. The patient received a 13-month direct injection treatment of the lesion, a total of 13 treatments, each time 100μl (lentivirus content: 5.39×10 6 TU), the total injection dose is 1300μl. The injection method is as follows:

[0137] In May 2010, the pathological examination confirmed that the craniopharyngioma was of cystic ameloblast type before the Omya capsule implantation surgery was performed in the Department of Neurosurgery of the PLA Navy General Hospital. After that, the Omya capsule implantation surgery was performed. Two days after the Omya capsule implantation, the experimental treatment was carried out by injecting lentivirus every 30 days, and the steps were as follows:

[0138] 1. Before injection, first use a syringe to completely aspirate the fluid in the Omya capsule and craniopharyngioma;

[0139] 2. Use a 1 ml syringe to slowly inject 100 μl of lentivirus into the Omya capsule;

[0140] 3. Then, 1 ml of normal saline is injected into the omega-3 cyst to dilute and evenly distribute the lentivirus and push the lentivirus into the tumor.

[0141] 4. The above injection process is performed once every 30 days and continues until the fluid in the cyst can no longer be effectively sucked out. At the same time, through CT image observation, it can be clearly seen that the tumor is gradually shrinking. The CT images before and after treatment are shown in Figure 2-Figure 10 .

[0142] It can be clearly seen from the CT images that the craniopharyngioma is gradually shrinking, and the patient did not experience any adverse reactions during the treatment. The whole process was painless and did not affect the patient's normal life.

[0143] In summary, the lentivirus described in the present invention has a significant effect of inhibiting proliferation and inducing auto-apoptosis of craniopharyngioma cystic ameloblasts, and will provide a safe and effective treatment method for craniopharyngioma patients.

Claims

1. A lentivirus for treating craniopharyngioma, characterized in that: The lentivirus carries hTERT promoter and CDC6shRNA gene.

2. The lentivirus according to claim 1, wherein the hTERT promoter sequence is SEQ ID NO.

2.

3. The lentivirus according to claim 1 or 2, wherein the CDC6shRNA gene sequence is SEQ ID NO.

3. The lentivirus according to claim 1 , wherein the lentivirus carries the hTERT promoter-CDC6 shRNA combination gene. 5 . The lentivirus according to claim 4 , wherein the hTERT promoter-CDC6shRNA combination gene sequence is SEQ ID NO.

1.

6. Use of the lentivirus according to any one of claims 1 to 5 in the preparation of a drug for treating craniopharyngioma.

7. The use according to claim 6, wherein the indication is cystic ameloblastic craniopharyngioma.

8. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the lentivirus according to any one of claims 1 to 5.

9. The pharmaceutical composition according to claim 8, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

10. The pharmaceutical composition according to claim 8 or 9, wherein the pharmaceutical composition is in the form of an injection. The pharmaceutical composition according to claim 10 , wherein the pharmaceutical composition is in the form of an omega-3 capsule injection.

12. The method for preparing a lentivirus according to any one of claims 1 to 5, characterized in that: The method comprises: (1) inserting hTERT promoter and CDC6shRNA gene sequence after the restriction site of the vector to obtain a plasmid; (2) transferring the plasmid into the expression strain, culturing and screening the successfully transferred strain; (3) shaking the successfully transferred strain obtained in step (2) to obtain an hTERT-CDC6shRNA expression plasmid; (4) Packaging the expression plasmid described in step (3) to obtain hTERT-CDC6shRNA lentivirus.

Images