Multiplex Quantitative Detection Method and Kit for Activation of the Polymorphic Interferon Pathway

Abstract

The present invention discloses a genome for detecting the activation of multiple interferon pathways and its corresponding primer set, including primers for amplifying the genes of IFI44, MX1, IRF1, and GBP1. By combining the detection primer set with the internal reference gene HPRT1, a multiplex detection method has been developed, which can simultaneously perform accurate quantitative analysis on genes in patient samples, thereby achieving the typing of type I / II interferon pathways in one reaction and having high specificity and sensitivity. The detection method developed by the present invention simultaneously detects four target genes. Through clinical verification, its quantitative results are highly consistent with the results of separately detecting the four genes, greatly improving the detection efficiency while ensuring the reliability of the quantitative results. Combining the specificity of the screened genes and the reliability of the quadruple quantitative detection, the present invention can accurately identify the molecular mechanism causing autoimmune diseases and evaluate the development of the disease, providing effective guidance for clinical diagnosis and precision treatment.

Description

Technical Field

[0001] The present invention relates to the field of precise detection, and particularly to a primer set for detecting the activation of multiple interferon pathways and its application. Background Art

[0002] Interferons are important immunomodulatory molecules, including type I (including IFN-α and IFN-β) and type II (IFN-γ), and play a key role in various diseases involving the immune system: In viral infectious diseases, the interferon response constitutes the first line of defense of the body against viral infection and can regulate effector cells of almost all innate and adaptive immune responses. In multiple diseases caused by viral infections, such as AIDS, hepatitis, etc., interferons can be used to activate the autoimmune response and help clear the virus. In various diseases including those caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), interferons can be used to monitor the occurrence, development, and prognosis of the disease.

[0003] In cancer, interferons usually play a beneficial role in promoting anti-tumor immune responses, and are also used to evaluate the activity of the immune system, the response to drugs, and the prediction of efficacy, etc. In sepsis, COVID-19 and other conditions, the cause of death of patients is often organ failure caused by cytokine storms. Among them, IFN-γ is a key cytokine inducing apoptosis, and its large-scale overexpression is considered to be the main cause of overactivation of the immune system, leading to cytokine storms, and ultimately resulting in organ failure. In the occurrence and development of autoimmune diseases such as systemic lupus erythematosus (SLE), dermatomyositis, and rheumatoid arthritis, abnormal activation of interferon-related pathways plays a key role. In different autoimmune diseases, the types and degrees of interferon pathway activation are different. For example, there is abnormal activation of the type I interferon pathway in SLE. At present, the main means of treating autoimmune diseases is still to use drugs such as hormones and immunosuppressants to inhibit the body's immune response. However, these drugs cannot solve the root cause of the disease, and long-term use has serious side effects. Currently, targeted drugs for different interferon pathways have been approved or are in the final stage of clinical trials abroad for the treatment of autoimmune diseases. Therefore, identifying and classifying the interferon-activated pathways in patients is the future development direction, which can accurately guide drug use and achieve more precise, effective, and lower-side-effect treatment. At the same time, quantitative analysis of the degree of interferon pathway activation can enable more effective diagnosis of patients with autoimmune diseases and more accurate assessment of the disease development. However, there is currently a lack of corresponding diagnostic products on the market.

[0004] Quantitative analysis of the activation status of the interferon pathway can help with effective disease analysis, prognosis assessment, medication guidance, treatment efficacy monitoring, etc. for various diseases. Currently, the diagnosis of such diseases including autoimmune diseases in clinical practice mainly relies on clinical symptoms and manifestations, highly depends on doctors' clinical experience and is difficult to achieve accurate quantitative assessment. Specific antibodies produced in the blood are also often used to assist in diagnosis, but there is a disconnect between these antibodies and the disease progression. Often, the patient's symptoms have alleviated while the antibodies still remain. The direct detection of interferon itself is a clinical diagnostic technique that is being vigorously developed. Interferons are present in very low levels in the blood, and their minute fluctuations can have a significant effect, making detection difficult and it is hard to directly use them for disease assessment. On the other hand, interferons achieve their effects by binding to receptors on immune cells and activating related intracellular pathways; the activation of these pathways will cause the activation and upregulation of a series of downstream ISG genes (IFN-stimulated genes) in immune cells (such as PBMC, peripheral blood mononuclear cells); the monitoring of the expression of these genes is a more direct means of assessing the activation status of the interferon pathway.

[0005] On the other hand, the characteristic genes related to the activation of type I interferons have been reported more in the literature and are used to measure the activation of the type I interferon pathway. Type II interferon-related genes have also been reported. However, the problems with these genes include: low expression levels themselves, difficult to detect; the expression changes caused by the activation of the type II interferon pathway are too small to identify and quantify the pathway activation; poor specificity, and they can also be activated by type I interferons. There are no methods or products on the market that can reliably, specifically, and quantitatively detect the activation of the type II interferon pathway.

[0006] Currently, the methods for detecting the activation of the interferon pathway at the molecular level include enzyme linked immunosorbent assay (ELISA) for proteins, and transcriptome analysis for gene expression (RNA-sequencing and microarray) and quantitative reverse transcription polymerase chain reaction (RT-qPCR), etc.

[0007] RNA-sequencing and Microarray have the powerful advantages of large amounts of data, wide coverage of the genome, high data flexibility, and can be used for genomic structure analysis. However, compared with ELISA and RT-PCR, transcriptome analysis is too expensive, takes too long, and has a limited regional coverage.

[0008] Meanwhile, type I interferons are difficult to measure in plasma, rendering ELISA technology usually unable to fully function. There are several deficiencies in the detection of plasma protein levels: 1) Most cytokines, including interferons, are produced near their sites of action and may not necessarily be released into the bloodstream; 2) The serum concentration of interferon molecules, especially IFN-γ itself, is usually very low and difficult to detect. Antibodies against IFN-α exist in most SLE patients, and these antibodies can neutralize the biological activity of IFN-α; 3) In some cases, the network interaction of interferons leads to the continuous expression of ISGs without direct extracellular IFN stimulation / low-concentration stimulation; 4) When applying monoclonal antibodies related to the IFN receptor, directly detecting the IFN level in serum cannot reflect the activation status of downstream pathways.

[0009] RT-qPCR technology is a general method for quantitative analysis of gene expression. First, the RNA product of gene expression is reverse transcribed into DNA, and then the DNA is amplified and quantitatively detected using fluorescence quantitative PCR technology. PCR is a commonly used molecular biology technique that can be used to amplify a trace target nucleic acid sequence (such as the gene sequence to be tested) to a detectable amount. Its principle is to use DNA primers that can recognize the target sequence to specifically bind to the target and, under the action of DNA polymerase, exponentially replicate and amplify the target sequence. Fluorescence quantitative PCR commonly used in molecular diagnosis introduces fluorescently labeled probes on the basis of ordinary PCR and uses the fluorescent signals generated during amplification to perform real-time detection and quantification of the target sequence. In multiplex quantitative PCR technology, specific fluorescent probes for different targets are used and carry different-colored fluorescent labels, enabling multiple targets to be detected simultaneously.

[0010] Currently, the detection of type I interferon-related genes is more common, and usually only the expression of one gene can be detected at a time, that is, single detection. Multiple target genes require multiple reactions for detection, resulting in a multiple increase in the consumption of human and material resources and a multiple decrease in the number of samples that can be detected at one time (detection throughput). Multiplex RT-qPCR technology can solve this problem and detect the expression of multiple target genes simultaneously in one reaction. On the other hand, multiplex detection technology can achieve more accurate quantification. Among multiple gene targets, an internal reference gene that is usually stably expressed in cells can be included, so that the ratio of the gene to be detected relative to the internal reference gene expression can accurately reflect the expression changes of the gene to be detected in cells. Moreover, this relative expression level does not change with the total amount of nucleic acid samples in the reaction, making the detection results minimally affected by cell processing, nucleic acid extraction, and the amount of sample addition, ensuring the repeatability of each result. Nevertheless, the design of multiplex RT-qPCR is quite difficult. As the number of target genes increases, it is easier for the primers and probes required for multiple genes to interfere with and compete with each other, bringing large errors to the quantification of each gene and seriously affecting the reliability of clinical results.

[0011] On the other hand, the genes reported in the literature related to the activation of the type II interferon pathway are significantly fewer than those related to type I, and there are even fewer examples of quantitative detection of type II interferon. At the same time, there is no systematic study on the specificity of these genes for type II interferon. Through testing, we found that the specificity of these type II-related genes for the activation of the type II interferon pathway is generally not high, and the stimulation of type I interferon often can also up-regulate the expression of such genes. In this case, using these genes as markers for the activation of the type II interferon pathway is unreliable.

[0012] Quickly and accurately differentiating the pathogenesis of patients can provide truly effective and targeted treatments, achieve precise diagnosis and treatment for each patient, and replace the current undifferentiated treatment plan for all patients. An example of the importance of precise diagnosis and treatment is AstraZeneca's new drug Saphnelo. This drug is the first type I interferon-targeted SLE drug approved by the US FDA in 10 years. However, in the clinical trials of this drug, more than half of the SLE patients still did not show significant improvement in symptoms. The reason may be that a large number of patients also have activation of the type II interferon pathway, resulting in unsatisfactory effects of only blocking type I interferon. This further highlights the key importance of typing and quantifying the activation of different interferon pathways and establishing corresponding molecular diagnostic tools. Summary of the Invention

[0013] The reasons for various problems in the prior art may lie in that, firstly, there is no targeted systematic screening of type II related genes using quantitative PCR to find genes with high specificity and sufficient expression levels. Therefore, it is also impossible to accurately and reliably detect and quantify the activation of the type II pathway. Additionally, the complexity of multiplex PCR design and the challenge of achieving precise quantification while performing multiplex detection have also led to the absence of corresponding products in the market.

[0014] Through systematic screening, the present invention discovers that the IRF1 gene is highly specific for the activation of the type II interferon pathway, and at the same time has a relatively high expression level and significant changes in expression levels. After verification, it is only upregulated under the stimulation of type II interferon and is minimally affected by type I interferon. Therefore, it is very suitable for monitoring the activation status of the type II pathway. Additionally, genes such as GBP1 and STAT1 that are significantly activated by type II interferon but have slightly lower specificity are screened out.

[0015] The present invention discloses a primer set for detecting the activation of multiple types of interferon pathways, including:

[0016] 1) Primers for amplifying the IFI44 gene; and

[0017] 2) Optionally, primers for amplifying the MX1 gene, primers for amplifying the IRF1 gene, and primers for amplifying GBP1; characterized in that the primer sequences for amplifying the IFI44 gene are respectively as shown in SEQ ID NO:1-2, the primer sequences for amplifying the MX1 gene are respectively as shown in SEQ ID NO:4-5, the primer sequences for amplifying the IRF1 gene are respectively as shown in SEQ ID NO:7-8, and the primer sequences for amplifying the GBP1 gene are respectively as shown in SEQ ID NO:17-18.

[0018] Preferably, the primer set includes:

[0019] 1) Primers for amplifying the IFI44 gene; and

[0020] 2) Primers for amplifying the MX1 gene and primers for amplifying the IRF1 gene.

[0021] Preferably, the primer set includes: 1) Primers for amplifying the IFI44 gene; and 2) Primers for amplifying the IRF1 gene and primers for amplifying GBP1. More preferably, it also includes probes.

[0022] Preferably, the probe binding to the IFI44 gene is as shown in SEQ ID NO:3, the probe binding to the MX1 gene is as shown in SEQ ID NO:6, the probe binding to the IRF1 gene is as shown in SEQ ID NO:9, and the probe binding to the GBP1 gene is as shown in SEQ ID NO:19.

[0023] Preferably, the probe is labeled with a fluorescent group.

[0024] Preferably, it further includes primers for amplifying a reference gene. More preferably, the reference gene is the HPRT1 gene, and the primer sequences for amplifying the reference gene are respectively as shown in SEQ ID NO: 10-11.

[0025] Preferably, it further includes a probe that binds to the reference gene HPRT1.

[0026] Preferably, the probe sequence that binds to the reference gene HPRT1 is as shown in SEQ ID NO: 12.

[0027] The present invention discloses a composition, including the primer set described above.

[0028] The present invention discloses a kit for detecting the activation of the type I interferon pathway, including the primer set or the composition described above.

[0029] The present invention discloses the use of the primer set and / or the composition described above in the preparation of a reagent for detecting the interferon subtype of a patient.

[0030] Preferably, the patient is a patient with systemic lupus erythematosus.

[0031] The present invention discloses an RT-qPCR amplification method of the primer set, including:

[0032] (1) Adding the primers in the primer set of claims 1-8 to an RT-qPCR reaction mixture to establish an RT-qPCR reaction system;

[0033] (2) Reacting under the following conditions: 55°C, 10 minutes; 95°C, 1 minute; 45 cycles of "95°C, 5 seconds, 60°C, 10 seconds".

[0034] Preferably, the concentrations of the respective primers in the reaction system are 0.1-0.06 μM, more preferably 0.08 μM.

[0035] Preferably, the RT-qPCR reaction system is: 12.5 μL of 2×RT-qPCR reaction mixture, 1 μL of reverse transcriptase, 0.16 μL of each primer in the primer set of claims 1-8 with a concentration of 10 μM, 0.16 μL of each probe of the respective genes of claims 1-8 with a concentration of 10 μM, 1 μL of the RNA sample to be tested, and adding an appropriate amount of pure water to a total reaction volume of 20 μL.

[0036] Preferably, the method is for non-disease diagnosis and / or non-therapeutic purposes.

[0037] Furthermore, by combining IRF1 and other type II interferon-related genes with two type I-related signature genes (IFI44 and MX1), and incorporating the reference gene HPRT1, a new multiplex assay was developed that can precisely quantify these genes simultaneously in patient samples, enabling the typing of the type I / II interferon pathways and the quantification of their respective activation levels in a single reaction.

[0038] The multiplex assay of the present invention includes four genes including the reference gene, the sequences of the corresponding four sets of primer-probes, and the RNA sequences (covering all and partial sequences) of the transcripts of their respective targeted genes.

[0039] The quadruple assay developed by the present invention simultaneously detects four target genes. After validation with clinical samples, its quantitative results are highly consistent with those obtained by separately detecting the four genes individually, thus greatly improving the detection efficiency while ensuring the reliability of the quantitative results.

[0040] Combining the specificity of the screened genes and the reliability of the quadruple quantitative detection, the present invention can more precisely identify the molecular mechanisms underlying autoimmune diseases and evaluate the progression of the disease, providing effective guidance for clinical diagnosis and precision treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 It is a diagram showing the screening results of each gene.

[0042] Figure 2 It is a schematic diagram showing the design principle of amplification primers.

[0043] Figure 3 It is a graph showing the amplification curve of the relative expression level of ISG.

[0044] Figure 4 It shows the expression of two different SLG combinations in SLE case 1.

[0045] Figure 5 It shows the expression of two different SLG combinations in SLE case 2.

[0046] Figure 6 It shows the expression of two different SLG combinations in SLE case 3.

[0047] Figure 7 It is the quantitative detection results of each gene at different RNA dilution concentrations.

[0048] Figure 8 It is the change in the relative expression level of each gene at different RNA concentrations.

[0049] Figure 9 It is for detection specificity.

[0050] Figure 10 For the multiplex quantitative detection of clinical patient samples and the analysis of the activation status of the interferon pathway. Specific implementation mode

[0051] The following examples further illustrate the content of the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and essence of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention all fall within the scope of the present invention.

[0052] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0053] Example 1 Gene selection for the simultaneous quantitative detection of the activation of type I and type II interferon pathways

[0054] Common reference genes include RPS18, ACTB, B2M, GUSB, GAPDH, HPRT1, MT-ATP6, RPS17, RPL13a, SDHA, UBE2D2, etc. Their expression levels in cells are usually very stable. Therefore, the relative expression level changes of other genes relative to them can be used for relative quantification. At the same time, compared with other reference genes, the expression of HPRT1 in PBMC cells is more stable, and the expression level is close to the normal expression levels of common type I and type II interferon-related genes, which is conducive to establishing a more accurate quadruple detection. In multiplex gene detection, genes with too high expression levels often occupy too much raw material in the amplification reaction, resulting in abnormal amplification of other genes and deviation of quantitative results. In particular, too high or too low levels of reference genes will seriously affect the accuracy of quantitative results. Other potentially available reference genes can also include RPL13a, SDHA, UBE2D2, GAPDH, etc.

[0055] After determining the reference gene, the expression level of the target gene relative to the reference gene can be calculated by the Ct value (cycle number threshold, the smaller the value, the higher the concentration) of the two genes in the RT-PCR amplification reaction. From the difference in the Ct values of the two genes, the concentration ratio (T / R) of the target gene to the reference gene in the sample can be obtained, that is, the relative expression level of the target gene is as follows: T / R = 2 (内参基因Ct–目标基因Ct) . According to the changes in the T / R value in different samples, the expression changes of the target gene in the samples can be judged.

[0056] First, genes related to the activation of type I and type II interferon pathways were preliminarily screened with the aim of finding genes that are highly specific to the corresponding interferon pathways and have a high enough expression level to improve the sensitivity of molecular detection. The primary screening of type I genes included the most common type I interferon-related signature genes reported in the literature: IFI44, MX1, IFIT1, OAS1, OAS3, RSAD2, USP18. To screen for genes highly specific to the activation of the type II interferon pathway, some genes related to type II interferon have been reported in the literature, but their specificity for the activation of the type II interferon pathway has not been systematically studied. We collected a group of major type II interferon-related genes, including C4BPA, CXCL9, CXCL10, GBP1, ICAM1, IRF1, STAT1, GABBR1, etc. for screening. The primary screening method was to select different patients with autoimmune diseases and detect the expression levels of each gene in their PBMC cells and the change range relative to healthy controls. The selected population included a group of patients with systemic lupus erythematosus (SLE), a group of patients with rheumatoid arthritis (RA), and healthy controls. The screening criteria were as follows:

[0057] 1) Specific genes for the activation of the type I interferon pathway should be generally upregulated in SLE patients and remain unchanged or show little change in RA patients. This is because it is generally believed in the literature that the activation of the type I interferon pathway is a common triggering mechanism for SLE, while the activation of the type II interferon pathway is a triggering mechanism for RA.

[0058] 2) Similarly, specific genes for the activation of the type II interferon pathway should be generally upregulated in RA patients and remain unchanged or show little change in SLE patients.

[0059] 3) In the case of similar specificity, genes with higher expression levels and higher upregulation amplitudes were selected. The Ct value obtained by RT-qPCR detection in PBMC cells of healthy individuals should not be higher than 35.

[0060] According to the above criteria, the candidate type I interferon-related genes obtained from the primary screening were IFI44 and MX1, and the type II interferon candidate genes were IRF1, GBP1, and STAT1. Further interferon activation experiments were carried out to verify these candidate genes. In this experiment, PBMC cells in the blood of healthy individuals were divided into four equal parts and were respectively added with 1) type I interferon (IFNα+); 2) type II interferon (IFNγ+); 3) a mixture of type I and type II (IFNα+IFNγ+); 4) interferon-free control (IFNα-IFNγ-) for culture. The changes in the relative expression levels T / R of each gene under the four conditions are shown in Figure 1 .

[0061] As can be seen from the figure, IFI44 and MX1 are most affected by type I interferon activation, with significantly upregulated expression levels compared to the interferon-free control. At the same time, they are less affected by type II interferon activation, with a certain degree of upregulation in expression. In contrast, GBP1 and STAT1 have a strong response to type II interferon activation, with a large upregulation in expression. At the same time, type I interferon also has an impact on their expression levels, but the upregulation amplitude is much smaller than that caused by type II interferon.

[0062] Different from the above genes is IRF1, which is significantly upregulated under type II interferon activation and has little response to type I interferon, showing excellent specificity for type II interferon.

[0063] Based on the above results, IFI44 and MX1 are mainly type I interferon-induced genes (ISGs) and also have a certain response to type II interferon induction; GBP1 and STAT1 are mainly type II interferon-induced genes and also have a certain response to type I interferon induction; while IRF1 is a very specific interferon-induced gene for type II interferon and is minimally affected by type I interferon.

[0064] In order to simultaneously detect and quantify the activation status of type I and type II interferon pathways, we selected three of the above genes for various combinations, based on the following principles: 1) at least one type I characteristic gene; 2) IRF1 must be included to achieve high specificity for type II. The optimal combinations selected are as follows:

[0065] 1) IFI44, MX1, IRF1;

[0066] 2) IFI44, GBP1, IRF1.

[0067] The verification of these two combinations in clinical samples is shown in Example 3. The first combination was mainly used in other examples cited in this document, but the second combination is also applicable.

[0068] Example 2 Design of Amplification Primers and Probes, and Establishment and Optimization of Reaction System

[0069] The primers were designed following the following principles: using publicly available free primer design tools such as Primer3Plus and using specifically optimized parameters; the upstream and downstream primers must span multiple exon regions in the messenger RNA sequence to avoid amplifying DNA impurities in the sample, thus eliminating the need for the step of removing DNA in sample processing. This is because there are often long intron sequences between different exons in the DNA sequences of these genes. In this way, even if the primers can recognize the exon sequences on the DNA, the large intron sequences in the middle will greatly reduce the amplification efficiency, thus avoiding amplifying the DNA background and only amplifying the gene expression product RNA. (See the schematic diagram of the design principleFigure 2 )。

[0070] The specific design ideas are as follows: 1) The target regions amplified by the primers do not have obvious overlap with non-target regions of the genomes or transcriptomes of humans or other species after Blast alignment. At the same time, there is no sequence overlap among the target regions of the four genes, thus reducing the possibility of non-specific amplification and amplification. 2) There is no obvious overlap among the four sets of primer and probe sequences of the four genes, avoiding mutual interference and the generation of amplification within the primers and probes. 3) The primer length is not less than 20 bases, the melting temperature (Tm) of the primer sequence is about 60 degrees Celsius, and the melting temperature (Tm) of the probe sequence is about 70 degrees Celsius. Too short primers are prone to non-specific amplification. 4) The amplification products of the primers are as short as possible because the amplification efficiency of short fragments is higher.

[0071] According to the above conditions, the following primer and probe sequences are obtained. Among them, the upstream and downstream primers of IRF1 span Exon 7 and 8 of the IRF1 gene, and the amplification product length is 62 base pairs; the upstream and downstream primers of IFI44 span Exon 2, 3, and 4 of its gene, and the amplification product length is 76 base pairs; the upstream and downstream primers of MX1 span Exon 18 and 19 of its gene, and the amplification product length is 74 base pairs; the upstream and downstream primers of GBP1 span Exon 1 and 2 of its gene, and the amplification product length is 81 base pairs; the upstream and downstream primers of HPRT1 span Exon 6 and 7 of its gene, and the amplification product length is 72 base pairs; the upstream and downstream primers of STAT1 span Exon 10 and 11 of its gene, and the amplification product length is 97 base pairs.

[0072] Primers and probes designed for each gene (in the order from the 5'-end to the 3'-end; the 5'-end of the probe is attached with different fluorescent groups, while the 3'-end is attached with a fluorescence quenching group):

[0073] 1) IFI44:

[0074] Primer F: 5'-TTCGATGCGAAGATTCACTG-3' (SEQ ID NO:1).

[0075] Primer R: 5'-AAGGCAGACAGTAAGCTCTT-3' (SEQ ID NO:2).

[0076] Probe: 5'- / Texas Red / -TGAAAGAAAGATAAAAGGGGTCATTGAGCTCAGG- / BHQ-2 / -3' (SEQID NO:3).

[0077] 2) MX1:

[0078] Primer F: 5’-GATCTTTCAGCACCTGATGG-3’ (SEQ ID NO:4).

[0079] Primer R: 5’-GGATGATCAAAGGGATGTGG-3’ (SEQ ID NO:5).

[0080] Probe: 5’- / Cy5 / -CACCAGGAGGCCAGCAAGCG- / BHQ-3 / -3’ (SEQ ID NO:6).

[0081] 3) IRF1:

[0082] Primer F: 5’-ACCAGTGATCTGTACAACTTC-3’ (SEQ ID NO:7).

[0083] Primer R: 5’-TCTGTTGTAGCTTCAGAGGT-3’ (SEQ ID NO:8).

[0084] Probe: 5’- / FAM / -CAGGTGTCACCCATGCCCTCC- / BHQ-1 / -3’ (SEQ ID NO:9).

[0085] 4) GBP1:

[0086] Primer F: 5’-ACAGAAGTGCTAGAAGCCA-3’ (SEQ ID NO:17).

[0087] Primer R: 5’-TCTCTGATGCCATGTCCA-3’ (SEQ ID NO:18).

[0088] Probe: 5’- / Cy5 / -AGGAGAAAAAGAACAGACAAGGGAACAGC- / BHQ-3 / -3’ (SEQ ID NO:19).

[0089] 5) HPRT1:

[0090] Primer F: 5’-AATCCAAAGATGGTCAAGGTCG-3’ (SEQ ID NO:10).

[0091] Primer R: 5’-GTCTGGCTTATATCCAACACTTCG-3’ (SEQ ID NO:11).

[0092] Probe: 5’- / HEX / -AGCTTGCTGGTGAAAAGGACCCCA- / BHQ-1 / -3’ (SEQ ID NO:12).

[0093] 6) STAT1:

[0094] Primer F: 5’-CGAACATGACCCTATCACAA-3’ (SEQ ID NO:21).

[0095] Primer R: 5’-TCTTTCCACCACAAACGAG-3’ (SEQ ID NO:22).

[0096] Probe: 5’- / Cy5 / -TGGGACCGCACCTTCAGTCTTTTCC- / BHQ-3 / -3’ (SEQ ID NO:23).

[0097] RNA sequences of the transcripts of the corresponding genes targeted by the primers in each group (in the order from the 5’ end to the 3’ end):

[0098] 1) IFI44: 5’-UCGAUGCGAAGAUUCACUGGAUGAAAGAAAGAUAAAAGGGGUCAUUGAGCUCAGGAAGAGCUUACUGUCUGCCUU-3’ (SEQ ID NO:13).

[0099] 2) MX1: 5’-GAUCUUUCAGCACCUGAUGGCCUAUCACCAGGAGGCCAGCAAGCGCAUCUCCAGCCACAUCCCUUUGAUCAUCC-3’ (SEQ ID NO:14).

[0100] 3) IRF1: 5’-ACCAGUGAUCUGUACAACUUCCAGGUGUCACCCAUGCCCUCCACCUCUGAAGCUACAACAGA-3’ (SEQ ID NO:15).

[0101] 4) GBP1: 5’-ACAGAAGUGCUAGAAGCCAGUGCUCGUGAACUAAGGAGAAAAAGAACAGACAAGGGAACAGCCUGGACAUGGCAUCAGAGA-3’ (SEQ ID NO:20).

[0102] 5) HPRT1: 5’-AAUCCAAAGAUGGUCAAGGUCGCAAGCUUGCUGGUGAAAAGGACCCCACGAAGUGUUGGAUAUAAGCCAGAC-3’ (SEQ ID NO:16).

[0103] 6) STAT1: 5’-CGAACAUGACCCUAUCACAAAAAACAAACAAGUGUUAUGGGACCGCACCUUCAGUCUUUUCCAGCAGCUCAUUCAGAGCUCGUUUGUGGUGGAAAGA-3’ (SEQ ID NO:24).

[0104] The composition of the RT-qPCR reaction is as follows: 12.5 μL of 2X RT-qPCR reaction mixture (NEB Luna UniversalProbe One-Step Reaction Mix), 1 μL of reverse transcriptase (NEB Luna RT Enzyme Mix (20X)), 0.16 μL of primers for each gene at a concentration of 10 μM (including forward and reverse primers), 0.16 μL of probes for each gene at a concentration of 10 μM, 1 μL of the RNA sample to be tested, and an appropriate amount of pure water is added to a total reaction volume of 20 μL.

[0105] RT-qPCR was performed on a Roche LightCycler 480II real-time fluorescence quantitative PCR instrument, and the reaction conditions were as follows:

[0106] 1) 55 °C for 10 minutes; 2) 95 °C for 1 minute; 3) 45 cycles of (95 °C for 5 seconds; 60 °C for 10 seconds).

[0107] The RNA extracted from the patient's peripheral blood mononuclear cells (PBMC) was added to the pre-prepared standard RT-qPCR reaction solution, and then placed in a real-time fluorescence PCR instrument to run the pre-set reaction program. The quantitative results of each gene can be obtained in about one hour. The principle is as follows: Under suitable temperature conditions, the reverse transcriptase in the reaction solution converts RNA into DNA molecules. If there is an expression product of a certain target gene in the original sample, the primers designed for this gene will selectively bind to it and use the DNA polymerase in the reaction solution for amplification. During this process, the probe of this gene will generate a fluorescence signal to indicate the presence of the target. Probes for different genes produce different colors of fluorescence, thus enabling the simultaneous detection of multiple targets.

[0108] In each PCR cycle, the real-time fluorescence quantitative PCR instrument reads the fluorescence signals of each fluorescence channel and plots the amplification curves of each channel based on this. After the reaction ends, using the amplification curves, the instrument automatically calculates the Ct value (cycle number threshold, the smaller the value, the higher the concentration) of the corresponding gene for each channel. The concentration ratio (T / R) of the target gene to the internal reference gene (HPRT1) in the sample can be calculated using the difference in Ct values of the target gene and the internal reference gene as the relative expression level of the target gene: T / R = 2 (内参基因Ct–目标基因Ct)The changes in the expression of each gene in the sample can be determined according to the changes in the T / R value in different samples.

[0109] In the following example, a patient with systemic lupus erythematosus (SLE) and a healthy individual (HC) are taken as examples to illustrate the process of multiplex quantitative detection of gene expression levels, and at the same time demonstrate the differences in the ISG expression levels between the patient and the healthy individual. The RNA of PBMC cells in the blood sample is analyzed by multiplex RT-qPCR, and four amplification curves are obtained simultaneously, representing four different fluorescence channels and their corresponding genes. See the amplification curves in Figure 3 。

[0110] The Ct values obtained by the instrument based on the amplification curves, and the relative expression levels T / R of each gene calculated according to the aforementioned calculation formula T / R = 2 (内参基因Ct–目标基因Ct) are shown in Table 1. It can be seen from the table that there are significant differences in the expression levels (T / R) of each gene relative to the HPRT1 internal reference gene between the patient and the healthy control. Among them, the substantial up-regulation of the relative expression level in the lupus patient fully reflects the activation status of the interferon pathway.

[0111] Table 1: Expression of the combination of IFI44, MX1, and IRF1 in different samples

[0112]

[0113] Optimization of multiplex quantitative detection conditions:

[0114] The conditions of the multiplex RT-qPCR reaction are similar to those of the single reaction. Appropriate primers and probes and the sample to be tested are added to the commercial RT-qPCR reaction solution and mixed for reaction. The main difference is that in the single reaction, there are only two primers (upstream and downstream) and one probe for one target, and only one target is measured at a time; while in the quadruple reaction, there are a total of 8 primers and 4 probes, and four targets need to be accurately measured at a time. The key to achieving multiplex detection is: 1. The sequences of multiple sets of primers and probes do not bind to each other and do not interfere with each other, which is achieved through primer and probe design; 2. The concentrations of the primers and probes should be appropriate, because the raw materials consumed in the amplification reaction in the reaction solution, such as enzymes, dNTPs, magnesium ions, etc., are fixed. Excessive primers will cause excessive consumption of raw materials and affect the quantitative results.

[0115] The ultimate test criterion for multiplex quantitative detection is that the quantitative results obtained from multiplex reactions should be consistent with those of single detection. During our optimization process, we found that the key factor in achieving this goal is the primer concentration. The generally recommended range of primer concentration for single PCR reactions is 0.1 - 1 μM (MicroMolar), while the primer concentrations for multiplex reactions need to be optimized separately. The traditional recommended operation is to set an initial concentration for all primers (such as 0.2 μM). When comparing the multiplex detection results with single detection, for the target with a higher result than the single one, the concentration of its primer should be decreased, and for the target with a lower result, the concentration of its primer should be increased until the multiplex result is consistent with the single one. In practice, we found that such an operation cannot achieve the consistency between multiplex and single results. Adjusting the primer for a certain target does not only affect the detection result of that target but also affects all targets, and the effects on each target lack regularity, which can increase or decrease unpredictably, making the optimization too complex.

[0116] Through experiments, we found that the optimal primer concentration for the commercial RT-qPCR reaction solution we used is 0.08 μM. When the concentrations of all primers are not higher than this value, the multiplex results are very close to the single results. At the same time, the primer concentrations for each target do not need to be optimized separately, greatly simplifying the optimization of multiplex quantitative reactions. As an example, Table 2 shows the comparison of the relative expression levels (T / R) of each gene obtained by single detection and multiplex detection at different primer concentrations in an SLE patient. It can be clearly seen that when the primer concentration is relatively high (0.20 μM), there is a large deviation between the multiplex detection results and single detection, and the higher the T / R value of the gene, the more obvious this deviation is. When the primer concentration is only 0.08 μM, the multiplex and single results are very close and can be used to achieve truly accurate quantification.

[0117] Table 2: Detection results with different primer concentrations used in RT-PCR reactions

[0118]

[0119] Example 3 Multiplex quantitative detection examples of two groups of ISG combinations

[0120] To verify that both of the two groups of ISG combinations selected in Example 1 can be used to construct multiplex quantitative detection reactions with the internal reference HPRT1 to detect and classify the activation status of type I and type II interferon pathways, we first constructed two multiplex detection systems according to the standards in Example 2, which respectively contained the primers and probes for IFI44 / MX1 / IRF1 / HPRT1, and the primers and probes for IFI44 / GBP1 / IRF1 / HPRT1. Then, these two systems were used to detect these two groups of ISG genes in multiple SLE patients and compared with healthy controls. It was found that the detection and classification results of the activation of the interferon pathway by these two groups of genes were consistent.

[0121] SLE case 1: There was no significant upregulation of IRF1, suggesting that type II interferon activation was not obvious; IFI44, MX1, and GBP1 were all significantly upregulated. Given that they are all sensitive to type I interferon activation, both ISG combinations suggest that case 1 was mainly activated by type I interferon. (See Figure 4 ).

[0122] SLE case 2: IRF1 was significantly upregulated, suggesting type II interferon activation; there was no obvious upregulation of IFI44 and MX1, which are sensitive to type I interferon, suggesting that type I interferon was inactive; GBP1 is mainly sensitive to type II interferon, and its upregulation was consistent with the upregulation of IRF1. Both ISG combinations suggest that type II interferon activation was the main factor. (See Figure 5 ).

[0123] SLE case 3: IRF1 was significantly upregulated, suggesting type II interferon activation; IFI44 was slightly upregulated, suggesting a certain degree of activation of type I interferon; GBP1 is sensitive to both type I and type II interferons and may be significantly upregulated under the simultaneous action of type I and type II interferons. Both ISG combinations suggest that type II interferon activation was the main factor but there may be a certain degree of type I interferon activation. (See Figure 6 ).

[0124] Example 4 Changes in the detection limit and relative expression level of multiplex quantitative detection

[0125] To study the detection limit of the multiplex quantitative detection reaction, we extracted the total RNA concentration in PBMC cells from about 2 mL of patient blood, which was approximately 39.4 ng / μL. Then, the RNA sample was serially diluted 4-fold and subjected to multiplex quantitative detection. The results are as Figure 7 .

[0126] As Figure 7 can be seen, for the detection of the IFI44, MX1, and IRF1 genes, even at a 1024-fold dilution (about 38 pg / μL total RNA), a good linear relationship was maintained, while HPRT1, which had a relatively low signal itself, lost its linear relationship after more than a 64-fold dilution (about 0.61 ng / μL total RNA).

[0127] For the most important relative expression level T / R value in multiplex quantitative detection, their values at different dilution degrees are shown in the following figure. As Figure 8 can be seen, up to a 64-fold dilution (about 0.61 ng / μL total RNA), the relative expression level T / R of each gene remained basically unchanged. It was not until a 256-fold dilution when the Ct value of the internal reference was no longer reliable that a large change in the T / R of each gene occurred.

[0128] This result indicates that the detection limit of multiplex quantitative detection depends on the gene with the lowest expression level; meanwhile, the quantitative results of relative expression levels obtained above this detection limit can maintain good consistency.

[0129] Example 5 Specificity of Multiplex Quantitative Detection

[0130] Since all human cells contain these four genes and very likely their expression products, to verify the specificity of multiplex quantitative detection, we used nucleic acid substances extracted from other species as controls. In the following examples, nucleic acid extracts of human PBMC cells, fungal nucleic acid extracts, and water blank controls were respectively added as samples to the multiplex quantitative detection reaction. The obtained amplification curves are as Figure 9 shown. As can be seen from the figure, only the expression products of the four genes can be detected in human cells, while nucleic acid samples without these four genes and blank controls without nucleic acids did not produce any amplification.

[0131] Example 6 Interferon Subtyping of Patients with Systemic Lupus Erythematosus (SLE):

[0132] PBMC cells of dozens of SLE patients were analyzed using multiplex quantitative detection technology. According to the changes in the expression levels of three genes, IFI44, MX1, and IRF1, relative to healthy controls (HC), it was found that the patients could be divided into four different types: 1) only type I interferon activation; 2) only type II interferon activation; 3) simultaneous activation of type I and type II interferons; 4) no activation of type I and type II interferons, as shown below Figure 10 .

[0133] As can be seen from the figure, although all were clinically diagnosed with SLE, there were significant differences in the molecular level and molecular mechanisms among the patients. Some patients only showed upregulation of IFI44 and MX1 while IRF1 remained unchanged, suggesting only the activation of the type I interferon pathway. Some patients had upregulation of IRF1 while IFI44 and MX1 remained unchanged, suggesting only the activation of the type II interferon pathway. More patients had upregulation of all three genes, suggesting that very likely both type I and type II interferon pathways were activated. There were also a few patients with no changes in all three genes, suggesting that there may be other pathogenesis mechanisms. Although it is generally believed that SLE is mainly caused by type I interferon, our results show that type II interferon also plays an important role in it, breaking the previous understanding. A large number of patients had simultaneous activation of both type I and type II interferon pathways, and a small number of patients even had only type II interferon activation.

[0134] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the technical principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention. Sequence Listing <110> Renji Hospital, Shanghai Jiao Tong University School of Medicine <120> Multiplex Quantitative Detection Method and Kit for Activation of Multiple Interferon Pathways <130> 2022 <160> 24 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificially synthesized <400> 1 ttcgatgcgaagattcactg 20 <210> 2 <211> 20 <212> DNA <213> Artificially synthesized <400> 2 aaggcagacagtaagctctt 20 <210> 3 <211> 34 <212> DNA <213> Artificially synthesized <400> 3 tgaaagaaagataaaaggggtcattgagctcagg 34 <210> 4 <211> 20 <212> DNA <213> Artificially synthesized <400> 4 gatctttcagcacctgatgg 20 <210> 5 <211> 20 <212> DNA <213> Artificially synthesized <400> 5 ggatgatcaaagggatgtgg 20 <210> 6 <211> 20 <212> DNA <213> Artificially synthesized <400> 6 caccaggaggccagcaagcg 20 <210> 7 <211> 21 <212> DNA <213> Synthetic <400> 7 accagtgatctgtacaactt c 21 <210> 8 <211> 20 <212> DNA <213> Synthetic <400> 8 tctgttgtagcttcagaggt 20 <210> 9 <211> 21 <212> DNA <213> Synthetic <400> 9 caggtgtcacccatgccctc c 21 <210> 10 <211> 22 <212> DNA <213> Synthetic <400> 10 aatccaaagatggtcaaggt cg 22 <210> 11 <211> 24 <212> DNA <213> Synthetic <400> 11 gtctggcttatatccaacacttcg 24 <210> 12 <211> 24 <212> DNA <213> Synthetic <400> 12 agcttgctggtgaaaaggacccca 24 <210> 13 <211> 75 <212> RNA <213> Synthetic <400> 13 ucgaugcgaagauucacuggaugaaagaaagauaaaaggggucauugagcucaggaagag 60 cuuacugucugccuu 75 <210> 14 <211> 74 <212> RNA <213> Synthetic <400> 14 gaucuuucagcaccugauggccuaucaccaggaggccagcaagcgcaucuccagccacau 60 cccuuugaucaucc 74 <210> 15 <211> 62 <212> RNA <213> Synthetic <400> 15 accagugaucuguacaacuuccaggugucacccaugcccuccaccucugaagcuacaaca 60 ga 62 <210> 16 <211> 72 <212> RNA <213> Synthetic <400> 16 aauccaaagauggucaaggucgcaagcuugcuggugaaaaggaccccacgaaguguugga 60 uauaagccag ac 72 <210> 17 <211> 19 <212> DNA <213> Synthetic <400> 17 acagaagtgctagaagcca 19 <210> 18 <211> 18 <212> DNA <213> Synthetic <400> 18 tctctgatgccatgtcca 18 <210> 19 <211> 29 <212> DNA <213> Synthetic <400> 19 aggagaaaaagaacagacaagggaacagc 29 <210> 20 <211> 81 <212> RNA <213> Synthetic <400> 20 acagaagugcuagaagccagugcucgugaacuaaggagaaaaagaacagacaagggaaca 60 gccuggacauggcaucagaga 81 <210>21 <211>20 <212> DNA <213> Synthetic <400>21 cgaacatgaccctatcacaa 20 <210>22 <211> 19 <212> DNA <213> Synthetic <400>22 tctttccaccacaaacgag 19 <210>23 <211> 25 <212> DNA <213> Synthetic <400>23 tgggaccgcaccttcagtcttttcc 25 <210> 24 <211>97 <212> RNA <213> Synthetic <400> 24 cgaacaugacccuaucacaaaaaacaaacaaguguuaugggaccgcaccuucagucuuuu 60 ccagcagcucauucagagcucguuugugguggaaaga 97

Claims

1. Detection primer set for activation of the polymorphic interferon pathway, comprising: 1) Primers for amplifying the IFI44 gene; 2) Primers for amplifying the MX1 gene; and 3) Primers for amplifying the IRF1 gene; It is characterized in that the primer sequences for amplifying the IFI44 gene are respectively as shown in SEQ ID NO: 1-2, the primers for amplifying the MX1 gene are respectively as shown in SEQ ID NO: 4-5, and the primers for amplifying the IRF1 gene are respectively as shown in SEQ ID NO: 7-8.

2. The detection primer set according to claim 1, characterized in that It also includes probes, wherein the probe binding to the IFI44 gene is as shown in SEQ ID NO: 3, the probe binding to the MX1 gene is as shown in SEQ ID NO: 6, and the probe binding to the IRF1 gene is as shown in SEQ ID NO:

9.

3. The primer set according to claim 2, characterized in that The probe is labeled with a fluorescent group.

4. The primer set according to claim 2, characterized in that It also includes primers for amplifying an internal reference gene, and the internal reference gene is the HPRT1 gene.

5. The primer set according to claim 4, characterized in that The primer sequences for amplifying the internal reference gene are respectively as shown in SEQ ID NO: 10-11.

6. The primer set according to claim 5, characterized in that It also includes a probe binding to the internal reference gene HPRT1, and the probe sequence binding to the internal reference gene HPRT1 is as shown in SEQ ID NO:

12.

7. A composition, characterized in that It includes the primer set according to any one of claims 1-6.

8. A kit for detecting activation of the polymorphic interferon pathway, characterized in that It includes the primer set according to any one of claims 1-6 or the composition according to claim 7.

9. Use of the primer set according to any one of claims 1-6 and / or the composition according to claim 7 in the preparation of a reagent for detecting interferon typing in a patient.

10. The use according to claim 9, characterized in that The disease suffered by the patient is systemic lupus erythematosus.

11. The use according to claim 9, characterized in that The reagent is used for RT-qPCR amplification to type interferons in the patient, and the RT-qPCR amplification method includes: (1) Add the primers in the primer set according to any one of claims 1-6 to the RT-qPCR reaction mixture to establish an RT-qPCR reaction system; (2) React under the following conditions: 55 °C, 10 minutes; 95 °C, 1 minute; 45 cycles: 95 °C, 5 seconds, 60 °C, 10 seconds.

12. The use according to claim 11, characterized in that The concentration of each primer in the reaction system is 0.01-0.1 μM.

13. The use according to claim 12, characterized in that The concentration of each primer in the reaction system is 0.08 μM.

14. The use according to claim 12, characterized in that The RT-qPCR reaction system is: 12.5 μL of 2-fold RT-qPCR reaction mixture, 1 μL of reverse transcriptase, 0.16 μL of each primer in the primer set according to any one of claims 1-6 with a concentration of 10 μM, 0.16 μL of the probe for each gene in the primer set according to any one of claims 1-6 with a concentration of 10 μM, 1 μL of the RNA sample to be tested, and add an appropriate amount of pure water to a total reaction volume of 20 μL.

Images