A circular mRNA vaccine for marine aquaculture fish, and its preparation method and application
By preparing a circular mRNA vaccine carrying the NNV virus B1 gene and a lipid nanocarrier, the problem of prevention and control of fish neuronecrosis in the juvenile stage was solved, and efficient, safe and economical vaccine application was achieved.
Patent Information
- Application Number
- CN202510253095.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-05
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2045-03-05
AI Technical Summary
Existing technologies make it difficult to effectively prevent and control fish neuralgia, especially in the juvenile stage, because the NNV virus infection has a high mortality rate and traditional immunization methods are difficult to be effective, and existing vaccines have poor immunization effects in the juvenile stage.
A circular mRNA vaccine for marine aquaculture fish, carrying the B1 gene of the NNV virus, was prepared by chemical synthesis and purification by ethanol precipitation, and then combined with lipid nanocarriers to prepare a stable and efficient vaccine to stimulate strong humoral and cellular immune responses.
It achieves efficient prevention and control of NNV virus in the juvenile fish stage, with a protection efficacy of nearly 90%, high safety, low cost, and suitable for large-scale production.
Smart Images

Figure CN119746051B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine technology, and in particular to a circular mRNA vaccine for marine cultured fish, and a preparation method and application thereof. Background Art
[0002] Fish neural necrosis viruses (NNVs) are highly pathogenic RNA viruses that cause significant economic losses to the global aquaculture industry. Viral nervosa necrosis (VNN), caused by NNV infection, is a Category II infectious disease with extremely high mortality rates in larvae and juveniles, with severe cases reaching 100% mortality within a week. In recent years, the number of infected fish species and the extent of the impact have increased rapidly. NNVs belong to the genus Betanodavirus and the family Nodaviridae and were first identified in Australia in the 1980s. These viruses have a non-enveloped, icosahedral morphology and are approximately 25 nanometers in size. Their genetic information is composed of two positive-sense single-stranded RNAs: 2970 base pairs (RNA1) and 1440 base pairs (RNA2). These RNA molecules lack poly(A) tails at their 3' ends. Despite the long history of NNV, strategies to prevent and control viral neuronecrosis in fish remain challenging. While vertical transmission of the virus can theoretically be prevented by selecting virus-free broodstock, current testing methods make it difficult to guarantee that the selected broodstock are completely free of the virus. Furthermore, while ozone and iodine disinfectants can help reduce horizontal transmission of the virus, surface disinfection alone is insufficient to completely prevent its spread, as the virus may be present both on the surface of fish eggs and within their inner membranes.
[0003] Vaccination is a key strategy for preventing and controlling viral diseases. Although recombinant vaccines can provide some protection in large-scale fish or adults, NNV primarily infects juvenile fish, where their specific immune systems are not yet fully mature, making it difficult to effectively control through traditional immunization methods. In recent years, circular RNA (circRNA) vaccine technology has garnered widespread attention as an innovative vaccine development approach. Circular mRNA vaccines possess remarkable stability and can produce higher levels of antigens with longer-lasting efficacy in vivo. Compared with mRNA vaccines, circular mRNA vaccines induce a higher proportion of neutralizing antibodies, providing more effective protection against viral mutations and reducing the potential side effect of antibody-dependent enhancement (ADE). Furthermore, circular mRNA vaccines induce a higher IgG2 / IgG1 ratio, indicating that they primarily induce a Th1-type protective T cell immune response, effectively reducing the potential side effect of vaccine-associated respiratory disease (VAERD). Circular mRNA vaccines are more stable than linear mRNA at ambient temperatures, allowing them to be stored and transported without a cold chain. In multiple animal models, the mucosal immune response induced by circular mRNA vaccines showed to be more effective than traditional parenteral immunization, which provides a new strategy for the prevention and control of viral neuronecrosis in fish. Summary of the Invention
[0004] The present invention provides a circular mRNA vaccine for marine cultured fish, a preparation method thereof, and an application thereof, to solve the problem in the fish farming industry that juvenile fish are easily infected by the NNV virus, causing large losses.
[0005] The present invention adopts the following technical solution: a circular mRNA vaccine for marine farmed fish, wherein the target antigen carried by the circular mRNA vaccine is the B1 gene of the NNV virus, and the circular mRNA vaccine is composed of a circular mRNA and a lipid nanocarrier carrying the circular mRNA. The circular mRNA is composed of the following three regions in sequence: an IRES untranslated region, a signal peptide sequence, and an NNV virus antigen coding region. The nucleotide sequence of the circular mRNA is shown in SEQ ID NO: 1.
[0006] Furthermore, the lipid nanocarrier comprises the following components: MC3, DSPC, cholesterol, and DMG-PEG2000 are mixed in a ratio of 5:1:3.8:0.2 and then placed in an ethanol solution, and the mass ratio of the circular mRNA to the nanolipid material is 1:10.
[0007] A method for preparing circular mRNA for marine aquaculture fish comprises the following steps:
[0008] (1) The circular mRNA template DNA is composed of a T7 promoter, an IRES untranslated region, a signal peptide sequence, and an NNV viral antigen coding region, and is synthesized by chemical synthesis;
[0009] (2) T7 RNA was transcribed using T7 RNA polymerase using the DNA chemically synthesized in the previous step as a template and purified by ethanol precipitation;
[0010] (3) adenylylating the transcribed RNA using 5'-end adenylylase and purifying it by ethanol precipitation;
[0011] (4) Circularize the adenylylated RNA obtained in the previous step using T4 RNA ligase 2 and purify it by ethanol precipitation;
[0012] (5) T7 RNA polymerase was used to perform T7 RNA transcription using the DNA chemically synthesized in the previous step as a template, and the target circular mRNA was finally obtained by purification using ethanol precipitation.
[0013] Furthermore, the nucleotide sequence of the T7 promoter is shown in SEQ ID NO: 2.
[0014] Furthermore, the nucleotide sequence of the IRES untranslated region is shown in SEQ ID NO: 3.
[0015] Furthermore, the amino acid sequence of the signal peptide sequence is shown in SEQ ID NO: 4.
[0016] Furthermore, the NNV virus antigen coding region contains the NNV-B1 gene, and the amino acid sequence is shown in SEQ ID NO:5.
[0017] The invention relates to an application of a circular mRNA vaccine for marine cultured fish, and its application in the preparation of a drug against fish neuronecrosis virus.
[0018] The mechanisms of action of the B1 and B2 proteins during NNV infection are multifaceted. B1 is believed to function as an anti-necrotic cell death factor, regulating the host cell cycle, reducing the loss of mitochondrial membrane potential, and upregulating p53 / p21 to induce G1 / S cell cycle arrest, thereby ensuring viral replication. B2 plays a crucial role in NNV proliferation and infection. It binds to double-stranded DNA, preventing Dicer cleavage, thereby antagonizing the host RNA interference (RNAi) response and accumulating viral RNA. Furthermore, B2 induces cell death by ATP depletion by increasing the loss of mitochondrial membrane potential and upregulating the expression of the apoptotic gene Bax, leading to loss of mitochondrial membrane potential. B2 also suppresses the host type I interferon response by inhibiting host transcriptional activity, particularly RNA polymerase II-directed transcription. The functions of these nonstructural proteins are crucial for NNV infection, viral replication, and host immune evasion. Understanding the mechanisms of action of B1 and B2 proteins not only sheds light on NNV pathogenesis but also provides potential targets for the development of new preventive and therapeutic strategies. This invention constructed a circular RNA vaccine of the NNV-B1 gene by cloning the NNV-B1 gene, which is of significant significance in the development of fish antiviral drugs and disease prevention and control strategies.
[0019] The present invention has the following beneficial effects:
[0020] (1) The NNV-B1 circular mRNA vaccine prepared by the present invention does not contain live viral components, is degraded into nucleotides in the body, and will not integrate into the host genome, so there is no risk in its use. Compared with other types of vaccines, the NNV-B1 circular mRNA vaccine can stimulate a stronger immune response, including humoral immunity and cellular immunity, and has lower immunogenicity, which is crucial for preventing viral infection. The production cost of the NNV-B1 circular mRNA vaccine is lower, and it is economically competitive when produced on a large scale.
[0021] (2) The NNV-B1 circular mRNA vaccine prepared by the present invention has high stability and good safety as shown by experiments. It has a protective efficacy of nearly 90% against grouper in preventing NNV virus infection. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 Schematic diagram of the synthetic structure of the NNV-B1 circular mRNA vaccine of the present invention.
[0023] Figure 2 This is a gel electrophoresis analysis diagram of the NNV-B1 circular mRNA and linear RNA of the present invention.
[0024] Figure 3This is a diagram showing the expression of the NNV-B1 circular mRNA vaccine of the present invention in HEK293 cells.
[0025] Figure 4 It is the antibody titer against the B1 protein of the NNV virus in the serum of grouper 28 days after immunization with the NNV-B1 circular mRNA vaccine of the present invention.
[0026] Figure 5 This is a diagram showing the effect of the NNV-B1 circular mRNA vaccine of the present invention in preventing and treating NNV virus in grouper. DETAILED DESCRIPTION
[0027] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of the present invention.
[0028] Human embryonic kidney 293 cells (HEK293 cells) were grown adherently in a cell culture medium in a 5% CO2 incubator at 37°C. HEK293 cells were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum, 100 T / ml penicillin, and 100 mg / ml streptomycin.
[0029] The microfluidic chip in the present invention is FluidicLab LNP-B1, which was purchased from Shanghai Pengzan Biotechnology Co., Ltd.
[0030] The NervoTs Necrosis VirTs (NNV) in the present invention is stored in the National Aquatic Animal Pathogen Bank.
[0031] Example 1: Preparation of NNV-B1 circular mRNA vaccine:
[0032] The nucleotide sequence of the NNV-B1 gene circular mRNA is shown in SEQ ID NO: 1.
[0033] The specific steps are as follows:
[0034] (1) Synthesis of DNA template for NNV-B1 gene circular mRNA vaccine: The template DNA of the circular mRNA vaccine is composed of a T7 promoter, an IRES untranslated region, a signal peptide sequence, and an NNV virus antigen coding region, and the DNA template is synthesized by chemical synthesis in the above order; wherein the nucleotide sequence of the T7 promoter is shown in SEQ ID NO: 2, the nucleotide sequence of the IRES untranslated region is shown in SEQ ID NO: 3, the amino acid sequence of the signal peptide sequence is shown in SEQ ID NO: 4, and the NNV virus antigen coding region is an antigen region containing the NNV-B1 gene, and the amino acid sequence is shown in SEQ ID NO: 5;
[0035] (2) T7 RNA transcription of NNV-B1 gene circular mRNA vaccine: T7 RNA transcription was performed using the synthesized DNA as a template;
[0036] The specific steps are as follows: 1 μg DNA template, 2 μL T7 transcription buffer, 4 μL NTP mix (10 mM), 0.1 μL T7 RNA polymerase (1 kT / μL), and nuclease-free water to 20 μL. Incubate at 37°C for 120 minutes. After completion of the reaction, transcribed linear RNA is purified by ethanol precipitation. The specific steps are as follows: First, add 160 μL nuclease-free water to expand the reaction volume to 180 μL. Then, add 20 μL 3M sodium acetate (pH 5.2) or 20 μL 5M ammonium acetate and mix thoroughly. Then, extract once with an equal volume of phenol / chloroform mixture (1:1), and then extract once or twice with chloroform. The extraction step is vortex mixing for 20-30 seconds, followed by centrifugation at 14,000 g for 5-10 minutes, and the supernatant is collected. Precipitate the RNA with double the volume of anhydrous ethanol and incubate at -20°C for at least 30 minutes. Centrifuge at 14,000g for 5-10 minutes at 4°C to precipitate the RNA. Discard the supernatant and wash the pellet with 500 μL of ice-cold 70% ethanol. Resuspend and dissolve the RNA in 20 μL of nuclease-free water. Finally, detect the synthesized circular mRNA by agarose gel electrophoresis.
[0037] (3) RNA adenylation: Adenylate the RNA purified in the previous step.
[0038] The specific steps are as follows: 5 μM RNA obtained in the previous step, 2 μL adenylation buffer, 2 μL ATP (1 mM), 1 μL 5' end adenylylase (75T / μL), add nuclease-free water to 20 μL, incubate at 65°C for 60 minutes, incubate at 85°C for 5 minutes to terminate the reaction, and purify the circularized RNA according to the above-mentioned ethanol precipitation method;
[0039] (4) T4 RNA ligase 2 circular ligation: The purified adenylylated RNA was circularized using T4 RNA ligase 2. The specific steps are as follows: 20 μM linear RNA, 2 μL T4 RNA ligase buffer, and 1 μL T4 RNA ligase 2 were taken, and the mixture was filled up to 20 μL with nuclease-free pure water. The mixture was incubated at 37°C for 1 hour, and the circularized RNA was purified using the ethanol precipitation method described above.
[0040] (5) RNase R enzyme removal of linear RNA: Use RNase R enzyme to remove the residual linear RNA in the above reaction system. Take 20 μL of the above purified RNA and 3 μL of RNase R enzyme buffer, add 30 μL of ribozyme-free pure water, incubate at 37°C for 30 minutes, and then purify the circularized RNA according to the above ethanol precipitation method to finally obtain the purified target circular mRNA. The results are as follows: Figure 2 As shown;
[0041] The process of circular mRNA from linear to circular Figure 1 As shown by Figure 1 It can be seen that the linear RNA is formed by reverse splicing of the linker sequence 1, shown in SEQ ID NO: 6 (GATCCCACCCACAGGCCCA) and the linker sequence 2, shown in SEQ ID NO: 7 (GACGTCGCACTCAAGTGTAG). During the preparation process, the residual linear RNA in the reaction system was removed by RNase R enzyme. Figure 2 As can be seen from the gel electrophoresis diagram, after the linear RNA is treated with RNase R, the RNA band disappears, while the circular RNA band still exists after RNase R treatment, and the concentration is similar to that of the RNA before RNase R treatment. Therefore, it can be seen that the present invention has successfully synthesized circular mRNA;
[0042] (6) Preparation of circular mRNA vaccine: MC3, DSPC, cholesterol, and DMG-PEG2000 were mixed in an ethanol solution at a ratio of 5:1:3.8:0.2 to prepare a lipid carrier. The lipid carrier and the circular mRNA solution were mixed in a volume ratio of 1:4 through a microfluidic chip to prepare a circular mRNA-LNP solution, wherein the mass ratio of the circular mRNA to the nanolipid material was 1:10. The ethanol was then removed through a tangential flow system to obtain a circular mRNA lipid nanoparticle preparation, i.e., a circular mRNA vaccine.
[0043] (7) Detection of the effect of the synthetic NNV-B1 gene circular mRNA vaccine on the production of target protein: HEK293 cells in the logarithmic growth phase were taken, digested with trypsin, and then diluted with cell culture medium to a cell density of 2.5×10 5cells / ml to form a cell suspension, which was added to a 12-well cell culture plate at 1 ml / well and cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 37°C.
[0044] After 24 hours of incubation, the cells were cultured, the supernatant discarded, and the cells were rinsed with sterile PBS. Cell culture medium was then added at 1 ml / well. The prepared circular mRNA vaccine containing the NNV-B1 gene circular mRNA was then added to the HEK293 cells. 48 hours after transfection, the cell supernatant was removed and the cells were lysed using RIPA lysis buffer. Following lysis, the protein sample was ultrasonically disrupted and centrifuged at 12,000 rpm for 10 minutes at 4°C to separate the supernatant. The supernatant was mixed with 6× Loading BTffer and then heated at 95°C for 10 minutes to denature the proteins. The treated protein sample was then loaded into the wells of an SDS-PAGE electrophoresis gel for electrophoresis separation at 80 V for 1 hour, after which the voltage was increased to 120 V until the end of the electrophoresis. Using TTbTlin as the internal reference, the protein bands to be tested in the gel were cut according to the protein molecular weight standard, and these protein bands were transferred to the PVDF membrane. The transfer conditions were electrophoresis at a current of 200mA for 2 hours. After the membrane transfer was completed, the PVDF membrane was placed in a 5% skim milk powder solution for blocking for 1 hour to reduce nonspecific binding. After blocking, the membrane was incubated overnight with a 1:1000 dilution of NNV-B1 antibody to specifically bind to the target protein. The next day, the membrane was washed 3 times with PBST buffer for 10 minutes each to remove unbound antibodies. After that, the membrane was incubated with a 1:2000 dilution of goat anti-rabbit secondary antibody for 2 hours, and then washed 3 times with PBST buffer for 10 minutes each to remove excess secondary antibody. Finally, the developer was added and the chemiluminescence reaction on the membrane was detected to evaluate the efficiency of circular mRNA expression of NNV-B1; the results are as shown in Figure 2. Figure 3 shown.
[0045] Depend on Figure 3 It can be seen that HEK293 cells transfected with circular mRNA carrying the NNV-B1 gene can efficiently express NNV-B1 protein, while HEK293 cells in the control group that were not transfected with anything did not express NNV-B1 protein, which shows that the synthetic circular mRNA can effectively produce the target antigen.
[0046] Example 2: Verification of the safety and efficacy of NNV-B1 circular mRNA vaccine:
[0047] To comprehensively evaluate the safety of the NNV circular mRNA vaccine for preventing viral neuronecrosis and ensure its safety in clinical application, a series of safety trials were conducted in accordance with the Chinese Veterinary Pharmacopoeia. Groupers weighing approximately 5g were used as experimental animals, and a 10μg injection of the circular mRNA vaccine was used.
[0048] The experimental design involved randomized grouping into two groups, each consisting of six fish: a control group and an mRNA vaccine group. Groupers in the control group received an intraperitoneal injection of 0.1 ml of PBS solution per grouper, while groupers in the vaccine group received an intraperitoneal injection of 0.1 ml of the circular mRNA vaccine per grouper at 10 μg per grouper. During the trial, all zebrafish in the experimental groups were closely monitored for clinical adverse reactions, and the number of fish deaths was recorded daily for seven days after immunization. Furthermore, the length and weight of fish in each group were regularly measured and recorded for 60 days after vaccination.
[0049] Results showed that while the grouper fish in the control group were in good condition, and the experimental group receiving intraperitoneal injection of the mRNA vaccine had no fish mortality within 7 days, no clinical adverse reactions were observed. Furthermore, the length and weight of the fish in the vaccinated group did not differ significantly from those in the control group after 60 days. These results demonstrate the high safety of this NNV circular mRNA vaccine.
[0050] Example 3: Efficiency of NNV-B1 circular mRNA in producing antibodies in grouper:
[0051] Groupers weighing about 25 grams were selected and divided into a control group and a circular mRNA vaccine group according to the random block method, with a total of 2 groups and 3 fish in each group. The groupers in the control group were injected with PBS solution at 0.1 ml / fish intraperitoneally, and the groupers in the vaccine group were injected with circular mRNA vaccine at 0.1 ml / 10 μg / fish intraperitoneally. The groupers were given immunization once every two weeks and immunized twice continuously. After 28 days of immunization, blood was collected from the tail vein of all groupers and serum was separated. The antibody titer against NNV virus B1 protein in the serum on the 28th day was detected by ELISA. The results are as follows Figure 4 shown.
[0052] Depend on Figure 4 It can be seen that the binding antibody titer in the serum of grouper vaccinated with NNV virus circular mRNA vaccine after 28 days of immunization is about 10 4 -10 5 The antibody conversion rate of this group was 100%.
[0053] Example 4: Application of NNV-B1 circular mRNA vaccine:
[0054] Groupers weighing approximately 25 grams were selected and divided into two groups, a control group and an mRNA vaccine group, according to the randomized block method, with 40 fish in each group. The groupers in the control group were injected with PBS solution at 0.1 ml / fish intraperitoneally, and the groupers in the vaccine group were injected with circular mRNA vaccine at 0.1 ml / 10 μg / fish intraperitoneally. The vaccine was administered once every two weeks for 2 consecutive immunizations. After a 28-day immunization period, all groupers were injected intraperitoneally with 0.1 ml of 1×10 5 TCID50 / mL of NNV virus. During the subsequent observation period, the survival and death of each group of groupers were recorded every day, and survival curves were drawn based on these data to evaluate the protective effect of the vaccine. Figure 5 shown.
[0055] Depend on Figure 5 As shown, grouper vaccinated with the NNV circular mRNA vaccine experienced a mortality rate of approximately 10% over a 20-day observation period. In contrast, the mortality rate of grouper in the unvaccinated negative control group reached 100% over the same period. This significant difference indicates that the NNV circular mRNA vaccine, administered via injection, has a protective efficacy of nearly 90% against NNV infection in grouper.
[0056] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. Such changes and modifications are intended to fall within the scope of the present invention. The scope of protection claimed in the present invention is defined by the appended claims and their equivalents.
Claims
1. A circular mRNA vaccine for marine aquaculture fish, characterized by: The target antigen carried by the circular mRNA vaccine is the B1 gene of the NNV virus. The circular mRNA vaccine consists of a circular mRNA and a lipid nanocarrier carrying the circular mRNA. The circular mRNA is composed of the following three regions in sequence: an IRES untranslated region, a signal peptide sequence, and an NNV virus antigen coding region. The nucleotide sequence of the circular mRNA is shown in SEQ ID NO:
1.
2. The circular mRNA vaccine for marine culture fish according to claim 1, wherein: The lipid nanocarrier comprises the following components: MC3, DSPC, cholesterol, and DMG-PEG2000 are mixed in a ratio of 5:1:3.8:0.2 and then placed in an ethanol solution. The mass ratio of the circular mRNA to the nanolipid material is 1:
10.
3. The method for preparing a circular mRNA vaccine for marine culture fish according to claim 1, wherein: The steps include: (1) The circular mRNA template DNA is composed of a T7 promoter, an IRES untranslated region, a signal peptide sequence, and an NNV viral antigen coding region, and is synthesized by chemical synthesis; (2) T7 RNA was transcribed using T7 RNA polymerase using the DNA chemically synthesized in the previous step as a template and purified by ethanol precipitation; (3) adenylylating the transcribed RNA using 5'-end adenylylase and purifying it by ethanol precipitation; (4) The adenylylated RNA obtained in the previous step was circularized and ligated using T4 RNA ligase 2 and purified by ethanol precipitation.
4. The method for preparing a circular mRNA vaccine for marine culture fish according to claim 3, wherein: The nucleotide sequence of the T7 promoter is shown in SEQ ID NO:
2.
5. The method for preparing a circular mRNA vaccine for marine culture fish according to claim 3, wherein: The nucleotide sequence of the IRES untranslated region is shown in SEQ ID NO:
3.
6. The method for preparing a circular mRNA vaccine for marine culture fish according to claim 3, wherein: The amino acid sequence of the signal peptide sequence is shown in SEQ ID NO:
4.
7. The method for preparing a circular mRNA vaccine for marine culture fish according to claim 3, wherein: The NNV virus antigen coding region contains the NNV-B1 gene, and the amino acid sequence is shown in SEQ ID NO:
5.
8. Use of the circular mRNA vaccine for marine cultured fish as claimed in claim 1 in the preparation of drugs against fish neuronecrosis virus.
Citation Information
Patent Citations
Nervous necrosis virus grouper oral vaccine and preparation method thereof
CN116617380A
Modified grouper nervous necrosis virus circRNA (Ribonucleic Acid), vaccine as well as preparation and application of modified grouper nervous necrosis virus circRNA
CN117887716A