Kit for detecting LINC01480 gene expression and preparation method and application thereof

Abstract

The invention discloses a kit for detecting LINC01480 gene expression as well as a preparation method and application thereof, and relates to the field of gene expression kits. The kit for detecting the expression of the LINC01480 gene comprises a specific primer pair aiming at the LINC01480 gene, a specific primer pair aiming at a reference gene GAPDH, a positive control lentiviral vector containing a LINC01480 gene segment, a negative control lentiviral vector and an RT-qPCR (Reverse Transcription-Quantitative Polymerase Chain Reaction) reaction system. According to the present invention, the MRD of the treated MM patient is noninvasively monitored by detecting the LINC01480 gene expression so as to achieve the purpose of improving the convenience and the accuracy of the MRD index monitoring of the treated MM patient.

Description

Technical Field

[0001] The present invention relates to the field of gene expression kits, and in particular to a kit for detecting LINC01480 gene expression, and a preparation method and application thereof. Background Art

[0002] Multiple myeloma (MM) is a malignant blood tumor characterized by abnormal proliferation of clonal plasma cells, accounting for 10% of hematological malignancies and 1% of all malignant tumors. So far, MM is still incurable, with an effective chemotherapy rate of 40% to 60% and a complete remission rate of less than 5%. The course of MM patients varies greatly, ranging from a few months to decades. Although new drugs such as lenalidomide and bortezomib have shown significant efficacy in recent years, MM is still incurable and all patients will eventually relapse. The main reason is that minimal residual disease (MRD) still exists in MM patients after conventional treatment, and MRD is considered to be one of the root causes of relapse. MRD monitoring after treatment is related to treatment outcomes, including progression-free survival (PFS) and overall survival (OS). MRD directly guides treatment and determines prognosis, so monitoring MRD is of great significance.

[0003] At present, the commonly used MRD monitoring method in clinical practice is to collect bone marrow samples for cell morphology detection and multi-parameter flow cytometry (MFC), but there are shortcomings: ① MM has a unique tissue distribution characteristic, that is, the degree of tumor cell infiltration and proliferation in the medullary is different, and it is distributed in a focal manner. It often requires multiple punctures to detect positive results, and the variation between multiple test results is large. ② Cell morphology is highly subjective and it is not easy to distinguish between benign and malignant plasma cells. In addition, the number of myeloma cells decreases sharply after chemotherapy. Even if the number of manually classified cells exceeds the number of daily tests, it is still difficult to accurately count the number of tumor cells. ③ Due to the large differences in the instrument status and personnel technical level of each laboratory, it is difficult to unify the detection scheme and monitoring indicators of flow cytometry, and even the current high-end multi-color flow cytometry (eight to ten colors) has a sensitivity of 10 -4 ④The prediction accuracy of MFC for PFS and OS is imperfect. According to the indicator (C statistic) that measures the discrimination ability of the prediction model, the C statistic for PFS is only about 0.67, and the C statistic for OS is 0.76. A C statistic exceeding 0.7 is considered to indicate that the model has good predictive ability.

[0004] At present, the monitoring indicators of MM MRD mainly include the expression pattern of myeloma cell surface molecules and the clonal rearrangement of immunoglobulin genes. Plasma cells with abnormal surface molecule expression patterns cannot be equated with malignant tumor plasma cells. This indicator can only be detected by flow cytometry, which is limited by the sensitivity of this technology. Clonal rearrangement of immunoglobulin genes is currently mainly detected by second-generation sequencing, which is expensive, about 10 times that of flow cytometry. In addition, this detection method cannot detect extramedullary lesions, cannot fully reflect the disease status of MM, and as an invasive operation, it is not suitable for continuous sampling and dynamic monitoring, which is not conducive to clinical promotion and application. Therefore, there is an urgent need for more accurate and specific methods to predict PFS and OS, especially more convenient non-invasive monitoring methods.

[0005] In view of this, this application is hereby filed. Summary of the invention

[0006] The purpose of the present invention is to provide a kit for detecting LINC01480 gene expression, a preparation method and application thereof, and to non-invasively monitor MM MRD by detecting LINC01480 gene expression. The kit and method provide a more accurate, specific and convenient non-invasive monitoring means to predict PFS and OS.

[0007] First, an embodiment of the present invention provides a kit for detecting LINC01480 gene expression, comprising a specific primer pair for the LINC01480 gene, a specific primer pair for the internal reference gene GAPDH, a positive control lentiviral vector containing a LINC01480 gene fragment, a negative control lentiviral vector and an RT-qPCR reaction system.

[0008] Specifically, LINC01480 is a long non-coding RNA. Based on the differential expression of LINC01480 in MM, the MRD of MM patients after treatment was monitored by quantifying its expression level in peripheral blood plasma. The expression of LINC01480 was accurately measured by RT-qPCR technology using specific primer pairs for the LINC01480 gene and the internal reference gene GAPDH. The internal reference gene GAPDH was used to standardize the experimental results to reduce the impact of differences between samples; the positive control lentiviral vector contained the LINC01480 gene fragment to verify the detection ability of the experimental system; the negative control lentiviral vector did not contain the LINC01480 gene fragment to verify the specificity of the experimental system. The RT-qPCR reaction system was used to extract RNA from the sample, reverse transcribe it into cDNA, and quantitatively detect the expression of the LINC01480 gene by qPCR.

[0009] Optionally, the specific primer pair for the LINC01480 gene includes:

[0010] The upstream primer LINC01480-F: 5′-CCACAAGGGAGTCAGAGCAG-3′ is complementary to the positive strand (template strand) of the LINC01480 gene and is used to initiate cDNA synthesis and amplification of the DNA strand in the qPCR reaction;

[0011] The downstream primer LINC01480-R: 5'-ACGCATGACAAAATCAGCCG-3' is complementary to the negative strand of the LINC01480 gene (the complementary strand of the template strand) and is used to complete cDNA synthesis and DNA strand amplification in the qPCR reaction. In general, the primers are used to complement the specific sequence of the LINC01480 gene to ensure that only the target gene is specifically amplified in the qPCR reaction, improve the detection sensitivity and accuracy, and can also be used to monitor the fluorescent signal generated during DNA synthesis, thereby achieving quantitative analysis of the expression level of the LINC01480 gene.

[0012] Optionally, the specific primer pair for the internal reference gene GAPDH includes:

[0013] Upstream primer: 5'-GGAGCGAGATCCCTCCAAAAT-3', complementary to the positive strand (template strand) of the GAPDH gene, used to initiate cDNA synthesis and amplification of the DNA strand in the qPCR reaction;

[0014] Downstream primer: 5'-GGCTGTTGTCATACTTCTCATGG-3', complementary to the negative strand of the GAPDH gene (the complementary strand of the template strand), is used to complete cDNA synthesis and DNA strand amplification in the qPCR reaction. This pair of primers is used to complement the specific sequence of the GAPDH gene, ensuring that only the GAPDH gene is specifically amplified in the qPCR reaction, and can be used to monitor the fluorescent signal generated during DNA synthesis, thereby achieving quantitative analysis of the expression level of the GAPDH gene.

[0015] Optionally, the RT-qPCR reaction system includes the following components:

[0016] An RNA extraction component, wherein the RNA extraction component is configured to extract RNA from cells and free RNA from plasma;

[0017] Reverse transcription components, used to reverse transcribe RNA into cDNA;

[0018] The qPCR component is set up for quantitative analysis of cDNA using a qPCR kit.

[0019] Secondly, in order to better solve the above problems, the embodiment of the present invention also provides a method for preparing a kit for detecting LINC01480 gene expression, comprising the following steps:

[0020] Select a specific primer pair for the LINC01480 gene and a specific primer pair for the internal reference gene GAPDH;

[0021] Prepare a negative control lentiviral vector and a positive control lentiviral vector containing the LINC01480 gene fragment;

[0022] Prepare RT-qPCR reaction system;

[0023] The specific primer pair for the LINC01480 gene, the specific primer pair for the internal reference gene GAPDH, the negative control lentiviral vector, the positive control lentiviral vector containing the LINC01480 gene fragment and the RT-qPCR reaction system were assembled into a kit.

[0024] Optionally, the preparation of the negative control lentiviral vector includes using a GV367 vector as a basic vector, and preparing it by not cloning or cloning a non-functional LINC01480 gene fragment into the GV367 vector;

[0025] The preparation of the positive control lentiviral vector containing the LINC01480 gene fragment includes using a GV367 vector as a basic vector and cloning the LINC01480 gene fragment into the GV367 vector for preparation.

[0026] Optionally, preparing the RT-qPCR reaction system includes:

[0027] Total RNA from the samples was extracted using the SteadyPure Rapid RNA Extraction Kit;

[0028] The extracted RNA was reverse transcribed into cDNA using lnRcute lncRNA First-Strand cDNA Kit;

[0029] The qPCR reaction system was prepared using the lnRcute lncRNA fluorescence quantitative detection kit.

[0030] Optionally, the RT-qPCR reaction system comprises:

[0031] 2xInR IncRNAPreMix, which is configured to provide the premixed reagents required for qPCR reactions;

[0032] 50xROX Reference Dye, used to normalize the fluorescence signal;

[0033] RNase-Free ddH2O, used for preparing and / or diluting reaction systems.

[0034] Optionally, the extracting total RNA from the sample using the SteadyPure rapid RNA extraction kit further comprises purifying the RNA;

[0035] Finally, in order to better achieve the purpose of the present invention, an embodiment of the present invention also provides an application of a kit for detecting LINC01480 gene expression, including using the above kit to monitor the MRD of MM patients after treatment.

[0036] Compared with the prior art, the embodiments of the present invention have the following advantages and beneficial effects:

[0037] 1. The embodiment of the present invention can non-invasively monitor the MRD of MM patients after treatment by specifically designing the kit, reducing the pain and risk of patients. The accuracy and reliability of LINC01480 gene expression monitoring can be improved by standardizing specific primers and internal reference genes. The monitoring results can be used to assist in the diagnosis, treatment effect evaluation and prognosis judgment of MM, guide clinical treatment decisions, and dynamically monitor the progression and recurrence of the disease by continuously monitoring the expression changes of LINC01480. Compared with other molecular biological detection methods, such as second-generation sequencing, the embodiment of the present invention has lower cost and is more suitable for widespread clinical application.

[0038] 2. The expression level of the GAPDH gene is relatively stable in different samples or conditions. By comparing the expression level of the target gene (such as LINC01480) with the expression level of GAPDH, the experimental results can be standardized and the impact of differences between samples can be reduced. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0040] Figure 1 Schematic diagram of circulating free nucleic acid LINC01480 monitoring MRD in MM patients;

[0041] Figure 2 This is a diagram for constructing a lentiviral vector, where Figure 2 a is the vector map, Figure 2 b is the electrophoresis diagram of the enzyme digestion results. Figure 2 c is the electrophoresis diagram of PCR products. Figure 2 d is the CR identification result diagram;

[0042] Figure 3 This is the RT-qPCR amplification curve of the positive lentiviral vector;

[0043] Figure 4 This is the standard curve of positive lentiviral vector;

[0044] Figure 5 It is the specific detection result diagram of the kit;

[0045] Figure 6 Comparison of the expression levels of LINC01480 in normal control group and newly diagnosed MM patients;

[0046] Figure 7 The expression level of LINC01480 in four multiple myeloma cell lines (RPMI-8226, MM.1S, U266, NCI-H929) compared with normal human plasma cells;

[0047] Figure 8 This is a correlation analysis diagram between LINC01480 expression in bone marrow plasma cells and IL-6 expression in peripheral blood serum of MM patients;

[0048] Fig. 9 The expression of LINC01480 in R-ISSⅠ (n=6), R-ISSⅡ (n=21), and R-ISSⅢ (n=33) MM patients;

[0049] Fig.10 Comparison of progression-free survival rates between the LINC01480 high expression group (n=33) and the LINC01480 low expression group (n=27);

[0050] Fig.11 This is a correlation analysis diagram of LINC01480 expression in bone marrow plasma cells and peripheral blood plasma of MM patients;

[0051] Fig.12 This is a survival analysis chart for patients with different R-ISS stages;

[0052] Fig.13 This is a survival analysis chart of patients with circulating plasma free LINC01480 mean value as the boundary, and patients with values ​​above and below the mean value;

[0053] Fig.14 This is a survival analysis chart of patients with circulating plasma free LINC01480 mean value as the boundary, and patients with values ​​above and below the mean value;

[0054] Fig.15The mean of circulating plasma free LINC01480 in R-ISS stage III patients is used as the boundary, and the survival analysis diagram of patients with values ​​above and below the mean is shown;

[0055] Fig.16 This is a schematic diagram showing the stable changes in the expression of circulating plasma free LINC01480 in 7 MM patients who had achieved complete remission during the follow-up period;

[0056] Fig.17 This is a schematic diagram of the first case of a MM patient who achieved complete remission and had significant changes in the expression of circulating plasma free LINC01480 during the follow-up period;

[0057] Fig.18 This is a schematic diagram of the significant change in the expression level of circulating plasma free LINC01480 in the second MM patient who achieved complete remission during the follow-up period;

[0058] Fig.19 This is a schematic diagram showing that the expression level of circulating plasma free LINC01480 changed significantly during the follow-up period in the third MM patient who had achieved complete remission;

[0059] Fig. 20 This is a schematic diagram of the fourth MM patient who achieved complete remission and showed significant changes in the expression level of circulating plasma free LINC01480 during the follow-up period. DETAILED DESCRIPTION

[0060] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Generally, the components of the embodiments of the present invention described and shown in the drawings here can be arranged and designed in various different configurations.

[0061] Therefore, the following detailed description of the embodiments of the present invention provided in the accompanying drawings is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0062] It should be noted that similar reference numerals and letters denote similar items in the following drawings, and therefore, once an item is defined in one drawing, further definition and explanation thereof is not required in subsequent drawings.

[0063] In the description of the present invention, it should be noted that the terms "first", "second", "third", etc. are only used to distinguish the description and cannot be understood as indicating or implying relative importance.

[0064] Example

[0065] Liquid biopsy of free nucleic acid is a non-invasive technology that can be used to diagnose, evaluate and / or monitor a variety of tumors. Among them, free long non-coding RNA (LncRNA) has a stable secondary structure and is expected to become a non-invasive monitoring indicator for plasma. Long non-coding RNA LINC01480 is located at position 41535498-41536904 on chromosome 19. LINC01480 can respond to the stimulation of IL-6, a myeloma growth survival factor. After IL-6 stimulates myeloma cells, the expression level of LINC01480 is significantly upregulated. LINC01480 is expressed at extremely low levels in normal plasma cells, but is abnormally highly expressed in MM cell lines, MM patient bone marrow plasma cells and plasma. More importantly, the expression level of LINC01480 is consistent with the current clinical prognostic stratification standard R-ISS system, that is, the worse the R-ISS stage of MM patients, the higher the expression level of LINC01480. Patients with high expression of LINC01480 have significantly lower progression-free survival. LINC01480 is an important indicator of early recurrence and significantly decreased survival rate. The high frequency and sustained expression of LINC01480, which is tumor-specific, makes it very likely to become an effective MM prognosis and efficacy monitoring indicator, especially a new target with high sensitivity and high specificity for non-invasive detection.

[0066] The purpose of the embodiment of the present invention is to find new indicators and methods for MRD detection in MM patients after treatment, that is, sensitive, specific, non-invasive, etc. At the same time, this method can not only be used to qualitatively detect the MRD of MM patients after treatment, but also can quantitatively measure the tumor burden in the patient through internal reference genes. The specific conception includes establishing inclusion and exclusion criteria, following up and collecting samples (bone marrow, peripheral blood) of active MM patients at different treatment stages, and deeply analyzing the correlation between circulating plasma free LINC01480 and bone marrow plasma cell LINC01480, serum IL-6 levels, tumor burden, and efficacy prognosis, comparing the advantages and disadvantages of circulating plasma free LINC01480 and existing monitoring methods, and studying whether circulating plasma free LINC01480 can sensitively monitor MRD and predict recurrence early at the human level.

[0067] Example 1

[0068] Provided is a method for preparing a kit for detecting LINC01480 gene expression, comprising the following steps:

[0069] Step 1: Selection of specific primer pairs

[0070] 1. Specific primer pair A for LINC01480 gene:

[0071] Upstream primer LINC01480-F: 5′-CCACAAGGGAGTCAGAGCAG-3′;

[0072] Downstream primer LINC01480-R: 5'-ACGCATGACAAAATCAGCCG-3'.

[0073] 2. Specific primer pair B for the internal reference gene GAPDH:

[0074] Upstream primer LINC01480-F: 5′-GGAGCGAGATCCCTCCAAAAT-3′;

[0075] Downstream primer LINC01480-R: 5'-GGCTGTTGTCATACTTCTCATGG-3'.

[0076] Step 2: Preparation of lentiviral vector

[0077] 1. Preparation of positive control lentiviral vector containing LINC01480 gene fragment:

[0078] Gene name: LINC01480 (NR_110724).

[0079] Species:Human.

[0080] Main reagents: as shown in Table 1 below:

[0081] Table 1

[0082] Reagent name Reagent Source cat.No 1kp DNA ladder marker Fermentas #SM0311 250bp DNA ladder marker JERRY DL250+,100T Agarose Sabaison GA4-100 <![CDATA[In-Fusion TM PCR Cloning Kit]]> clontech 639626 Taq polymerase SinoBio E001-02B dNTP Takara D4030A Primer JERUI BIOTECH Restriction enzymes NEB Plasmid Extraction Kit Promega A1460 Agarose Gel DNA Recovery Kit Tiangen Biochemical DP209-03

[0083] Main instruments and equipment: as shown in Table 2 below:

[0084] Table 2

[0085] Instrument Name Instrument source cat.No. PCR instrument Applied Biosystems 2720thermal cycler Positive clone sequencing Meiji Biotechnology ABI3730 Stabilized voltage DNA electrophoresis instrument BioRad Gel Imager Tianneng Company Bacteria Shaker Hualida Experimental Equipment Co., Ltd. HI-9211K Bacterial incubator Shanghai Yiheng Scientific Instrument Co., Ltd. Gilson Pipettes Gilson Corporation High-speed centrifuge Hitachi TGL-16G-A Disposable flat dishes Hunan Changsha Tiandiren Biotechnology Co., Ltd. 1L flask Jintan Jingbo Experimental Instrument Factory 1111.1115 50ml Polypropylene tube Shanghai Wuhua Chemical Co., Ltd.

[0086] Vector restriction enzyme information: The vector name is GV367, the element sequence is Ubi-MCS-SV40-EGFP-IRES-puromycin, the cloning site is AgeI / NheI, and the vector map is as follows: Figure 2 As shown in a, the vector instructions come from the website:

[0087] (http: / / www.genechem.com.cn / index / supports / tool_search.html?keywords).

[0088] Enzyme digestion results: Figure 2As shown in b, the marker bands from top to bottom are: 10kb, 8kb, 6kb, 5kb, 4kb, 3.5kb, 3kb, 2.5kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp; 1 is the vector digestion product; 2 is the undigested vector.

[0089] Acquisition of target gene fragments: Primers are shown in Table 3 below:

[0090] Table 3

[0091]

[0092] Primer description: Contains exchange pairing bases, restriction sites, and partial sequence at the 5' end of the target gene for PCR fishing of the target gene.

[0093] PCR results: The PCR product size is 518bp. Figure 2 In the electrophoresis diagram shown in c, the marker bands from top to bottom are: 5kb, 3kb, 2kb, 1.5kb, 1Kb, 750bp, 500bp, 250bp, 100bp; the size of the PCR product is 512bp.

[0094] Recombinant plasmid construction: The product was exchanged into a linearized expression vector, and the PCR identification primers are shown in Table 4 below:

[0095] Table 4

[0096] ID seq LINC01480(72181-1)-p3 GGGTCAATATGTAATTTTCAGTG LINC01480(72181-1)-p4 CGTCGCCGTCCAGCTCGACCAG

[0097] PCR identification results: The size of the PCR product of the positive transformant is 1139 bp, and the size of the PCR product of the negative transformant is 661 bp. Figure 2 The electrophoresis diagram shown in d shows that the size of the PCR product of the positive transformant is 1139bp, and the size of the PCR product of the negative transformant is 661bp. 1 is the negative control (ddH2O); 2 is the negative control (empty control group); 3 is the positive control (GAPDH); 4 is the marker, from top to bottom, 5kb, 3kb, 2kb, 1.5kb, 1Kb, 750bp, 500bp, 250bp, 100bp; 5-12 are transformants 1-8.

[0098] Positive clone sequencing results and analysis: The alignment results are as follows: Sequence 1:

[0099] TGGCCGTTTTTGGCTTTTTTGTTAGACGAAGCTTGGGCTGCAGGTCGACTCTAGAGGATC

[0100] CCCGGGTACCGGTATGTTAGTGGAATTAACATATGCCCCACCCCAAGTGACTTCTAAAGG

[0101] GCTAACTCACCACAAGGGAGTCAGAGCAGATCTTGGACTGAGACCTACAGGACACAGC

[0102] GACTCTTAAATAGGTGGCTCACCAGGAGAAAGGCATAGCAGAACCTGGACTGAGACCT

[0103] ACGGGAGACAGGCAGACACACAGGAGGTTGGACGTCGAGAGGAGCACATCAGTGCAA

[0104] GAACACATGGGTGGCTGCCACTTCTCTCCCTTTCCTGAGAGGGAAAAACTCTCGACGCT

[0105] GAGAGGAATCCACCAACAGGCACCAGCACTCTGGCAGGCCACCGACCAATGGATTGAC

[0106] ATAGAGTTTGGCTGGGGCAGCCAGAGGAGAGCCTGGGCCGCTGAATAACCCGACTTCA

[0107] GGGGAAAACTATTCTCCCTTTTGGCTCCCCCATCTGCTGAGAGCTACTTCCACTCAATAA

[0108] AACCTTGCACTCATTCTCCAAGAGCTAGCCTGTGGAATGTGTGTCAGTTAGGGTGTGGA

[0109] AAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGC

[0110] AACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCAT

[0111] CTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCG

[0112] CCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCT, the comparison result is verified to be correct.

[0113] 2. Preparation of negative control lentiviral vector: Prepare by not cloning or cloning a non-functional LINC01480 gene fragment into the GV367 vector.

[0114] Step 3: Preparation of RT-qPCR reaction system

[0115] 1. Cell RNA extraction

[0116] SteadyPure rapid RNA extraction kit (Aikuri Biotechnology, AG21023) was used to extract cellular RNA, which specifically includes:

[0117] Cell lysis: Add 500uL Buffer QLS lysis solution to the cell pellet, immediately shake at high speed to mix or pipette repeatedly until the homogenate is clear and non-viscous, and let the homogenate stand at room temperature for 2 minutes;

[0118] Add an equal volume of 100% ethanol to the homogenate and mix well with a pipette. If there is obvious sticky matter or precipitation, use a pipette to blow several times to break up the precipitation. (Note: If the precipitation is not broken up, it will cause the Quick RNAMini Column to clog, affecting the yield and purity)

[0119] Immediately transfer all of the above mixture to the Quick RNA Mini Column, centrifuge at 12,000 rpm for 2 min at room temperature, and discard the filtrate;

[0120] Add 700uL of Buffer QWB to the Quick RNAMini Column, centrifuge at 12,000rpm for 1min at room temperature, and discard the filtrate; (Note: Before the first use of Buffer QWB, add 35ml of 100% ethanol (the volume ratio of Buffer QWB to anhydrous ethanol is 3:7), mix well, mark the bottle, and store at room temperature)

[0121] Place the Quick RNAMini Column adsorption column on a new 2.0ml Collection Tube and centrifuge at 12,000rpm for 2 minutes at room temperature; (Note: In this step, the adsorption column must be taken out vertically to prevent the adsorption column head from touching the collection tube wall; installing it on a new 2.0ml Collection Tube is beneficial to improve RNA purity)

[0122] Place the Quick RNAMini Column adsorption column on a new RNase Free Tube, add 50uL RNase Free Water to the center of the adsorption column membrane, let it stand at room temperature for 3 minutes, then centrifuge at 12,000rpm for 2 minutes at room temperature to elute the RNA, detect the total RNA concentration, and store it at -80℃.

[0123] 2. Plasma RNA Extraction

[0124] In order to enrich free RNA in plasma, 10% PEG8000 was added after separation of plasma, and then QIAampRNA Blood Mini Kit was used to extract circulating plasma free RNA, including:

[0125] Take 1.0 mL of plasma into a 15 ml centrifuge tube, add 300 uL of RPI buffer, shake vigorously for 5 seconds, and let stand at room temperature for 3 minutes;

[0126] Add 100uL RPP buffer, shake vigorously for 20s, place on ice for 3min, and centrifuge at room temperature and 3000rmp for 10min;

[0127] Transfer the upper layer of liquid to a new centrifuge tube, add 1 volume of ice isopropylene, mix thoroughly, transfer to a 15 mL collection column, centrifuge at room temperature and 3000 rpm for 3 min, and discard the filtrate in the collection tube;

[0128] Add 4 ml of RWT buffer to the collection column, centrifuge at room temperature and 3000 rpm for 3 min, and discard the filtrate in the collection tube;

[0129] Add 2.5 mL of RPE buffer to the collection column, centrifuge at room temperature and 3000 rpm for 5 min, and replace with a new collection tube;

[0130] Add 30uL of RNase-free water to the collection column, let stand at room temperature for 1min, and centrifuge at 3000rmp for 2min to elute RNA;

[0131] Detect total RNA concentration.

[0132] 3. Reverse transcription reaction

[0133] The lnRcute lncRNA First-Strand cDNA Kit (Tian Gen, KR202) was used for reverse transcription reaction, which specifically included the following steps:

[0134] Thaw 5×gDNABuffer, lnR-RT Primer Mix, 10×lnR RT Buffer, and RNase-Free ddH2O at room temperature (15-25°C) and quickly place on ice after thawing. Vortex each solution to mix well before use, and briefly centrifuge to collect the liquid remaining on the tube wall;

[0135] Prepare the genomic DNA removal system mixture: 2 μL RNA template, 2 μL 5×gDNA Buffer, 6 μL RNase-Free ddH2O, mix thoroughly. Centrifuge briefly, incubate at 42°C for 3 minutes, and then place on ice;

[0136] Prepare the reverse transcription reaction system mixture: 10×lnR RT Buffer 2μL, lnR RT Enzyme Mix 1μL, lnR-RT Primer Mix 2μL, RNase-Free ddH2O 5μL. Add 10μL of Mix to the reaction solution in the gDNA removal step and mix thoroughly to complete the 20μL reaction system. Incubate at 42℃ for 15min. Incubate at 95℃ for 3min and place on ice. The obtained cDNA can be used for subsequent experiments or stored at low temperature.

[0137] 4. qPCR reaction

[0138] The lnRcute lncRNA fluorescence quantitative detection kit (SYBR Green) (Tiangen, FP402) was used to prepare the reaction system, and qPCR was performed on a fluorescence real-time quantitative PCR instrument (7500-FAST, ABI, USA), which specifically included the following steps:

[0139] qPCR reaction system (20 μL): 0.5 μL of the upstream primer in step 1, 0.5 μL of the downstream primer in step 1, 10 μL of 2xInR IncRNAPreMix, 1 μL of reverse transcription product, 0.4 μL of 50xROX Reference Dye, and 7.6 μL of RNase-FreeddH2O;

[0140] qPCR reaction: A two-step PCR reaction procedure was used for the reaction, with pre-denaturation at 95°C for 3 min, PCR reaction (40 cycles): denaturation at 95°C for 5 sec, annealing / extension at 60°C for 32 sec, and finally melting curve analysis.

[0141] Test results:

[0142] 1. Sensitivity test of the kit

[0143] 1. Assembly of the kit

[0144] The kit consists of the following components: a specific primer pair A for the LINC01480 gene prepared in Example 1, a specific primer pair B for the internal reference gene GAPDH, a positive control lentiviral vector and a negative control lentiviral vector, and an RT-qPCR reaction system.

[0145] 2. Sensitivity test of the kit

[0146] 1. The positive control lentiviral vector was diluted 10-fold to contain 10 6 , 10 5 , 10 4 , 10 3 , 10 2 copies of the LINC01480 gene fragment.

[0147] 2. Reverse transcription reaction

[0148] The reverse transcription reaction step is the same as step 3 in Example 1.

[0149] 3. qPCR reaction

[0150] The qPCR reaction steps are the same as those in step 3 of Example 1.

[0151] Results: Positive control lentiviral vector 10 6 , 10 5 , 10 4 , 10 3 , 10 2 The qPCR amplification curve of copies is as follows Figure 3 The standard curve is shown in Figure 4 As shown, the sensitivity of detecting the LINC01480 gene fragment can reach 100 copies, indicating that the kit has high sensitivity.

[0152] 2. Specificity detection of the kit

[0153] 1. Assembly of the kit

[0154] The kit consists of the following components: a specific primer pair A for the LINC01480 gene prepared in Example 1, a specific primer pair B for the internal reference gene GAPDH, a positive control lentiviral vector and a negative control lentiviral vector, and an RT-qPCR reaction system.

[0155] 2. Specificity detection

[0156] The positive control lentiviral vector, the negative control lentiviral vector and the RNA of the bone marrow plasma cells of 4 MM patients were subjected to RT-PCR, and the PCR products were subjected to agarose gel electrophoresis, specifically including the following steps:

[0157] Bone marrow plasma cell separation: Take 2mL of bone marrow specimen, anticoagulate with EDTA-K2, add 20uL of magnetic bead-coupled CD138 antibody (MiltenyiBiotec), mix well, and incubate in a 4°C refrigerator for 15 minutes. After incubation, filter the bone marrow sample using a 70um sterile filter membrane. Wet the sorting column with PBS, transfer the filtered bone marrow to the sorting column, wash it with PBS 3 times, remove the sorting column, and elute the plasma cells adsorbed on the sorting column with PBS. The separated plasma cells are stored at -80°C for RNA extraction.

[0158] Reverse transcription reaction: the same as the reverse transcription reaction step in step 3 of Example 1.

[0159] PCR reaction: 2×Taq Master Mix (Vazyme, P111) was used for PCR reaction. ①PCR reaction system (20 μL): 0.8 μL of upstream primers shown in Example 1, 0.8 μL of downstream primers shown in Example 1, 10 μL of 2×Taq Master Mix, 1 μL of reverse transcription product, 7.4 μL of RNase-Free ddH2O. ②PCR reaction: pre-denaturation at 95°C for 3 min, PCR reaction (35 cycles): denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 60°C for 32 sec, and complete extension at 72°C for 5 min. The PCR products were subjected to agarose gel electrophoresis.

[0160] Results: After PCR amplification, the specific primer pair A for the LINC01480 gene prepared in Example 1 can specifically amplify the LIN01480 gene (such as Figure 5 As shown in the figure, the agarose gel electrophoresis results of PCR products of 4 cases of MM, positive lentiviral vector control, and negative lentiviral vector control, the marker bands from top to bottom are: 2.5kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp). There was no band in the negative control group; only a single concentrated band was amplified in the positive control group, and the size of the band was consistent with the preset size (512bp); only a single concentrated band was amplified in the 4 cases of MM patients, and the size of the band was consistent with the preset size (512bp), indicating that the kit has high specificity.

[0161] Example 2: Provided is an application of a kit for detecting LINC01480 gene expression, specifically a kit for detecting the expression of LINC01480 in MM, illustratively:

[0162] 1. Assembly of the kit

[0163] The kit consists of the following components: a specific primer pair A for the LINC01480 gene prepared in Example 1, a specific primer pair B for the internal reference gene GAPDH, a positive control lentiviral vector and a negative control lentiviral vector, and an RT-qPCR reaction system.

[0164] 2. Kit detection of LINC01480 expression in MM

[0165] 1. The kit was used to detect the expression level of LINC01480 in bone marrow plasma cells and plasma of 60 newly diagnosed MM and 20 healthy controls.

[0166] ①Case selection: A total of 60 MM patients treated in the Department of Hematology of Sichuan Provincial People's Hospital from January 2021 to December 2022 were selected as the study group, including 35 males and 25 females; the median age was 66 years [(46-88) years]; 6 cases of R-ISS stage I, 21 cases of R-ISS stage II, and 33 cases of R-ISS stage III. Inclusion criteria: patients who met the diagnostic criteria for MM in the International Myeloma Working Group (IMWG); age ≥ 18 years old; bone marrow smear or bone marrow biopsy confirmed MM; patients signed informed consent. Exclusion criteria: other blood system plasma cell tumors (including plasma cell leukemia, monoclonal gammopathy, POMES syndrome, systemic amyloidosis, etc.); reactive plasma cell increase; non-first-diagnosed and relapsed refractory MM patients; previous treatment in other hospitals, lack of complete data. Another 20 healthy bone marrow donors from our hospital were selected as the control group, including 10 males and 10 females with a median age of 37 years [(21-56) years].

[0167] ② Research methods: Staging and prognostic stratification were performed according to R-ISS. Samples were collected at the time of initial diagnosis for patients who were newly diagnosed, and samples were collected according to the review cycle for patients after chemotherapy or transplantation. Study termination criteria: Patients requested not to participate in the study. Patients were followed up for 24 months by telephone follow-up and outpatient follow-up, with monthly follow-up to record the survival status of MM patients. The patient's survival period started from the date of diagnosis, and the follow-up ended in December 2024.

[0168] Progression-free survival (PFS) and complete response (CR) are used as tumor efficacy standards and are often used to determine the prognosis and survival of malignant tumors. PFS refers to the period from the start of treatment to the observation of disease progression or death due to any reason in patients with tumor diseases. Complete remission of MM: serum and urine immunofixation electrophoresis is negative, soft tissue plasmacytoma disappears, and plasma cells in the bone marrow are <5%; for patients who only rely on serum FLC levels as measurable lesions.

[0169] ③Sample collection:

[0170] Plasma: Fasting peripheral blood was collected from MM patients and healthy donors and anticoagulated with EDTA-K2. After centrifugation at 3000 rpm for 5 min, 1.5 mL of upper plasma was collected. The separated plasma was stored at -80°C for the extraction of circulating nucleic acids and the determination of IL-6 levels.

[0171] Bone marrow: Take 2mL of bone marrow specimen, anticoagulate with EDTA-K2, add 20uL of magnetic bead-coupled CD138 antibody (MiltenyiBiotec), mix well, and incubate in a 4°C refrigerator for 15 minutes. After incubation, filter the bone marrow sample using a 70um sterile filter membrane. Wet the sorting column with PBS, transfer the filtered bone marrow to the sorting column, wash it with PBS 3 times, remove the sorting column, and elute the plasma cells adsorbed on the sorting column with PBS. The separated plasma cells are stored at -80°C for RNA extraction.

[0172] ④Sample testing:

[0173] Serum IL-6 level determination: using AuthentiKine TM Human IL-6 ELISA Kit (Proteintech) was used to detect the level of human serum IL-6 according to the instructions. The corresponding standard and the sample to be tested were added to each well of the ELISA plate, and the enzyme conjugate was added and incubated at 37°C for 1 hour. The plate was washed three times and then the color developer was added. The color was developed at 37°C in the dark for 15 minutes. The stop solution was added and the OD450 value was detected with an ELISA reader within 10 minutes after the reaction was terminated.

[0174] Extraction of RNA from bone marrow plasma cells: the same as the cell RNA extraction step in step 3 of Example 1.

[0175] Plasma RNA extraction: the same as the plasma RNA extraction step in step 3 of Example 1.

[0176] Reverse transcription reaction: the same as the reverse transcription reaction step in step 3 of Example 1.

[0177] qPCR reaction: the same as the qPCR reaction step in step 3 of Example 1.

[0178] Each batch of RT-qPCR experiments was set up with a positive control (using an equal volume of 10-fold serially diluted positive control lentiviral vector to replace the sample), a negative control (using an equal volume of negative control lentiviral vector to replace the sample) and a no-template blank control (using an equal volume of H 2 O instead of sample). Each sample was repeated 3 times. The relative expression of LINC01480 in bone marrow plasma cells and plasma was calculated using 2 -△△Ct Method calculation.

[0179] 2. The kit was used to detect the expression level of LINC01480 in four multiple myeloma cell lines (RPMI-8226, MM.1S, U266, and NCI-H929).

[0180] RNA extraction: The same as the cell RNA extraction step in step 3 of Example 1.

[0181] Reverse transcription reaction: the same as the plasma RNA extraction step in step 3 of Example 1.

[0182] qPCR reaction: the same as the qPCR reaction step in step 3 of Example 1.

[0183] The results showed that the expression of LINC01480 in the bone marrow plasma cells of 60 MM patients was 34.41±10.03 times that of the normal control group (P=0.0010, Figure 6 Compared with the plasma cells in the normal control group, LINC01480 was significantly overexpressed in RPMI-8226, MM.1S, U266, and NCI-H929 cells (P<0.0001, as shown). Figure 7 At the same time, the expression of LINC01480 in bone marrow plasma cells of MM patients was positively correlated with serum IL-6 levels (R 2 =0.8187, P<0.0001, such as Figure 8 The worse the R-ISS stage of MM patients, the higher the expression of LINC01480 in bone marrow plasma cells (P<0.0001, as shown). Fig. 9 Kaplan Meier analysis was used to evaluate the relationship between LINC01480 and the prognosis of MM patients. The results showed that the higher the expression of LINC01480, the shorter the progression-free survival (PSF) of MM patients (P = 0.0074, as shown). Fig.10 As shown in Figure 3, the progression-free survival rate of the LINC01480 high expression group (n=33) and the LINC01480 low expression group (n=27), Log-rank (Mantel-Cox) test). At the initial diagnosis, the expression level of circulating plasma free LINC01480 was strongly positively correlated with the expression level of LINC01480 in bone marrow plasma cells (R 2 =0.9518, P<0.0001, such as Fig.11The above results show that the expression of LINC01480 is related to the clinical stage. The worse the R-ISS stage of MM patients, the higher the expression of LINC01480, indicating that LINC01480 is associated with poor prognosis of MM patients. In addition, the level of LINC01480 in bone marrow plasma cells is positively correlated with the level of serum IL-6 in MM patients, and the level of circulating plasma free LINC01480 is correlated with the level of LINC01480 in bone marrow plasma cells, indicating that LINC01480 can reflect the tumor burden of MM patients, and circulating plasma free LINC01480 is a potential new target for MM liquid biopsy.

[0184] Example 3: Provided is an application of a kit for detecting LINC01480 gene expression, specifically an application of the kit for detecting circulating plasma free LINC01480 in different R-ISS stages, exemplarily:

[0185] 1. Assembly of the kit

[0186] The kit consists of the following components: a specific primer pair A for the LINC01480 gene prepared in Example 1, a specific primer pair B for the internal reference gene GAPDH, a positive control lentiviral vector and a negative control lentiviral vector, and an RT-qPCR reaction system.

[0187] 2. Application of circulating plasma free LINC01480 in different R-ISS stages: Same as step 2 of Example 2.

[0188] The results showed that the progression-free survival (PFS) of 60 MM patients with different R-ISS stages was different. The PFS of patients in R-ISS stage I was (21.77±1.23) months; the PFS of patients in R-ISS stage II was (15.32±1.81) months; the PFS of patients in R-ISS stage III was only (6.53±1.52) months, and the PFS of patients in R-ISS stage III was the worst (e.g. Fig.12 The differences in the expression levels of circulating plasma free LINC01480 within each R-ISS group were further analyzed. Within the same R-ISS group, the expression levels of circulating plasma free LINC01480 were different, with the mean as the boundary, and there was a difference in PFS between patients above the mean and those below the mean. The mean circulating plasma free LINC01480 in stage I patients was 3.45, and patients above the mean in the same group had worse PFS (X 2 =5.49,P=0.019, Fig.13 The mean value of circulating plasma free LINC01480 in stage II patients was 5.04, and patients with values ​​higher than the mean in the same group had worse PFS (X 2 =15.96, P = 0.00006451, such as Fig.14 In stage III patients, the mean value of circulating plasma free LINC01480 was 6.45, and patients with values ​​higher than the mean in the same group had worse PFS (X 2 =0.021,P=0.88, such as Fig.15 The above shows that LINC01480 can be used as an indicator for MM prognosis.

[0189] Example 4: Provided is an application of a kit for detecting LINC01480 gene expression, specifically an application of the kit for detecting circulating plasma free LINC01480 in MRD monitoring after complete remission, exemplarily:

[0190] 1. Assembly of the kit

[0191] The kit consists of the following components: a specific primer pair A for the LINC01480 gene prepared in Example 1, a specific primer pair B for the internal reference gene GAPDH, a positive control lentiviral vector and a negative control lentiviral vector, and an RT-qPCR reaction system.

[0192] 2. Application of circulating plasma free LINC01480 in MRD monitoring after complete remission: Schematic diagram of circulating free nucleic acid LINC01480 for detecting MRD in MM patients is shown in Figure 1 As shown, it is the same as step 2 of Example 2.

[0193] The results showed that after induction chemotherapy, 11 of the 60 MM patients achieved complete remission. Among them, 7 MM patients showed MRD continued to be negative by MFC detection, and their circulating plasma free LINC01480 remained at a low level during the follow-up period (such as Fig.16 As shown in Figure 2 ). The expression of circulating LINC01480 in the other 4 patients who had achieved complete remission gradually increased during the follow-up period. When MFC was negative, the expression of LINC01480 showed a gradual upward trend and increased significantly at a certain stage. The turning point of the trend change was 4 to 8 weeks earlier than the MFC positive (as shown in Figure 2 ). Figure 17-20 This indicates that LINC01480 can detect disease recurrence in MM patients in advance and sensitively.

[0194] 3. Technical Effect: The embodiment of the present invention develops circulating plasma free LINC01480 into a new indicator for MRD monitoring of MM patients after treatment, and creates a non-invasive, highly sensitive and highly specific MM MRD detection kit.

[0195] In general, the kit prepared in Example 1 of the present invention can be used for the following applications:

[0196] ①The worse the R-ISS stage of MM patients, the higher the expression of LINC01480, and LINC01480 indicates that MM patients have a poor prognosis. ②The level of LINC01480 in bone marrow plasma cells is positively correlated with the level of serum IL-6 in MM patients, and the circulating plasma free LINC01480 is correlated with the level of LINC01480 in bone marrow plasma cells. LINC01480 can reflect the tumor load in MM patients. ③MM patients with high expression of LINC01480 have a shorter median progression-free survival. ④Compared with the traditional MFC detection of MRD, this kit can monitor the recurrence of MM patients earlier, more sensitively and non-invasively, accurately assess the prognosis of MM patients, and help quickly identify high-risk MM patients.

[0197] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall be included in the protection scope of the present invention. It should be noted that the structures or components illustrated in the accompanying drawings are not necessarily drawn to scale, and the present invention omits the description of known components and processing technologies and processes to avoid unnecessary limitations on the present invention.

Claims

1. A kit for detecting LINC01480 gene expression, characterized in that: It includes a specific primer pair for the LINC01480 gene, a specific primer pair for the internal reference gene GAPDH, a positive control lentiviral vector containing the LINC01480 gene fragment, a negative control lentiviral vector and an RT-qPCR reaction system.

2. A kit for detecting LINC01480 gene expression according to claim 1, characterized in that: The specific primer pair for the LINC01480 gene includes: Upstream primer LINC01480-F: 5′-CCACAAGGGAGTCAGAGCAG-3′; Downstream primer LINC01480-R: 5'-ACGCATGACAAAATCAGCCG-3'.

3. A kit for detecting LINC01480 gene expression according to claim 2, characterized in that: The specific primer pair for the internal reference gene GAPDH includes: Upstream primer: 5′-GGAGCGAGATCCCTCCAAAAT-3′; Downstream primer: 5'-GGCTGTTGTCATACTTCTCATGG-3'.

4. A kit for detecting LINC01480 gene expression according to claim 3, characterized in that: The RT-qPCR reaction system includes the following components: An RNA extraction component, wherein the RNA extraction component is configured to extract RNA from cells and free RNA from plasma; Reverse transcription components, used to reverse transcribe RNA into cDNA; The qPCR component is set up for quantitative analysis of cDNA using a qPCR kit.

5. A method for preparing a kit for detecting LINC01480 gene expression, characterized in that: The following steps are involved: Select a specific primer pair for the LINC01480 gene and a specific primer pair for the internal reference gene GAPDH; Prepare a negative control lentiviral vector and a positive control lentiviral vector containing the LINC01480 gene fragment; Prepare RT-qPCR reaction system; The specific primer pair for the LINC01480 gene, the specific primer pair for the internal reference gene GAPDH, the negative control lentiviral vector, the positive control lentiviral vector containing the LINC01480 gene fragment and the RT-qPCR reaction system were assembled into a kit.

6. The method for preparing a kit for detecting LINC01480 gene expression according to claim 5, characterized in that: The preparation of the negative control lentiviral vector includes using the GV367 vector as a basic vector, and preparing it by not cloning or cloning a non-functional LINC01480 gene fragment into the GV367 vector; The preparation of the positive control lentiviral vector containing the LINC01480 gene fragment includes using a GV367 vector as a basic vector and cloning the LINC01480 gene fragment into the GV367 vector for preparation.

7. The method for preparing a kit for detecting LINC01480 gene expression according to claim 5, characterized in that: Prepare the RT-qPCR reaction system including: Total RNA from the samples was extracted using the SteadyPure Rapid RNA Extraction Kit; The extracted RNA was reverse transcribed into cDNA using lnRcute lncRNA First-Strand cDNA Kit; The qPCR reaction system was prepared using the lnRcute lncRNA fluorescence quantitative detection kit.

8. The method for preparing a kit for detecting LINC01480 gene expression according to claim 7, characterized in that: The RT-qPCR reaction system comprises: 2xInR IncRNAPreMix, which is configured to provide the premixed reagents required for qPCR reactions; 50xROX Reference Dye, used to normalize the fluorescence signal; RNase-Free ddH2O, used for preparing and / or diluting reaction systems.

9. The method for preparing a kit for detecting LINC01480 gene expression according to claim 3, characterized in that: The method of extracting total RNA from a sample using the SteadyPure rapid RNA extraction kit also includes purifying the RNA.

10. An application of a kit for detecting LINC01480 gene expression, characterized in that: The method comprises using the kit according to any one of claims 1 to 4 to monitor the MRD of MM patients after treatment.

Images