Composition for preventing and treating blueberry root and stem diseases and application thereof

Abstract

The present invention belongs to the technical field of microorganism and plant disease prevention and control, and specifically, relates to a composition for preventing and controlling blueberry root and stem diseases and its application, wherein the composition comprises: a) Bacillus amyloliquefaciens, b) bamboo shoot fiber powder, corn pollen polysaccharide, cattle bone meal, mineral potassium humate and polyglutamic acid, and c) biomass power plant ash; wherein the preservation number of Bacillus amyloliquefaciens is CCTCC NO: M20221206. Applying the composition during the blueberry planting process can significantly reduce the content of fungal toxins such as fusaric acid, fumonisin and trichothecene in the rhizosphere soil of blueberries, increase the content of resistance substances such as salicylic acid, jasmonic acid and phenolic substances in the root system, and reduce the fungal toxins caused by Fusarium solani ( Fusarium solani ), Fusarium equisetum ( Fusarium horsetail ), and / or, Pythium ( Pythium sterile )、Rhizoctonia solani( Rhizoctonia solani )、Fusobacterium spp. Neofusicoccus minor ) to measure the disease index of blueberry rhizome diseases caused by infection, and ultimately achieve effective prevention and control of blueberry rhizome diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganism and plant disease prevention and control, and specifically relates to a composition for preventing and controlling blueberry root and stem diseases and an application thereof. Background Art

[0002] Blueberry, also known as blue berry, is a kind of blueberry in the Vaccinium genus of the Vaccinium family (Vacciniaceae). Blueberry ) plant, belonging to perennial deciduous or evergreen shrubs or small shrubs. With the continuous introduction of excellent varieties, the improvement of market awareness and the improvement of storage and transportation technology, China has become the main blueberry planting area in the world. In my country, it is mainly distributed in the northeast and southwest regions, among which Yunnan Province has as many as 46 species, accounting for almost half of the blueberry species in my country.

[0003] Fusarium solani ( Fusarium solani ), Fusarium equisetum ( Fusarium horsetail )、Pythium( Pythium barren )、Rhizoctonia solani( Rhizoctonia solani )、Fusobacterium spp.( Neofusicoccus small ) is a typical destructive soil-borne disease that mainly harms the roots. After the roots are infected, the plants show obvious symptoms, and the overall weakening trend is like the symptoms of nutrient deficiency. The leaves turn green and yellow, and the lateral roots first necrotize and rot, and then spread to the entire root system, resulting in slow plant growth and complete death of the plant, which has a serious impact on the growth of blueberries. In severe cases, blueberries will be completely extinct, greatly endangering the healthy, orderly and rapid development of the blueberry industry. At present, chemical control is still the main means of prevention and control of blueberry root rot. Blueberry root rot is mainly caused by a variety of fungi. These pathogens are of various types and may vary depending on the region, climatic conditions and cultivation management methods. Therefore, it is a major challenge to accurately identify pathogens and formulate targeted prevention and control measures. The occurrence of blueberry root rot is closely related to factors such as soil moisture, temperature, and air permeability. The complexity and variability of environmental factors make prevention and control more difficult. At present, the prevention and control methods of blueberry root rot mainly include agricultural control, chemical control and biological control. However, these methods all have certain limitations. For example, although chemical control is effective, long-term use of pesticides can lead to environmental pollution and the development of bacterial resistance. Although biological control is environmentally friendly, the screening and application of biocontrol bacteria requires a long time and high technical costs. Agricultural control requires farmers to have rich experience and skills, and the implementation effect is affected by many factors. In order to effectively control the occurrence and spread of blueberry root rot, farmers, scientific research institutions and government departments need to work together to strengthen disease monitoring and early warning, and develop new control technologies and products. Summary of the invention

[0004] The purpose of the present invention is to provide a composition for preventing and treating blueberry root and stem diseases and its application in view of the technical difficulties such as diversity of blueberry root rot pathogens, complex disease environment, limited prevention and control methods, rapid disease spread and difficulty in comprehensive prevention and control. The composition provided by the present invention can significantly reduce the content of mycotoxins such as fusaric acid, fumonisin and trichothecenes in the rhizosphere soil of blueberries, increase the content of resistance substances such as salicylic acid, jasmonic acid and phenolic substances in the root system, and reduce the content of resistant substances such as fusarium solani ( Fusarium solani ), and / or, Fusarium equisetum ( Fusarium horsetail ), and / or, Pythium ( Pythium sterile ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and / or, Fusarium spp. Neofusicoccus minor ) to measure the disease index of blueberry rhizome diseases caused by infection, and ultimately achieve effective prevention and control of blueberry rhizome diseases.

[0005] To achieve the above object, the first aspect of the present invention provides a composition for preventing and controlling blueberry root and stem diseases, comprising the following components:

[0006] Component 1: optional Bacillus amyloliquefaciens;

[0007] Component 2: bamboo shoot fiber powder, corn pollen polysaccharide, cattle bone meal, mineral potassium humate and polyglutamic acid;

[0008] Component 3: Biomass power plant ash.

[0009] Furthermore, in the composition, the content of component 1 is 0 to 5% by weight, the content of component 3 is 0 to 30% by weight, and the balance is component 2.

[0010] Further, in the composition, the amount of Bacillus amyloliquefaciens in the component 1 is such that the content of Bacillus amyloliquefaciens in the composition is 2×10 9 ~5×10 9 cfu / g; and / or, in component 2, the weight ratio of bamboo shoot fiber powder, corn pollen polysaccharide, cattle bone meal, mineral potassium humate and polyglutamic acid is 51-76:10-20:10-20:3-6:1-3.

[0011] Further, in the composition, the bamboo shoot fiber powder has an organic matter content of 40 to 50% by weight, calculated on a dry matter basis; and / or, the corn pollen polysaccharide has a polysaccharide content of 50 to 60% by weight, and a flavonoid content of 5 to 10% by weight, calculated on a dry matter basis; and / or, the cattle bone meal has a CaH2PO4 content of 30 to 35% by weight, and a protein content of 20 to 30% by weight, calculated on a dry matter basis; and / or, the mineral source potassium humate has a fulvic acid content of 50 to 60% by weight, and a potassium oxide content of 30 to 40% by weight, calculated on a dry matter basis; and / or, the polyglutamic acid has a polyglutamic acid content of 5 to 10% by weight, calculated on a dry matter basis; and / or, the biomass power plant ash has a silicate content of 15 to 25% by weight, and a potassium salt content of 3 to 6% by weight, calculated on a dry matter basis; and / or, the preservation number of the Bacillus amyloliquefaciens is CCTCC NO: M20221206.

[0012] The second aspect of the present invention provides the use of the above-mentioned composition in reducing the fungal toxicity in the rhizosphere soil of blueberries, and / or improving the resistance substances of the blueberry root system, and / or preventing and controlling the root and stem diseases of blueberries.

[0013] Furthermore, the crop is blueberry, and the pathogen causing the blueberry root disease is Fusarium solani ( Fusarium solani ), and / or, Fusarium equisetum ( Fusarium horsetail ), and / or, Pythium ( Pythium sterile ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and or, Fusarium spp. Neofusicoccus minor ).

[0014] The third aspect of the present invention provides a method for reducing fungal toxicity in rhizosphere soil of blueberries, and / or improving resistance substances of blueberry roots, and / or preventing and controlling rhizomes and stem diseases of blueberries, characterized in that the composition is applied to the rhizosphere soil of crops, and the amount of the composition applied to the rhizosphere soil of crops is 40-60 kg / 667 m 2 / times, application frequency 3 times during the entire reproductive period.

[0015] Through the above technical solution, the present invention can at least achieve the following beneficial effects:

[0016] (1) When the microbial composition provided by the present invention is applied to the soil, it can significantly reduce the content of mycotoxins such as fusaric acid, fumonisin and trichothecenes in the rhizosphere soil of blueberries, thereby reducing the infection of pathogens, thereby reducing the risk of Fusarium solani ( Fusarium solani ), and / or, Fusarium equisetum ( Fusarium horsetail ), and / or, Pythium ( Pythium barren ), and / or, Rhizoctonia solani ( Rhizoctonia solani), and / or, Fusarium spp. Neofusicoccus minor ) Disease index of blueberry root and stem diseases caused by infection.

[0017] (2) When the microbial composition provided by the present invention is applied to the soil, it can significantly increase the content of resistance substances such as salicylic acid, jasmonic acid and phenolic substances in the root system of blueberries, thereby improving the immunity of crops and enhancing their resistance to Fusarium solani ( Fusarium solani ), and / or, Fusarium equisetum ( Fusarium horsetail ), and / or, Pythium ( Pythium sterile ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and / or, Fusarium spp. Neofusicoccus minor ) to improve resistance to blueberry root and tuber diseases caused by infection.

[0018] Biological Deposit

[0019] The Bacillus amyloliquefaciens used in the present invention is classified and named Bacillus amyloliquefaciens SH-53 was deposited in the China Center for Type Culture Collection on August 8, 2022, at 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University, with a deposit number of CCTCCNO: M20221206. The deposit information of the strain has been disclosed in the prior invention patent with application number: CN202211478828.9. DETAILED DESCRIPTION

[0020] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0021] In the present invention, "optional" means that the component is a non-essential component, and those skilled in the art can choose whether to add the component according to actual conditions. In the technical solution provided by the present invention, the purpose of the present invention (such as reducing mycotoxin in the rhizosphere soil of blueberries, improving blueberry root resistance substances, preventing and controlling blueberry root and stem diseases, etc.) can be achieved without adding the "optional" component. If the "optional" component is added, the effect can be further improved.

[0022] In the present invention, Bacillus amyloliquefaciens SH-53 and Bacillus amyloliquefaciens CCTCC No: M20221206 are the same strain, and the two have the same meaning, and their names (numbers) can be used interchangeably.

[0023] The inventors of the present invention isolated and obtained a strain of Bacillus amyloliquefaciens ( Bacillus starch liquefier ), named SH-53, and deposited in the China Center for Type Culture Collection on August 8, 2022, with the deposit number CCTCC No: M20221206.

[0024] The inventors of the present invention found in their research that applying a composition made by mixing bamboo shoot fiber powder, corn pollen polysaccharides, cattle bone meal, mineral potassium humate, polyglutamic acid, biomass power plant ash, etc. in a certain proportion to the rhizosphere soil of blueberries can significantly reduce the content of fungal toxins such as fusaric acid, fumonisin and trichothecenes in the rhizosphere soil of blueberries, and increase the content of resistance substances such as salicylic acid, jasmonic acid and phenolic substances in the roots.

[0025] After further research, the inventors found that applying Bacillus amyloliquefaciens SH-53 alone or together with the above-mentioned composition to the rhizosphere soil of blueberries can significantly reduce the growth of bacteria caused by Fusarium solani ( Fusarium solani ), and / or, Fusarium equisetum ( Fusarium horsetail ), and / or, Pythium ( Pythium barren ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and / or, Fusarium spp. Neofusicoccus minor ) The incidence rate and disease index of rhizome diseases caused by infection, and the prevention and control effect is significant.

[0026] Based on the above findings, the present invention provides a composition for preventing and controlling blueberry root and stem diseases, the composition comprising:

[0027] Component 1: optional Bacillus amyloliquefaciens;

[0028] Component 2: bamboo shoot fiber powder, corn pollen polysaccharide, cattle bone meal, mineral potassium humate and polyglutamic acid;

[0029] Component 3: Biomass power plant ash.

[0030] That is, the composition formula provided by the present invention is any one of the following: (1) Bacillus amyloliquefaciens; (2) and / or, bamboo shoot fiber powder, corn pollen polysaccharide, cattle bone meal, mineral potassium humate, polyglutamic acid; (3) and / or, biomass power plant ash; (4) and / or, Bacillus amyloliquefaciens, bamboo shoot fiber powder, corn pollen polysaccharide, cattle bone meal, mineral potassium humate, polyglutamic acid; (5) and / or, Bacillus amyloliquefaciens, biomass power plant ash, (6) and / or, bamboo shoot fiber powder, corn pollen polysaccharide, cattle bone meal, mineral potassium humate, polyglutamic acid, biomass power plant ash, (7) and / or, Bacillus amyloliquefaciens, bamboo shoot fiber powder, corn pollen polysaccharide, cattle bone meal, mineral potassium humate, polyglutamic acid, biomass power plant ash.

[0031] The inventors found in their research that when the components of the composition are used in a specific weight ratio, the obtained Fusarium solani ( Fusarium solani ), and / or, Fusarium equisetum ( Fusarium horsetail ), and / or, Pythium ( Pythium sterile ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and / or, Fusarium spp. Neofusicoccus minor Therefore, according to a preferred embodiment of the present invention, the total amount of the Bacillus amyloliquefaciens is 0 to 5% by weight, preferably 2 to 5% by weight, and more preferably 4 to 5% by weight, based on the total weight of the composition.

[0032] Preferably, the amount of the bacterial agent is such that the content of Bacillus amyloliquefaciens in the composition is 2×10 9 ~5×10 9 cfu / g, preferably 3×10 9 ~5×10 9 cfu / g, more preferably 4×10 9 ~5×10 9 cfu / g.

[0033] According to a preferred embodiment of the present invention, the weight ratio of bamboo shoot fiber powder, corn pollen polysaccharide, cattle bone meal, mineral potassium humate and polyglutamic acid is 51-76:10-20:10-20:3-6:1-3, preferably 60-76:13-20:13-20:4-6:1.5-3, and more preferably 65-76:16-20:16-20:5-6:2-3.

[0034] According to a preferred embodiment of the present invention, the total amount of the biomass power plant ash is 0 to 30% by weight, more preferably 20 to 30% by weight.

[0035] In the present invention, there is no particular limitation on the raw materials used for the above-mentioned composition (such as bamboo shoot fiber powder, corn pollen polysaccharide, cattle bone meal, mineral potassium humate, polyglutamic acid, biomass power plant ash), which can be any related product in the art that can be used to prepare the composition, and can be either commercially available related products or related products prepared by the prior art.

[0036] The inventors found in the study that when specific raw materials are used, the disease control effect obtained is better. Therefore, according to a preferred embodiment of the present invention, in the bamboo shoot fiber powder, the organic matter content is 40-50% by weight, preferably 43-50% by weight, and more preferably 46-50% by weight, based on dry matter. In the corn pollen polysaccharide, the polysaccharide content is 50-60% by weight, preferably 53-60% by weight, and more preferably 56-60% by weight, and the flavonoid content is 5-10% by weight, preferably 7-10% by weight, and more preferably 9-10% by weight. In the cattle bone powder, the CaH2PO4 content is 30-35% by weight, preferably 32-35% by weight, and more preferably 34-35% by weight, and the protein content is 20-30% by weight, preferably 23-35% by weight, and more preferably 26-35% by weight, based on dry matter. In the mineral source potassium fulvic acid, the fulvic acid content is 50-60% by weight, preferably 53-60% by weight, more preferably 56-60% by weight, and the potassium oxide content is 30-40% by weight, preferably 33-60% by weight, more preferably 36-60% by weight. In the polyglutamic acid, the polyglutamic acid content is 5-10% by weight, preferably 7-10% by weight, more preferably 9-10% by weight, based on dry matter. In the biomass power plant ash, the silicate content is 15-25% by weight, preferably 18-25% by weight, more preferably 21-25% by weight, and the potassium salt content is 3-6% by weight, preferably 4-6% by weight, more preferably 5-6% by weight, based on dry matter.

[0037] The present invention further provides a method for preparing the above-mentioned composition. According to a preferred embodiment of the present invention, the method comprises uniformly mixing the bamboo shoot fiber powder, corn pollen polysaccharide, cattle bone meal, mineral potassium humate, polyglutamic acid, and biomass power plant ash of the aforementioned component 2 to obtain a basic formula, and then adding the optional Bacillus amyloliquefaciens and biomass power plant ash to the basic formula according to the aforementioned dosage ratio according to the aforementioned dosage, and mixing evenly.

[0038] In the present invention, there is no particular restriction on the specific storage and use form of the microbial composition. Since the raw materials used in the microbial combination are basically solid, the preparation method is only to mix the components in proportion. Therefore, the microbial composition can be directly stored or used in the form of a solid preparation. Considering the differences in different crops or planting methods and planting conditions, the composition can also be mixed with a certain amount of water to prepare a liquid or slurry (suspension) preparation for storage or use.

[0039] The Bacillus amyloliquefaciens provided in the second aspect of the present invention, or the composition described in the first aspect, is used in reducing fungal toxicity in rhizosphere soil of blueberries, and / or improving resistance substances of blueberry roots, and / or preventing and controlling root and stem diseases of blueberries.

[0040] According to a preferred embodiment of the present invention, the crop is blueberry.

[0041] In the present invention, the fungal toxins in the rhizosphere soil of blueberry refer to fusaric acid, fumonisin and trichothecenes; and the root resistance substances refer to salicylic acid, jasmonic acid and phenolic substances in the root system of blueberry.

[0042] In the present invention, preventing and controlling crop root diseases refers to preventing or reducing the occurrence of crop diseases, or reducing the losses caused by the diseases after the diseases occur.

[0043] Preferably, the crop diseases are selected from blueberry root and stem diseases.

[0044] According to some preferred embodiments of the present invention, the pathogen causing the blueberry root and stem disease is Fusarium solani ( Fusarium solani ), and / or, Fusarium equisetum ( Fusarium horsetail ), and / or, Pythium ( Pythium sterile ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and / or, Fusarium spp. Neofusicoccus minor ).

[0045] The third aspect of the present invention provides a method for controlling rhizomes diseases of blueberries using a composition for controlling rhizomes diseases of blueberries, the method comprising applying the composition of the first aspect to the rhizosphere soil of blueberries.

[0046] That is, the above method may include the following ways:

[0047] (1) Applying Bacillus amyloliquefaciens directly to the rhizosphere soil of crops (usually, this can be done by directly applying a solid bacterial agent to the rhizosphere soil of crops, or by culturing Bacillus amyloliquefaciens and then applying the culture to the soil);

[0048] (2) applying the composition without Bacillus amyloliquefaciens to the rhizosphere soil of the crop;

[0049] (3) Applying a composition containing Bacillus amyloliquefaciens to the rhizosphere soil of crops.

[0050] In the present invention, the crop is blueberry.

[0051] Preferably, the pathogen causing the blueberry root disease is Fusarium solani ( Fusarium solani ), and / or, Fusarium equisetum ( Fusarium horsetail ), and / or, Pythium ( Pythium barren ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and / or, Fusarium spp. Neofusicoccus minor ).

[0052] The specific features of the Bacillus amyloliquefaciens and the composition used in the method provided by the present invention are as described above and will not be repeated here.

[0053] In the present invention, there is no particular limitation on the specific dosage of the Bacillus amyloliquefaciens and the composition, as long as they can prevent and treat root and tuber diseases.

[0054] According to a preferred embodiment of the present invention, in the above method (1), the amount of Bacillus amyloliquefaciens is such that the content of Bacillus amyloliquefaciens in the composition is 2×10 9 ~5×10 9 The dosage of Bacillus amyloliquefaciens is calculated according to the dosage of the composition and the quantity of Bacillus amyloliquefaciens contained therein, wherein the liquid bacterial agent is converted according to 1 g / mL.

[0055] The inventors of the present invention have also found in their research that when planting different crops, the dosage of the aforementioned Bacillus amyloliquefaciens is also adjusted accordingly, which can further improve the systemic resistance and disease prevention effects of the crops.

[0056] According to some preferred embodiments of the present invention, for the above method (1): when applied to the crop rhizosphere soil, the total amount of the Bacillus amyloliquefaciens is not less than 40-60 kg / 667 m 2 / time, preferably 45-60kg / 667m 2 / time, more preferably 50-60kg / 667m 2 / Second-rate.

[0057] The composition provided by the present invention and Bacillus amyloliquefaciens have a synergistic effect when used together. Therefore, when adopting the above-mentioned method (1), in order to obtain a better effect, the amount of Bacillus amyloliquefaciens used can be appropriately increased compared with the amount of Bacillus amyloliquefaciens used with the bacterial agent in method (3).

[0058] Preferably, for the above method (3): when applied to crops, the total amount of the composition is not less than 40-60 kg / 667 m 2 , preferably 45-60kg / 667m 2 , more preferably 50-60kg / 667m 2 , more preferably 55 to 60 kg / 667 m 2 .

[0059] The present invention will be described in detail below by way of examples. It should be understood that the following examples are only used to further explain and illustrate the present invention, and are not intended to limit the present invention. Example

[0060] In this embodiment, bamboo shoot fiber powder and corn pollen polysaccharide were purchased from Xi'an An'ao Biotechnology Co., Ltd., cattle bone powder was purchased from Jinan Yucai Chemical Co., Ltd., polyglutamic acid was purchased from Yunnan Microbial Fermentation Engineering Research Center Co., Ltd., mineral potassium humate was purchased from Jinan Qinghai Chemical Co., Ltd., and biomass power plant ash was purchased from Anhui Yingtianqing Biotechnology Co., Ltd. The liquid culture medium obtained by expanding the bacterial agent with Bacillus amyloliquefaciens (see CN202211478828.9 for the acquisition method) had a content of 1.5×10 10 cfu / g.

[0061] Table 1 lists the test results of the basic formula raw material components used in the composition, among which the organic matter content in bamboo shoot fiber powder was determined by ultraviolet spectrophotometry; the polysaccharide content in corn pollen polysaccharide was determined by phenol-sulfuric acid colorimetry, and the flavonoid content was determined by ultraviolet spectrophotometry; the CaH2PO4 content in cattle bone meal was determined by titration, the protein content was determined by biuret method, the nitrogen content was determined by Kjeldahl nitrogen determination, and the phosphorus (P2O5) content was determined by ammonium phosphomolybdate volumetric method; the polyglutamic acid and amino acid content in polyglutamic acid was determined by high performance liquid chromatography (HPLC), and the organic matter content was determined by ultraviolet spectrophotometry; the fulvic acid content in mineral potassium fulvic acid was determined by high performance liquid chromatography (HPLC), and potassium oxide was determined by acid-base titration; the silicate content in biomass power plant ash was determined by chemical analysis, and the potassium salt content was determined by atomic absorption flame photometry. The components in the test results are calculated based on the dry matter in the material.

[0062] Table 1 Basic material composition

[0063]

[0064] The microbial composition was prepared according to the formula in Table 2. The specific preparation method included: weighing the raw materials according to the proportions in Table 2, and mixing them evenly to obtain the microbial composition.

[0065] Table 2 Microbial composition formula

[0066]

[0067] According to a preferred embodiment of the present invention, the application frequency of the microbial composition is 1 to 3 times per crop. In order to obtain a better disease prevention effect, according to some preferred embodiments of the present invention, when the microbial composition is applied to blueberries, it is applied once every 20 to 30 days from the time of planting, for a total of 3 times. According to the formula of the microbial composition in Table 2, 40 to 60 kg / 667 m 2 / times (100 plants were planted in each test group).

[0068] During the harvest period, Fusarium solani ( Fusarium solani ), Fusarium equisetum ( Fusarium horsetail )、Pythium( Pythium barren )、Rhizoctonia solani( Rhizoctonia solani )、Fusobacterium spp.( Neofusicoccus minor ) infection, and determined the contents of fungal toxins such as fusaric acid, fumonisin and trichothecenes in the rhizosphere soil and the contents of resistance substances such as lignin, jasmonic acid and salicylic acid in the blueberry roots.

[0069] Fusarium solani of blueberry Fusarium solani ) Root rot investigation and analysis standards:

[0070] Level 0: There are no lesions on the stem and taproot.

[0071] Level 1: There are lesions on the base of the stem and the main root, and the area of ​​the lesions accounts for less than 1 / 4 of the total area of ​​the stem and the main root.

[0072] Level 3: The area of ​​lesions on the stem and taproot accounts for about 1 / 4 to 1 / 2 of the total area of ​​the stem and taproot.

[0073] Level 5: The lesions cover more than 1 / 2 of the stem and taproot area.

[0074] Level 7: The lesions on the stem base and main root are connected and have formed a stem-wrapped phenomenon, but the root system is not necrotic.

[0075] Level 9: The aboveground parts wilt or die.

[0076] Fusarium equisetum Fusarium horsetail ) Root rot investigation and analysis standards:

[0077] Level 0: There are no lesions on the stem and taproot.

[0078] Level 1: There are lesions on the base of the stem and the main root, and the area of ​​the lesions accounts for less than 1 / 4 of the total area of ​​the stem and the main root.

[0079] Level 3: The area of ​​lesions on the stem and taproot accounts for about 1 / 4 to 1 / 2 of the total area of ​​the stem and taproot.

[0080] Level 5: The lesions cover more than 1 / 2 of the stem and taproot area.

[0081] Level 7: The lesions on the stem base and main root are connected and have formed a stem-wrapped phenomenon, but the root system is not necrotic.

[0082] Level 9: The aboveground parts wilt or die.

[0083] Pythium cyanobacteria Pythium barren ) Root rot survey and grading standards:

[0084] Level 0: The whole plant is disease-free.

[0085] Level 1: There are occasional chlorotic spots on the stem, or less than 1 / 2 of the leaves on the diseased side wilt.

[0086] Level 3: There are black streaks on the stem, but they do not exceed 1 / 2 of the stem height, or 1 / 2 to 2 / 3 of the leaves on the diseased side are withered.

[0087] Level 5: The black streaks on the stem exceed 1 / 2 of the stem height but do not reach the top of the stem, or more than 2 / 3 of the leaves on the diseased side wilt.

[0088] Level 7: Black streaks on the stem reach the top of the stem, or all the leaves of the diseased plant wilt.

[0089] Level 9: The diseased plants are basically dead.

[0090] Rhizoctonia solani Rhizoctonia solani ) Root rot survey and grading standards:

[0091] Level 0: There are no lesions on the stem and taproot.

[0092] Level 1: There are lesions on the base of the stem and the main root, and the area of ​​the lesions accounts for less than 1 / 4 of the total area of ​​the stem and the main root.

[0093] Level 3: The area of ​​lesions on the stem and taproot accounts for about 1 / 4 to 1 / 2 of the total area of ​​the stem and taproot.

[0094] Level 5: The lesions cover more than 1 / 2 of the stem and taproot area.

[0095] Level 7: The lesions on the stem base and main root are connected and have formed a stem-wrapped phenomenon, but the root system is not necrotic.

[0096] Level 9: The aboveground parts wilt or die.

[0097] Blueberry Fusarium Neofusicoccus minor ) Root rot survey and grading standards:

[0098] Level 0: There are no lesions on the stem and taproot.

[0099] Level 1: There are lesions on the base of the stem and the main root, and the area of ​​the lesions accounts for less than 1 / 4 of the total area of ​​the stem and the main root.

[0100] Level 3: The area of ​​lesions on the stem and taproot accounts for about 1 / 4 to 1 / 2 of the total area of ​​the stem and taproot.

[0101] Level 5: The lesions cover more than 1 / 2 of the stem and taproot area.

[0102] Level 7: The lesions on the stem base and main root are connected and have formed a stem-wrapped phenomenon, but the root system is not necrotic.

[0103] Level 9: The aboveground parts wilt or die.

[0104] Disease index = [(Σ(number of diseased plants × representative level)) / (total number of plants × highest representative level)] × 100

[0105] Control effect (%) = [(control group disease index - treatment group disease index) / control group disease index] × 100%

[0106] Disease identification:

[0107] Fusarium solani ( Fusarium solani ), Fusarium equisetum ( Fusarium horsetail )、Pythium( Pythium barren )、Rhizoctonia solani( Rhizoctonia solani )、Fusobacterium spp.( Neofusicoccus minor ) were infected with typical root and stem disease samples, and the pathogens were isolated and purified by tissue separation to obtain pure cultures of the pathogens; the pure cultures were inoculated into blueberries according to Koch's postulates to verify the pathogenicity; the pathogens were re-isolated from the diseased tissues to obtain pure cultures identical to the original inoculum. The above verifications indicate the pathogenicity of the isolates to blueberries. Based on the morphological identification of the isolates, ITS / 16S RNA was further used for molecular identification to finally determine the taxonomic status of the pure cultures.

[0108] Fusarium solani Fusarium solani ) ITS gene sequence (SEQ ID NO.1):

[0109] TGGAAGTAAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAAACGTTGCTTCGGCGGGAACAGACGGCCCTGTAACAACGGGCCGCCCCCGCCAGAGGACCCCTAACTCTGTTTTTATAATGTTTTTCTGAGTAAACAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAGGCCCCCGGGCCTGGCGTTGGGGATCGGCAGAAGCCCCCTGTGGGCACACGCCGTCCCTCAAATACAGTGGCGGTCCCGCCGCAGCTTCCATTGCGTAGTAGCTAACACCTCGCAACTGGAGAGCGGCGCGGCCATGCCGTAAAACACCCAACTTCTGAATGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAA

[0110] Fusarium equiseti ( Fusarium horsetail ) ITS sequence (SEQ ID NO.2):

[0111] TCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCTATACGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGGCCCGCCCGAGGACCCTAAACTCTGTTTTTAGTGGAACTTCTGAGTAAAACAAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGGTGTTGGGACTCGCGGTAACCCGCGTTCCCCAAATCGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATAATACACCTCGTTACTGGTAATCGTCGCGGCCACGCCGTAAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAA

[0112] Pythium ( Pythium barren ) ITS sequence (SEQ ID NO.3):

[0113] TTTCCACGTGAATTGTTTTGCTGTACCTTTGGGCTTCGCCGTTGTCTTGTTCTTTTGTAAGAGAAAGGGGGAGGCGCGGTTGGAGGCCATCAGGGGTGCGTTCGTCGCGGTTTCTTTCGTTTGTGGAAACTGGCCCCCGAAGCCTCCCTTTTGGCCACCCCATTTTTTGAATGAAAAACTGATCATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTCTGCCTGGAAGTATGTCTGTATCAGTGTCCGTACACTAAACTTGCCTTTCTTGCGTCGTGTAGTCGTCGCTGGGAATGCGCAGATGTGAGGTTTTGTCTTGCTCTGGCTCGAATTCGTTGGGCAGGAGCAAGTCCCTTTAAAGTCGGACGTGTTTTCTCTCTGCGGTGTGCTGTGTCGGCGCTGGCGGCGCGTGGGACTCTCTTGTCTGTTGACGAGTCTGGCGACCTTTGGCTCGTGCATTGCGGGGTGTGCTCGATTGGCGGTATGTTAGGCTTCGGCT

[0114] Fusicoccum小新壳梭孢菌( Neofusicoccus minor ) ITS sequence (SEQ ID NO.4):

[0115] GGAAGGATCATTACCGAGTTGATTCGAGCTCCGGCTCGACTCTCCCACCCTATGTGTACCTACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGGCGCCCTTTCGGGGGGCTGGCCAGCGCCCGCCAGAGGACCATAAAAACTCCAGTCAGTGAACTTCGCAGTCTGAAAAACAAGTTAATAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAAT GCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCCCCGTCCTCCACGGACGCGCCTTAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGAAAACACCTCGCTTTGGAGCGCACGGCGTCGCCCGCCGGACGAACCTTTGA

[0116] Determination of toxin content in blueberry rhizosphere soil: The contents of fusaric acid, fumonisin and trichothecenes were determined by high performance liquid chromatography (HPLC).

[0117] Determination of the content of resistance substances in blueberry roots: The content of resistance substances such as lignin, jasmonic acid and salicylic acid in blueberry roots was determined by high performance liquid chromatography (HPLC).

[0118] From the data in Tables 3, 4 and 5, it can be seen that when the microbial composition provided by the present invention is applied, the blueberry infected with Fusarium solani ( Fusarium solani ), Fusarium equisetum ( Fusarium horsetail )、Pythium( Pythium sterile )、Rhizoctonia solani( Rhizoctonia solani )、Fusobacterium spp.( Neofusicoccus minor ) infection; it has a good preventive and control effect on root and rhizome diseases caused by blueberry infection; it reduces the content of toxins such as fusaric acid, fumonisin and trichothecenes in the rhizosphere soil of blueberry and increases the content of resistance substances such as lignin, jasmonic acid and salicylic acid in the root system of blueberry, which are significantly stronger than the control.

[0119] Table 3 Test conditions and results of the microbial composition for the prevention and control of blueberry root and stem diseases

[0120]

[0121] *The control group was a blank control group without any bacterial agent.

[0122] Table 4 Test conditions and results of the microbial composition test on the fungal toxin content in blueberry soil

[0123]

[0124] *The control group was a blank control group without any bacterial agent.

[0125] Table 5 Test conditions and results of the microbial composition for the content of blueberry root resistance substances

[0126]

[0127] *The control group was a blank control group without any bacterial agent.

[0128] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

Claims

1. A composition for preventing and controlling blueberry root and stem diseases, characterized in that: The composition comprises: Component 1: Bacillus amyloliquefaciens ( Bacillus amyloliquefaciens ), the deposit number of the Bacillus amyloliquefaciens is CCTCC NO: M20221206; Component 2: bamboo shoot fiber powder, corn pollen polysaccharide, cattle bone meal, mineral potassium humate and polyglutamic acid; Component 3: biomass power plant ash; The composition comprises component 1 in an amount of 0 to 5% by weight, component 3 in an amount of 0 to 30% by weight, and component 2 in an amount of the remainder, and the contents of components 1 and 3 are not 0; the amount of Bacillus amyloliquefaciens in component 1 is such that the content of Bacillus amyloliquefaciens in the composition is 2×10 9 ~5×10 9 cfu / g; in the component 2, the weight ratio of bamboo shoot fiber powder, corn pollen polysaccharide, cattle bone meal, mineral potassium humate and polyglutamic acid is 51-76:10-20:10-20:3-6:1-3.

2. A composition for preventing and controlling blueberry root and stem diseases according to claim 1, characterized in that: In the bamboo shoot fiber powder, the organic matter content is 40-50% by weight, calculated on dry matter; and / or, in the corn pollen polysaccharide, the polysaccharide content is 50-60% by weight, and the flavonoid content is 5-10% by weight, calculated on dry matter; and / or, in the cattle bone meal, the CaH2PO4 content is 30-35% by weight, and the protein content is 20-30% by weight, calculated on dry matter; and / or, in the mineral source potassium humate, the fulvic acid content is 50-60% by weight, and the potassium oxide content is 30-40% by weight, calculated on dry matter; and / or, in the polyglutamic acid, the polyglutamic acid content is 5-10% by weight, calculated on dry matter; and / or, in the biomass power plant ash, the silicate content is 15-25% by weight, and the potassium salt content is 3-6% by weight, calculated on dry matter.

3. Use of the composition according to any one of claims 1 to 2 in reducing mycotoxin in rhizosphere soil of blueberries, and / or improving resistance substances in blueberry roots, and / or preventing and controlling rhizomes of blueberries; the mycotoxin is fusaric acid, and / or fumonisin, and / or trichothecenes; the resistance substance is lignin, and / or salicylic acid, and / or jasmonic acid; the pathogen of rhizomes of blueberries is Fusarium solani ( Fusarium solani ), and / or, Fusarium equisetum ( Fusarium equiseti ), and / or, Pythium ( Pythium sterilum ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and or, Fusarium spp. Neofusicoccum parvum ).

4. The use according to claim 3, characterized in that: The method for preventing and controlling blueberry root and stem diseases comprises applying the composition according to any one of claims 1 to 2 to the rhizosphere soil of the crop, wherein the amount of the composition applied to the rhizosphere soil of the crop is 40 to 60 kg / 667 m 2 / times, application frequency 3 times during the entire reproductive period.

Images