Streptomyces mobaraensis for high yield of heat-resistant glutamine transaminase

Abstract

The invention discloses streptomyces mobaraensis for high yield of heat-resistant glutamine transaminase, and belongs to the technical field of gene engineering. According to the invention, Pgapdh and PsmY2022-2 are combined to obtain the tandem promoters PsmY2022-2-Pgapdh and Pgapdh-PsmY2022-2, and the constructed tandem promoters are used for expression of regulation and control, so that the shake flask fermentation enzyme activity of the constructed recombinant bacteria reaches 64.94 U / mL, the expression quantity of heat-resistant glutamine transaminase is improved, and a theoretical foundation is laid for efficient expression of other genes in streptomyces mobaraensis.

Description

Technical Field

[0001] The invention relates to a strain of Streptomyces mobaraensis capable of producing high-temperature resistant glutamine aminotransferase, belonging to the technical field of genetic engineering. Background Art

[0002] Glutamine aminotransferase (EC 2.3.2.13) is a protein cross-linking and protein modification enzyme that can catalyze the formation of ε-(γ-glutamine) isopeptide bonds between glutamine residues and different acyl acceptors in proteins, resulting in cross-linking or small molecule modification. It has been widely used in food fields such as meat products, dairy products and soy products, as well as in non-food fields such as antibody-drug conjugation and tissue engineering. Microbial TGase was first isolated from Streptomyces mobaraensis. Compared with animal and plant sources, TGase (smTG) from S. mobaraensis has a Ca-independent 2+ The advantages of smTG include the catalytic reaction and low production cost. This also makes S. mobaraensis fermentation the main source of commercial TGase. However, the low thermal stability and low specific enzyme activity of smTG limit its application efficiency.

[0003] So far, many heat-resistant smTG mutants have been constructed. For example, the smTG thermostable combined mutant TGm1 (S2P-S23V-Y24N-S199A-K294L) obtained by random mutation and saturation mutation has a half-life of 24.3 min at 60 °C, which is 11.2 times that of smTG. The FRAPD-TGm2 (S2P-S23V-Y2 4N-E28T-S199A-A265P-A287P-K294L), with a half-life of 66.87 min at 60°C and a specific enzyme activity of 71.41 U / mg; FRAPD-TGm2-S116A-S179L (FRAPD-TGm2A) obtained by virtual saturation mutagenesis in a flexible region far away from the substrate binding pocket on the basis of FRAPD-TGm2, had a half-life of 132.38 min at 60°C (t 1 / 2 (60℃) specific activity is 79.15U / mg. Although there are many heat-resistant TGase mutants, they are all expressed in E. coli hosts and cannot be used in food and other fields. Summary of the invention

[0004] The present invention provides a tandem promoter having a nucleotide sequence shown in SEQ ID NO.7 or SEQ ID NO.8.

[0005] The invention also provides a recombinant plasmid containing the tandem promoter.

[0006] In one embodiment, the plasmid is pSET152.

[0007] The present invention also provides a recombinant Streptomyces spp. smY2022 -2 or P gapdh The promoter regulates the expression of transglutaminase TGm2A.

[0008] In one embodiment, the nucleotide sequence of the gene TGm2A encoding transglutaminase is shown as SEQ ID NO.1.

[0009] In one embodiment, the recombinant Streptomyces moyuanensis uses smY2022-Δtg as a host.

[0010] The present invention also provides a method for improving the ability of Streptomyces mobara to produce glutamine transaminase, which comprises regulating the expression of glutamine transaminase using the promoter shown in (a), (b) or (c); wherein:

[0011] (a) Promoter P gapdh ;

[0012] (b) Tandem promoter P gapdh -P smY2022 -2;

[0013] (c) Tandem promoter P smY2022 -2-P gapdh .

[0014] In one embodiment, the promoter P gapdh The nucleotide sequence is shown in SEQ ID NO.6.

[0015] In one embodiment, the promoter P smY2022 -2-P gapdh The nucleotide sequence is shown in SEQ ID NO.7.

[0016] In one embodiment, the promoter P gapdh -P smY2022 The nucleotide sequence of -2 is shown in SEQ ID NO.8.

[0017] In one embodiment, the glutamine aminotransferase is encoded by the gene shown in SEQ ID NO.1.

[0018] The present invention also provides the use of the tandem promoter or the recombinant Streptomyces mobaraensis in preparing transglutaminase or products containing transglutaminase.

[0019] In one embodiment, the application is to culture the recombinant Streptomyces mobaraensis at 30-37° C. for 24-60 hours and collect the glutamine transaminase in the culture solution.

[0020] Beneficial Effects

[0021] (1) The present invention integrates TGm2A into smY2022Δtg through pSET152 to obtain a S. mobaraensis strain with high production of heat-resistant TGase. The maximum enzyme activity of the obtained recombinant strain smY2022-TGm2A in shake flask fermentation reaches 15.1 U / mL. The recombinant TGm2 has excellent specific activity and thermal stability: the specific enzyme activity is 75.73 U / mg, and the half-life at 60°C reaches 132.38 min; it can be applied to many heat-resistant application conditions.

[0022] (2) The present invention screened a strong promoter P gapdh , in P gapdh The highest enzyme activity of TGm2A was 31.48 U / mL under the action of P smY2022 -2 TGm2A yield increased by 108.4%.

[0023] (3) The present invention converts P gapdh and P smY2022 -2 combination to obtain the tandem promoter P gapdh -P smY2022 -2 and P smY2022 -2-P gapdh , where P smY2022 -2-P gapdh The highest enzyme activity of smY2022-TGm2A in shake flask fermentation was 64.94 U / mL, compared with the fermentation with P smY2022 The yield of -2-TGm2A increased by 330%. Overall, this has important reference significance for the application of heat-resistant TGase and the efficient expression of other genes in S. mobaraensis. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Diagram for the recombinant strain construction of smY2022-TGm2A.

[0025] Figure 2 This is the fermentation curve of smY2022-TGm2A.

[0026] Figure 3 This is the fermentation bar graph of recombinant smY2022-promoter-TGm2A.

[0027] Figure 4 For smY2022-P smY2022 -2-P gapdh-TGm2A and smY2022-P gapdh -P smY2022 -2-TGm2A fermentation curve.

[0028] Figure 5 This is the SDS-PAGE analysis of purified recombinant TGm2A.

[0029] Figure 6 is the thermal inactivation curve of recombinant TGm2A. DETAILED DESCRIPTION

[0030] The detection methods involved in the following embodiments are as follows:

[0031] The method for determining the activity of glutamine transaminase is:

[0032] The TGase activity was determined by colorimetry using N-CBZ-Gln-Gly and hydroxylamine as substrates. The TGase reaction was initiated by mixing 60 μL of TGase solution with 150 μL of substrate solution (30 mM N-CBZGln-Gly, 100 mM hydroxylamine, 10 mM glutathione, 200 mM Tris-HCl buffer, pH = 6.0). After incubation at 37°C for 10 min, 60 μL of stop reagent (1 M hydrochloric acid, 4% (v / v) trichloroacetic acid, 2% (m / v) FeCl3·6H2O) was added to terminate the enzyme reaction. The reaction product (L-glutamic acid γ-monohydroxamate) was calculated based on the absorbance (A525) of the reaction solution. One unit of TGase activity was defined as the amount of enzyme required to produce 1 μmol of CBZ-Glu-Gly hydroxamate per minute at 37°C.

[0033] Determination of specific enzyme activity:

[0034] The specific enzyme activity assay is to dilute the purified enzyme solution to 0.4-0.6 mg / mL with Tris-HCl buffer (50 mM, pH 8.0), measure the enzyme activity and protein concentration, and calculate the specific enzyme activity parameters.

[0035] Purification and enzymatic properties of recombinant TGm2A:

[0036] After 60 hours of fermentation of smY2022-TGm2A, the supernatant was collected and ethanol precipitated. The protein precipitate was collected by centrifugation and redissolved in sodium acetate buffer (50mM pH 5.5). It was purified using a cationic chromatography column, and then desalted using a desalting column and the optimal reaction temperature and temperature stability were determined. The protein precipitate obtained after ethanol precipitation was made into a dry powder and the optimal pH was determined.

[0037] The primer sequences involved in the following examples are shown in Table 1:

[0038] Table 1 Primer sequences

[0039]

[0040] Note: The underlined sequences are homologous sequences cloned in one step.

[0041] The culture medium and fermentation conditions involved in the following examples are as follows:

[0042] GYM solid medium: 1% glucose, 0.4% yeast extract, 0.3% malt extract, 2% agar powder.

[0043] Basic fermentation medium: 2% glycerol, 2% peptone, 0.5% yeast extract, 2% soybean meal, 0.4% K2HPO4, 0.2% KH2PO4, 0.2% CaCO3, 0.2% MgSO4.

[0044] Seed medium: 2% glycerol, 2% peptone, 0.5% yeast extract, 0.2% K2HPO4, 0.2% MgSO4, pH 7.2.

[0045] Fish meal fermentation medium: 2% glycerol, 7.5% fish meal peptone, 0.5% yeast extract, 0.55% corn steep liquor, 0.55% ammonium sulfate, 0.2% MgSO4, 0.2% K2HPO4, pH 7.0-7.2.

[0046] The fermentation conditions of Streptomyces mobara involved in the following examples are:

[0047] The Streptomyces mobara strain was first cultured on a GYM solid plate at 30°C for 4-5 days, spores and hyphae were scraped into a shake flask containing 30 mL of seed culture medium using an inoculation loop, and cultured in a shaker at 30°C and 220 rpm for 24 hours to obtain a Streptomyces mobara seed solution; the seed solution was inoculated into a shake flask containing 30 mL of fish meal fermentation medium at an inoculation rate of 8%, and fermented at 30°C and 220 rpm.

[0048] Example 1: Construction of recombinant Streptomyces mobara strains

[0049] (1) Construction of recombinant vector

[0050] Using pUC19 plasmid as vector, Shanghai Shenggong Biotechnology Co., Ltd. chemically synthesized pUC-TGm2A, and using pUC-TGm2A as template, primers TGm2A-F / TGm2A-R were used to amplify the TGm2 expression cassette of 2154 bp (SEQ ID NO: 1). The nucleotide sequence is as follows:

[0051]

[0052]

[0053] Note: The underline is the TGm2A coding gene, the wavy line is the zymogen and signal peptide region, and the dotted underline is P smY2022 -2 areas.

[0054] The TGm2A expression cassette fragment was connected between the XbaI and NotⅠ sites of plasmid pSET152 using a one-step cloning method to obtain plasmid pSET152-P smY2022 -2-TGm2A.

[0055] (2) Construction of recombinant strains

[0056] Plasmid pSET152-P smY2022 -2-TGm2A was transformed into smY2022-Δtg (smY2022-Δtg was disclosed in the paper "Efficient Production of a Thermostable Mutant of Transglutaminase by Streptomyces mobaraensis"), and the transformants were selected and cultured on non-antibiotic GYM solid plates to obtain the recombinant strain smY2022-P smY2022 -2-TGm2A( Figure 1 ).

[0057] (3) For smY2022-P smY2022 -2-TGm2A fermentation:

[0058] Scrape the Streptomyces mobaraensis smY2022-P with an inoculation loop smY2022 -2-TGm2A spores and mycelium were added to a shake flask containing 30 mL of seed culture medium and cultured in a shaker at 30°C and 220 rpm for 24 h to obtain a seed solution of Streptomyces mobaraensis;

[0059] The seed liquid was inoculated into a shake flask containing 30 mL of fish meal fermentation medium at an inoculation rate of 8% (v / v), and fermented at 30°C and 220 rpm. The fermentation liquid was centrifuged at 10,000 r / min for 5 min, and the supernatant was taken to detect the activity of recombinant glutamine transaminase (recombinant TGm2A).

[0060] The results show that Figure 2 ), fermented for 60 h, the enzyme activity of recombinant TGm2A in the fermentation supernatant could reach 15.1 U / mL.

[0061] Example 2: Screening of exogenous promoters

[0062] (1) Construction of recombinant plasmids containing different promoters

[0063] In Shanghai Sangon Biotech Co., Ltd., the promoter P rpsL , P kasO*p , P ermE* , P Sp44 and P gapdh The promoter plasmids were constructed on the plasmid pET-28a(+) and the synthesized promoter plasmids were named pET-28a(+)-Promoter. rpsL -F / P rpsL -R, P kasO*p -F / P kasO*p -R, P ermE* -F / P ermE* -R, P Sp44 -F / P Sp44 -R and P gapdh -F / P gapdh -R respectively amplify P rpsL (SEQ ID NO: 2), P kasO*p (SEQ ID NO:3), P ermE* (SEQ ID NO:4), P Sp44 (SEQ ID NO: 5) and P gapdh (SEQ ID NO:6).

[0064] The vector pSET152-P was amplified using primers zai-F / zai-R smY2022 -2-TGm2A does not include all the nucleic acid sequences of the promoter, and then cloned them separately with P rpsL , P kasO*p , P ermE* , P Sp44 or P gapdh Ligation to obtain plasmid pSET152-P rpsL -TGm2A, pSET152-P kasO*p -TGm2A, pSET152-P ermE* -TGm2A, pSET152-P Sp44 -TGm2A and pSET152-P gapdh -TGm2A.

[0065] (2) Construction of recombinant strains

[0066] The plasmid pSET152-P constructed in step (1) rpsL -TGm2A, pSET152-P kasO*p -TGm2A, pSET152-P ermE* -TGm2A, pSET152-P Sp44-TGm2A and pSET152-P gapdh -TGm2A were transformed into smY2022-Δtg, and the transformants were picked and cultured on GYM solid plates without antibiotics to obtain the recombinant strain smY2022-P rpsL -TGm2A, smY2022-P kasO*p -TGm2A, smY2022-P ermE* -TGm2A, smY2022-P Sp44 -TGm2A and smY2022-P gapdh -TGm2A.

[0067] (3) Fermentation of the recombinant strain:

[0068] Scrape the Streptomyces mobaraensis smY2022-P with an inoculation loop rpsL -TGm2A, smY2022-P kasO*p -TGm2A, smY2022-P ermE* -TGm2A, smY2022-P Sp44 -TGm2A or smY2022-P gapdh -TGm2A spores and mycelium were added to a shake flask containing 30 mL of seed culture medium and cultured in a shaker at 30°C and 220 rpm for 24 h to obtain the seed solution of Streptomyces mobaraensis.

[0069] The seed liquid was inoculated into a shake flask containing 30 mL of fish meal fermentation medium at an inoculum rate of 8% (v / v), and fermented at 30°C and 220 rpm. The fermentation liquid was centrifuged at 10,000 r / min for 5 min, and the supernatant was taken to detect the activity of recombinant glutamine transaminase (recombinant TGm2A).

[0070] The results show that Figure 3 ), fermented for 60 h, recombinant strain smY2022-P rpsL -TGm2A, smY2022-P kasO*p -TGm2A, smY2022-P ermE* -TGm2A and smY2022-P Sp44 -TGm2A fermentation broth, no TGase activity was detected, and the recombinant strain smY2022-P gapdh -After 60h of fermentation, the TGm2A enzyme activity reached 31.4U / mL.

[0071] Example 3: Construction of tandem promoters

[0072] (1) Construction of recombinant plasmid

[0073] Using pUC-TGm2A and pET-28a(+)-Promoter constructed in Example 2 as templates, primers smY2022-F1 / smY2022-R1, gapdh-F1 / gapdh-R1, smY2022-F2 / smY2022-R2, gapdh-F2 / gapdh-R2 were used to amplify P smY2022 -2 and P gapdh The nucleic acid sequence was amplified using primers ATGTCCCAACGCGGGAGAACTCTCGTCTg and TCTAGAGTCGACCTGCAGCCCAAGCTTGG loop P vector pSET152-P smY2022-2 -TGm2A, and then clone the vector with P smY2022-2 and P gapdh The plasmids pSET152-P smY2022-2 -P gapdh -TGm2A and pSET152-P gapdh -P smY2022-2 -TGm2A.

[0074] (2) Construction of recombinant strains

[0075] Plasmid pSET152-P smY2022 -2-P gapdh -TGm2A and pSET152-P gapdh -P smY2022 -2-TGm2A were transformed into smY2022-Δtg, and the transformants were picked and cultured on GYM solid plates without antibiotics to obtain the recombinant strain smY2022-P smY2022 -2-P gapdh -TGm2A and smY2022-P gapdh -P smY2022 -2-TGm2A.

[0076] (3) Fermentation of the recombinant strain

[0077] Scrape the Streptomyces mobaraensis smY2022-P with an inoculation loop smY2022 -2-P gapdh -TGm2A and smY2022-P gapdh -P smY2022 -2-TGm2A spores and mycelium were added to a shake flask containing 30 mL of seed culture medium and cultured in a shaker at 30°C and 220 rpm for 24 h to obtain the seed solution of Streptomyces mobaraensis.

[0078] The seed liquid was inoculated into a shake flask containing 30 mL of fish meal fermentation medium at an inoculation rate of 8% (v / v), and fermented at 30°C and 220 rpm. The fermentation liquid was centrifuged at 10,000 r / min for 5 min, and the supernatant was taken to detect the activity of recombinant glutamine transaminase (recombinant TGm2A).

[0079] The results show that Figure 4 ), fermented for 60 h, recombinant strain smY2022-P smY2022 -2-P gapdh -TGm2A and smY2022-P gapdh -P smY2022 -2-TGm2A fermentation for 60h, the highest enzyme activity of TGm2A reached 64.9U / mL and, respectively, the recombinant strain smY2022-P gapdh -P smY2022 -2-TGm2A was fermented for 60 h, and the highest enzyme activity of TGm2A reached 21.2 U / mL.

[0080] Example 4: Purification and enzymatic properties of recombinant TGm2

[0081] (1) Use an inoculation loop to scrape Streptomyces mobaraensis smY2022-P smY2022 -2-P gapdh -TGm2A spores and mycelium were added to a shake flask containing 30 mL of seed culture medium and cultured in a shaker at 30°C and 220 rpm for 24 h to obtain the seed solution of Streptomyces mobaraensis.

[0082] (2) The seed solution was inoculated into a shake flask containing 30 mL of fish meal fermentation medium at an inoculum volume of 8% (v / v) and fermented at 30°C and 220 rpm to produce smY2022-P smY2022 -2-P gapdh -TGm2A was fermented for 60 h, and the supernatant was collected and ethanol precipitated. The protein precipitate was collected by centrifugation and redissolved in sodium acetate buffer (50 mM pH 5.5). It was purified using a cationic chromatography column, and then desalted using a desalting column and the optimal reaction temperature and temperature stability were determined. The protein precipitate obtained after ethanol precipitation was made into a dry powder and the optimal pH was determined.

[0083] from Figure 5 It can be seen that the use of smY2022-P smY2022 -2-P gapdh -TGm2A The purified TGm2A (enzyme obtained from the recombinant strain) prepared by the method had a single band and the protein purity was in line with expectations.

[0084] The specific enzyme activity of the enzyme protein was measured, and the results showed that the recombinant bacteria smY2022-P smY2022 -2-P gapdh-The specific enzyme activity of TGm2A obtained by TGm2A fermentation is 75.73U / mg.

[0085] The optimal temperature of the enzyme produced by the fermentation of the recombinant bacteria was determined, and the enzyme activity of the purified and diluted enzyme solution was measured at 37-80°C. The enzyme activity at 37°C was taken as 100%, and the relative enzyme activity at each temperature was calculated. smY2022 -2-P gapdh The optimal reaction temperature of the enzyme prepared by -TGm2A was 60℃.

[0086] The optimum pH of the enzyme prepared by fermentation of the recombinant bacteria was determined, and the specific steps were as follows: after the fermentation supernatant of step (2) and step (3) was precipitated by ethanol, the protein precipitate was collected to prepare a protein dry powder, a protein solution of the same concentration was prepared with a buffer of pH 3.5-8, and the enzyme activity was determined by reacting with a substrate of the corresponding pH at 37°C for 10 minutes. The enzyme activity measured by the protein solution of pH 6.0 and the substrate of pH 6.0 was taken as 100%, and the relative enzyme activity at each pH was calculated. The results showed that the optimum pH was 6.

[0087] The temperature stability of the enzyme prepared by recombinant bacterial fermentation was measured. The specific steps are as follows: the purified and diluted enzyme solution was incubated at 60°C for 0-120 minutes and then stored in an ice-water mixture, and the residual enzyme activity of samples with different incubation times was measured. The enzyme activity at 0 minutes of incubation was taken as 100%, and the relative enzyme activity of samples with different incubation times was calculated. Based on these data, a regression equation was fitted to calculate the half-life of recombinant TGm2A at 60°C. The results showed that after the recombinant TGm2A was treated at 60°C for 60 minutes, more than 50% of the enzyme activity was still residual compared to that without incubation, and the half-life at 60°C reached 120.36min ( Figure 6 ).

[0088] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A promoter, characterized in that It has the nucleotide sequence shown in SEQ ID NO.7 or SEQ ID NO.

8.

2. A recombinant plasmid containing the promoter according to claim 1.

3. The recombinant plasmid according to claim 2, characterized in that The plasmid is pSET152.

4. Recombinant Streptomyces masouensis, characterized in that: P smY2022 -2 or P gapdh The promoter regulates the expression of transglutaminase TGm2A.

5. The recombinant Streptomyces maoyuanensis according to claim 4, characterized in that The nucleotide sequence of the gene TGm2A encoding transglutaminase is shown in SEQ ID NO.

1.

6. The recombinant Streptomyces moyuanensis according to claim 4 or 5, characterized in that smY2022-Δtg was used as the host.

7. A method for improving the ability of Streptomyces mobara to produce glutamine transaminase, characterized in that: The expression of glutamine aminotransferase is regulated by the promoter shown in (a), (b) or (c); wherein: (a) Promoter P gapdh ; (b) Promoter P gapdh -P smY2022 -2; the promoter P gapdh -P smY2022 -2 has a nucleotide sequence as shown in SEQ ID NO:8; (c) Promoter P smY2022 -2-P gapdh ; The promoter P smY2022 -2-P gapdh The nucleotide sequence is shown in SEQ ID NO:

7.

8. The method according to claim 7, characterized in that The glutamine aminotransferase is encoded by the gene shown in SEQ ID NO.

1.

9. The method according to claim 7, characterized in that: The Streptomyces mobaraensis is Streptomyces mobaraensis smY2022-Δtg.

10. Use of the promoter according to claim 1 or the recombinant Streptomyces mobaraensis according to any one of claims 4 to 6 in the preparation of transglutaminase or a product containing transglutaminase.

Images