P450 enzyme mutant, fusion protein and application thereof

By performing site-directed mutagenesis on the P450 enzyme and fusing it with the CYP116B46 reductase domain, the problem of poor product selectivity in the synthesis of CS bonds catalyzed by the P450 enzyme was solved, achieving the efficient synthesis of high-purity sulfur-containing indolelactam derivatives and improving catalytic efficiency and enzyme stability.

CN119752823BActive Publication Date: 2026-03-27ENJOY ENTROPY BIOTECHNOLOGY (SHANGHAI) CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410050159.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-11
Publication Date
2026-03-27
Estimated Expiration
2044-01-11

AI Technical Summary

Technical Problem

Existing P450 enzymes suffer from poor product selectivity and mixture problems when catalyzing CS bond synthesis, making it difficult to efficiently synthesize high-purity sulfur-containing indolelactam derivatives.

Method used

By performing site-directed mutagenesis on the P450 enzyme, particularly by mutating the amino acid sequence at position 85 or 89 to glycine, alanine, or cysteine, and fusing it with the CYP116B46 reductase domain, a self-sufficient fusion protein can be formed, thereby improving the selectivity of the catalytic reaction.

Benefits of technology

It significantly improved the selectivity and yield of product P1, reaching over 93%, even approaching 100%, achieving the specific synthesis of high-purity sulfur-containing indolelactam derivatives and enhancing the enzyme's catalytic efficiency and stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119752823B_ABST
    Figure CN119752823B_ABST
Patent Text Reader

Abstract

The application provides a P450 enzyme mutant, a fusion protein and application thereof, the mutant is selected from any one of the following: a mutant formed by mutating an amino acid at the 85th position of a P450 enzyme shown in SEQ ID NO: 1 into glycine, alanine or cysteine, a mutant formed by mutating an amino acid at the 89th position of a P450 enzyme shown in SEQ ID NO: 2 into glycine, a mutant formed by mutating an amino acid at the 93rd position of a P450 enzyme shown in SEQ ID NO: 3 into glycine, a mutant formed by mutating an amino acid at the 85th position of a P450 enzyme shown in SEQ ID NO: 4 into glycine, and a mutant formed by mutating an amino acid at the 89th position of a P450 enzyme shown in SEQ ID NO: 5 into glycine. The P450 enzyme mutant can catalyze intramolecular C-S bond formation, and through improving the product selectivity of the P450 enzyme, specific synthesis of high-purity sulfur-containing compounds is realized.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biotechnology, in particular to a P450 enzyme mutant, a fusion protein and application thereof. BACKGROUND

[0002] Organosulfur compounds are important components and structural backbones of numerous natural metabolites, drugs and functional materials. Traditional chemical methods, such as transition metal-mediated cross-coupling reactions, usually face challenges such as harsh reaction conditions, low catalytic efficiency and poor sustainability in synthesizing C-S bonds. In contrast, biological enzyme methods can greenly synthesize compounds containing C-S bonds under mild conditions. As a "golden catalyst", cytochrome P450 enzymes have the advantages of broad substrate spectrum and catalytic diversity, and have been widely studied and applied in the fields of drug synthesis and fine chemical production.

[0003] P450 enzymes require the participation of an electron transfer system in the process of catalytic reaction, and are divided into Class I-X according to the electron transfer system. Among them, for example: Class I is composed of Heme, iron-sulfur cluster-containing ferredoxin and FAD-containing ferredoxin reductase, and the typical representative is CYP101A1; Class II is composed of Heme and FAD / FMN-containing cytochrome P450 enzyme reductase; Class VII is naturally fused by Heme and FMN / Fe2S2-containing chaperone protein, which is a single-component catalytic system, such as P450RhF. Since Narhi and Fulco identified the self-sufficient catalytic system of P450 BM3 in 1986, P450 enzyme fusion proteins have been widely studied and applied. Protein fusion engineering not only can improve the catalytic efficiency of P450 enzymes, but also can improve the stability of proteins. Researchers usually fuse the heme domain and reductase domain of P450 enzymes to obtain artificial self-sufficient P450 enzymes.

[0004] In recent years, some progress has been made in the research on key P450 enzymes in the synthesis pathway of sulfur-containing compounds, such as griseusin, plant antitoxin and innovin. Among them, P450 TleB enzyme can catalyze the formation of intramolecular C-S bond of (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide, thereby obtaining two sulfur-containing indole lactam derivatives. However, the reported P450 enzymes capable of catalyzing the synthesis of C-S bond are still few. In addition, the natural TleB enzyme has the problem of mixture when generating the product of (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide, which makes it difficult to specifically synthesize high-purity sulfur-containing indole lactam derivatives by enzyme method. Therefore, in order to solve this problem, it is necessary to develop new P450 enzymes or mutants thereof with high product specificity. This will help to further analyze the molecular mechanism of P450 TleB enzyme in selectively catalyzing the formation of C-S bond, and provide new ideas and methods for the synthesis of sulfur-containing compounds. SUMMARY

[0005] To solve the problems in the background art, the present application provides a P450 enzyme mutant and its application, which can catalyze the synthesis of intramolecular C-S bond of the substrate and significantly improve the selectivity of the catalytic reaction.

[0006] The technical solution of the present application to solve the above technical problems is as follows:

[0007] In a first aspect, the present application provides a P450 enzyme mutant, which is selected from any one of the following:

[0008] (a) the amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO: 1, the 85th amino acid is mutated to glycine, alanine or cysteine;

[0009] (b) the amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO: 2, the 89th amino acid is mutated to glycine, alanine or cysteine;

[0010] (c) the amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO: 3, the 93rd amino acid is mutated to glycine, alanine or cysteine;

[0011] (d) the amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO: 4, the 85th amino acid is mutated to glycine, alanine or cysteine;

[0012] (e) the amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO: 5, and the 89th amino acid is mutated to glycine, alanine or cysteine.

[0013] Further, the 85th amino acid of the amino acid sequence shown in SEQ ID NO: 1 is mutated to glycine, the 89th amino acid of the amino acid sequence shown in SEQ ID NO: 2 is mutated to glycine; the 93rd amino acid of the amino acid sequence shown in SEQ ID NO: 3 is mutated to glycine; the 85th amino acid of the amino acid sequence shown in SEQ ID NO: 4 is mutated to glycine; and the 89th amino acid of the amino acid sequence shown in SEQ ID NO: 5 is mutated to glycine.

[0014] The P450 enzymes with the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5 are respectively TleB (CYP107E48), CYP107E49, CYP107E50, CYP107E51 and CYP107E52.

[0015] In one or more embodiments, the nucleotide sequences of TleB (CYP107E48), CYP107E49, CYP107E50, CYP107E51 and CYP107E52 are respectively shown in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and SEQ ID NO: 11.

[0016] Further, the mutant can also be selected from a polypeptide formed after adding a tag sequence, a restriction site sequence or a signal sequence to one end or both ends of the amino acid sequence of any one of (a) to (e).

[0017] In a second aspect, the present application provides a P450 enzyme mutant fusion protein, comprising

[0018] (i) a fusion protein formed by connecting a CYP116B46 reductase domain to the C-terminus of the above-mentioned P450 enzyme mutant; or

[0019] (ii) a polypeptide formed after adding a tag sequence, a restriction site sequence or a signal sequence to one end or both ends of the amino acid sequence of the fusion protein of (i).

[0020] Further, the amino acid sequence of the CYP116B46 reductase domain is shown in SEQ ID NO: 6.

[0021] In a third aspect, the present application provides a polynucleotide encoding the P450 enzyme mutant or the P450 enzyme mutant fusion protein.

[0022] In a fourth aspect, the present application provides an expression vector comprising the polynucleotide.

[0023] In a fifth aspect, the present application provides a genetically engineered host cell comprising the expression vector.

[0024] The host cell includes a prokaryotic cell or a eukaryotic cell, and in one or more embodiments, the host cell is E. coli, Corynebacterium glutamicum, Bacillus subtilis, Saccharomyces cerevisiae, Pichia pastoris, Aspergillus oryzae, and more preferably, the host cell is E. coli.

[0025] In a sixth aspect, the present application provides use of the P450 enzyme mutant, the P450 enzyme mutant fusion protein, the expression vector or the genetically engineered host cell in catalyzing C-S bond formation in a substrate molecule.

[0026] Preferably, the P450 enzyme mutant fusion protein is used to catalyze the substrate (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide to generate a product containing a C-S bond, and significantly improve the selectivity of generating the product P1, and the structure of the substrate is as follows:

[0027] The catalyzed reaction is as follows:

[0028]

[0029] In one or more embodiments, NADP + , glucose and glucose dehydrogenase (GDH) are added to the reaction system when the P450 enzyme mutant fusion protein is used to catalyze the substrate.

[0030] In another or more embodiments, NADPH is added to the reaction system when the P450 enzyme mutant fusion protein is used to catalyze the substrate.

[0031] In a preferred embodiment, a reducing agent such as TCEP can be added to the reaction system to avoid oxidation of the substrate.

[0032] Compared with the P450 enzyme mutant fusion protein, the P450 enzyme mutant needs to additionally add ferredoxin (Fdx) containing iron-sulfur clusters and ferredoxin reductase (Fdr) containing FAD when used for catalyzing substrates.

[0033] The beneficial effects of the present application are:

[0034] The P450 enzyme mutant provided by the present application can catalyze the formation of intramolecular C-S bond, improve the product selectivity of P450 enzyme, and realize the specific synthesis of high-purity sulfur-containing indole lactam derivatives. The P450 enzyme mutant of the present application used for catalyzing the substrate (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide can significantly improve the selectivity of the catalytic synthesis product P1, and even basically completely form the product P1. When the P450 enzyme mutant of the present application catalyzes the substrate (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide, the yield of the product P1 can be higher than 93%, more preferably more than 95%, and further more preferably more than 99%;

[0035] The P450 enzyme mutant and the CYP116B46 reductase domain are fused to form a P450 enzyme mutant fusion protein for enzyme catalysis, which does not need to additionally add reductase, realizes self-sufficiency, improves the catalytic efficiency of the enzyme, and improves the stability of the enzyme. BRIEF DESCRIPTION OF DRAWINGS

[0036] Figure 1 HPLC chromatogram of the catalytic product of the TleB and TleB-CYP116B46 in Example 6 of the present application;

[0037] Figure 2 HPLC chromatogram of the catalytic product of the TleB M1 and TleB M1-CYP116B46 in Example 6 of the present application. DETAILED DESCRIPTION

[0038] The principles and characteristics of the present application are described below in combination with the drawings and specific examples, and the examples are only used to explain the present application and are not used to limit the scope of the present application.

[0039] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of, for example, a parameter, an individual value from the range can be expressly disclosed herein, even though only one or a few such values from the range can be explicitly recited. Each individual value from a listed range can be explicitly recited and will be explicitly encompassed within the present application. Moreover, it is intended that the scope of the present application extend to all such individual values, and that the scope of the present application extend to each and every

[0040] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise.

[0041] As such, many modifications and variations of the present application can be made in the light of the above teachings without departing from the spirit and scope of the invention. Other implementations of the present application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The examples and embodiments described herein are exemplary and are not intended to be limiting.

[0042] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed material or step.

[0043] In the present application, the term "P450 enzyme TleB" or "TleB" or "CYP107E48" has the same meaning and can be used interchangeably herein, which is the wild type TleB enzyme with the amino acid sequence of SEQ ID NO: 1, which is derived from Streptomyces blastmyceticus and has the accession number of BAP27940.1 in NCBI. The enzyme can catalyze intramolecular C-S bond synthesis to generate product P1 and P2 from the substrate (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide, wherein the structural formula of the substrate, product P1 and product P2 are as follows:

[0044] Substrate

[0045] Product P1

[0046] Product P2

[0047] The yield ratio of the two products P1 and P2 generated by catalysis is 60% and 40%, respectively.

[0048] The P450 enzyme mutants of the present application can be chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts using recombinant technology.

[0049] In the present application, the terms "CYP116B46" or "CYP116B46 reductase domain" have the same meaning and can be used interchangeably herein, both referring to the reductase domain of CYP116B46 as shown in the amino acid sequence of SEQ ID NO: 6, such as TleB-CYP116B46 being a fusion protein of TleB and CYP116B46 reductase domain, CYP107E49-CYP116B46 being a fusion protein of CYP107E49 and CYP116B46 reductase domain, and the like.

[0050] Using bioinformatics methods, sequence retrieval was performed in the NCBI database, and four P450 enzymes were analyzed and mined, which were CYP107E49, CYP107E50, CYP107E51 and CYP107E52, which were derived from Kitasatospora humi, Streptomyces clavuligerus, Streptomyces alkaliphilus and Streptomyces luteoverticillatus, and the amino acid sequences were shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5 (the accession numbers in NCBI were WP_230051513.1, WP_065757225.1, WP_182604341.1 and WP_126913049.1, respectively), and the sequence identity with TleB was 83.59%, 84.09%, 81.66% and 79.34%, respectively, and only about 100 amino acids were not completely identical, wherein the 40 amino acids between T82 and L392 around the active center were basically identical. According to the P450 enzyme naming committee, TleB and the four P450 enzymes belong to the CYP107E family, and TleB is named as CYP107E48.

[0051] ​The four P450 enzymes CYP107E49, CYP107E50, CYP107E51 and CYP107E52 can also catalyze the substrate (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2- mercapto-3-methylbutanamide to generate carbon-sulfur heterocyclic products P1 and P2, wherein CYP107E49 catalyzes the generation of P1 and P2 in a ratio of 67% and 33%, CYP107E50 catalyzes the generation of P1 and P2 in a ratio of 69% and 31%, CYP107E51 catalyzes the generation of P1 and P2 in a ratio of 65% and 35%, and CYP107E52 catalyzes the generation of P1 and P2 in a ratio of 67% and 33%.

[0052] In order to improve the catalytic activity of TleB and improve the product selection specificity, the inventors first obtained the three-dimensional structure of TleB (PDB: 6J83) through the PDB database, then used Yasara to perform molecular docking of the TleB structure and the substrate molecule, determined the hot amino acids around the active pocket and some amino acid sites that may interact, through rational analysis and semi-rational design, used the means of directed evolution to perform site-directed mutation and saturation mutation on these amino acids to construct a mutant library, and finally screened out mutants TleB M1, TleB M2 and TleB M3, whose 85th amino acids were respectively mutated to glycine, alanine and cysteine, which can significantly improve the yield of product P1, and the selectivity for product P1 is 99%, 90% and 95% respectively.

[0053] When TleB and its mutants catalyze the above reaction, additional reductases (iron-sulfur cluster-containing ferredoxin (Fdx) and FAD-containing ferredoxin reductase (Fdr)) are needed. In order to achieve self-sufficiency in catalytic reaction, the inventors prepared a fusion protein of the above mutants combined with the reductase domain of CYP116B46, wherein the amino acid sequence of the reductase domain of CYP116B46 is shown in SEQ ID NO: 6. Specifically, the inventors performed protein fusion on the basis of the original wild-type TleB, used T5 exonuclease for Gibson assembly, and connected the reductase domain of CYP116B46 (CYP116B46) to the C-terminus of TleB to obtain TleB-CYP116B46. In this way, electrons are directly transferred to the active center of TleB through CYP116B46, so that TleB-CYP116B46 can achieve self-sufficiency and does not need to add reductases to participate in the reaction, which is also conducive to protein purification and mutant library screening.

[0054] In one or more embodiments, NADP is added to the reaction system when the P450 enzyme mutant fusion protein is used to catalyze the substrate + , glucose and glucose dehydrogenase (GDH);

[0055] In another or more embodiments, NADPH is added to the reaction system when the P450 enzyme mutant fusion protein is used to catalyze the substrate

[0056] In a preferred embodiment, a reducing agent such as TCEP can be added to the reaction system to avoid oxidation of the substrate.

[0057] Compared with the P450 enzyme mutant fusion protein, the P450 enzyme mutant needs to additionally add ferredoxin (Fdx) containing iron-sulfur cluster and ferredoxin reductase (Fdr) containing FAD when used to catalyze the substrate.

[0058] Preferably, the catalytic reaction temperature is 25°C.

[0059] The mutation sites of the fusion protein are consistent with the mutations of TleB. The leucine at position 85 of the fusion protein TleB-CYP116B46 is respectively mutated to glycine, alanine and cysteine to form mutants TleB M1-CYP116B46, TleB M2-CYP116B46 and TleB M3-CYP116B46, all of which can significantly improve the yield of product P1, and the selectivity for product P1 is 99%, 93% and 96%, respectively.

[0060] Meanwhile, the inventors constructed 3D models of four P450 enzymes CYP107E49, CYP107E50, CYP107E51 and CYP107E52 using AlphaFold, and compared them with the sequence and spatial structure of TleB respectively to find the sites corresponding to the key site L85 in the four enzymes, and then carried out site-directed mutagenesis, finally obtaining the mutants CYP107E49 M1 (mutated site: L89G), CYP107E49 M2 (mutated site: L89A), CYP107E49 M3 (mutated site: L89C), CYP107E50 M1 (mutated site: L93G), CYP107E50 M2 (mutated site: L93A), CYP107E50 M3 (mutated site: L93C), CYP107E51 M1 (mutated site: L85G), CYP107E51 M2 (mutated site: L85A), CYP107E51 M3 (mutated site: L85C), CYP107E52 M1 (mutated site: L89G), CYP107E52 M2 (mutated site: L89A), CYP107E52 M3 (mutated site: L89C), all of which can significantly improve the yield of product P1.

[0061] The above TleB M1, TleB M2, TleB M3, CYP107E49 M1 (mutated site: L89G), CYP107E49 M2 (mutated site: L89A), CYP107E49 M3 (mutated site: L89C), CYP107E50 M1 (mutated site: L93G), CYP107E50 M2 (mutated site: L93A), CYP107E50 M3 (mutated site: L93C), CYP107E51 M1 (mutated site: L85G), CYP107E51 M2 (mutated site: L85A), CYP107E51 M3 (mutated site: L85C), CYP107E52 M1 (mutated site: L89G), CYP107E52 M2 (mutated site: L89A), CYP107E52 M3 (mutated site: L89C) all belong to the "P450 enzyme mutant" of the present application.

[0062] Similarly, the inventors prepared fusion proteins CYP107E49 M1-CYP116B46, CYP107E49 M2-CYP116B46, CYP107E49 M3-CYP116B46, CYP107E50 M1-CYP116B46, CYP107E50 M2-CYP116B46, CYP107E50 M3-CYP116B46, CYP107E51 M1-CYP116B46, CYP107E51 M2-CYP116B46, CYP107E51 M3-CYP116B46, CYP107E52 M1-CYP116B46, CYP107E52 M2-CYP116B46 and CYP107E52 M3-CYP116B46 by combining the above-mentioned mutant CYP107E49 M1, CYP107E49 M2, CYP107E49 M3, CYP107E50 M1, CYP107E50 M2, CYP107E50 M3, CYP107E51 M1, CYP107E51 M2, CYP107E51 M3, CYP107E52 M1, CYP107E52 M2 and CYP107E52 M3, respectively, with the reduction domain of CYP116B46, and the resulting P450 enzyme mutant fusion proteins can significantly improve the yield of product P1.

[0063] The above-mentioned CYP107E49 M1-CYP116B46, CYP107E49 M2-CYP116B46, CYP107E49 M3-CYP116B46, CYP107E50 M1-CYP116B46, CYP107E50 M2-CYP116B46, CYP107E50 M3-CYP116B46, CYP107E51 M1-CYP116B46, CYP107E51 M2-CYP116B46, CYP107E51 M3-CYP116B46, CYP107E52 M1-CYP116B46, CYP107E52 M2-CYP116B46 and CYP107E52 M3-CYP116B46 all belong to the "P450 enzyme mutant fusion protein" described in the present application.

[0064] In the present application, the term "P450 enzyme mutant" also includes derivatives that retain the protein activity of the P450 enzyme mutant, which have 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more, such as 98% or more, 99% or more sequence identity to the amino acid sequence of the P450 enzyme mutant. In these derivatives, there is certainly the mutation described above in the present application: the 85th amino acid of the amino acid sequence shown in SEQ ID NO: 1 is mutated to glycine, alanine or cysteine; or the 89th amino acid of the amino acid sequence shown in SEQ ID NO: 2 is mutated to glycine; or the 93rd amino acid of the amino acid sequence shown in SEQ ID NO: 3 is mutated to glycine; or the 85th amino acid of the amino acid sequence shown in SEQ ID NO: 4 is mutated to glycine; or the 89th amino acid of the amino acid sequence shown in SEQ ID NO: 5 is mutated to glycine.

[0065] In the present application, the term "P450 enzyme mutant" also includes derivatives that retain the protein activity of the P450 enzyme mutant, which have 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more, such as 98% or more, 99% or more sequence identity to the amino acid sequence of the P450 enzyme mutant. In these derivatives, there is certainly the mutation described above in the present application: the 85th amino acid of the amino acid sequence shown in SEQ ID NO: 1 is mutated to glycine, alanine or cysteine; or the 89th amino acid of the amino acid sequence shown in SEQ ID NO: 2 is mutated to glycine; or the 93rd amino acid of the amino acid sequence shown in SEQ ID NO: 3 is mutated to glycine; or the 85th amino acid of the amino acid sequence shown in SEQ ID NO: 4 is mutated to glycine; or the 89th amino acid of the amino acid sequence shown in SEQ ID NO: 5 is mutated to glycine.

[0066] The present application also provides polynucleotides encoding the above-mentioned P450 enzyme mutants, P450 enzyme mutant fusion proteins. The polynucleotides of the present application can be in the form of DNA or RNA, including genomic DNA, cDNA or artificially synthesized DNA, and the DNA can be a coding strand or a non-coding strand.

[0067] The present application also provides vectors containing the polynucleotides of the present application, and host cells genetically engineered with the vectors or the coding sequences of the P450 enzyme mutants or P450 enzyme mutant fusion proteins of the present application.

[0068] The polynucleotide sequence of the P450 enzyme mutant or the P450 enzyme mutant fusion protein of the present application can be used to express or produce the P450 enzyme mutant or the P450 enzyme mutant fusion protein by conventional recombinant DNA techniques, generally by the following steps: (1) transforming or transducing a suitable host cell with the polynucleotide of the P450 enzyme mutant or the P450 enzyme mutant fusion protein of the present application or a recombinant expression vector containing the polynucleotide; (2) culturing the host cell in a suitable medium; and (3) isolating and purifying the protein from the medium or the cell.

[0069] In the present application, the polynucleotide sequence of the P450 enzyme mutant or the P450 enzyme mutant fusion protein can be inserted into a recombinant expression vector. Any plasmid and vector can be used as long as it can be stably replicated in a host. An important feature of the expression vector is that it usually contains a replication origin, a promoter, a marker gene and a translation control element. Methods well known to those skilled in the art can be used to construct an expression vector containing a DNA sequence encoding the P450 enzyme mutant or the P450 enzyme mutant fusion protein and suitable transcription / translation control signals. The DNA sequence can be operably linked to a suitable promoter of the expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. The expression vector preferably contains one or more selective marker genes to provide a phenotypic trait for selection of transformed host cells.

[0070] The vector containing the appropriate DNA sequence described above and a suitable promoter or control sequence can be used to transform a suitable host cell to enable it to express the protein.

[0071] In the present application, the host cell can be any microorganism suitable for expressing the P450 enzyme or the P450 enzyme mutant or the P450 enzyme mutant fusion protein, including bacteria and fungi, preferably E. coli, Corynebacterium glutamicum, Bacillus subtilis, Saccharomyces cerevisiae, Pichia pastoris, Aspergillus oryzae, and more preferably E. coli, in which one or more of the following embodiments, E. coli BL21 (DE3) is used.

[0072] In the present application, the polynucleotide sequence (coding sequence) encoding the P450 enzyme mutant or the P450 enzyme mutant fusion protein can also be applied to the present application, wherein the coding sequence of the TleB, CYP107E49, CYP107E50, CYP107E51, CYP107E52 and CYP116B46 reductase domain is respectively shown as SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and the coding sequence of the P450 enzyme mutant or the P450 enzyme mutant fusion protein can also be a degenerate variant of the polynucleotide sequence provided in the present application, and the degenerate variant refers to a nucleic acid sequence that encodes the P450 enzyme mutant or the P450 enzyme mutant fusion protein in the present application, but has differences with the nucleotide sequence in the examples of the present application.

[0073] It is well known that the same nucleotide sequence often has great differences in expression results in different microbial hosts, and in order to best express the P450 enzyme or its mutant in Escherichia coli which is most commonly used in genetic engineering, the expression genes of these enzymes can be codon optimized.

[0074] Codon optimization is a technique that can be used to maximize protein expression in an organism by increasing the efficiency of translation of the gene of interest. Different organisms generally show a special preference for one of the codons that encode the same amino acid due to mutation tendency and natural selection. For example, in fast-growing microorganisms such as Escherichia coli, the optimized codons reflect the composition of their respective genomic tRNA pools. Therefore, in fast-growing microorganisms, low-frequency codons of amino acids can be replaced with codons for the same amino acid but with high frequency. Therefore, the expression of the optimized DNA sequence is improved in fast-growing microorganisms.

[0075] It is clear to those skilled in the art how to select appropriate vectors, promoters, enhancers and host cells. The recombinant cells (host cells) established by the present application can be cultured by conventional methods to express the polypeptides encoded by the genes of the present application. According to the host cells used, the culture medium used in the culture can be selected from various conventional culture media. The culture is carried out under conditions suitable for the growth of the host cells. When the host cells grow to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature shift or chemical induction), and the cells are cultured for a period of time.

[0076] When expressed, the P450 enzyme mutant or the P450 enzyme mutant fusion protein of the present application can be expressed in cells and secreted outside the cells, and if necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting-out method), centrifugation, osmotic lysis, ultrasonic treatment, high-speed centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high-performance liquid chromatography (HPLC), and other various liquid chromatography techniques, and combinations of these methods.

[0077] The P450 enzyme mutant and the P450 enzyme mutant fusion protein of the present application can be used to catalyze the intramolecular C-S bond formation, and the forms of the enzyme include purified enzyme, crude enzyme, etc.

[0078] When the substrate is The P450 enzyme mutant of the present application can improve the selectivity of catalytically generating the product P1, and is used for selective catalytic synthesis of the product P1, and the structural formula of P1 is:

[0079] It should be understood that the host cell expressing the P450 enzyme mutant or the P450 enzyme mutant fusion protein or its expression product (such as a lysate or a secretion product) also has this use.

[0080] In one or more embodiments, when the P450 enzyme mutant fusion protein is used for catalysis of the substrate, NADP + , glucose and glucose dehydrogenase (GDH) are added to the reaction system;

[0081] In another or more embodiments, when the P450 enzyme mutant fusion protein is used for catalysis of the substrate, NADPH is added to the reaction system.

[0082] In a preferred embodiment, a reducing agent such as TCEP can be added to the reaction system to avoid oxidation of the substrate.

[0083] Compared with the P450 enzyme mutant fusion protein, when the P450 enzyme mutant is used for catalysis of the substrate, ferredoxin (Fdx) containing iron-sulfur clusters and ferredoxin reductase (Fdr) containing FAD need to be additionally added.

[0084] The present application will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present application and are not used to limit the scope of the present application.

[0085] The molecular biology experiments in the following examples include plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, medium preparation, etc., which are mainly carried out according to the Molecular Cloning Laboratory Manual (3rd Edition), J. Sambrook et al., Science Press, and the specific experimental conditions can be determined by simple tests if necessary. The PCR amplification experiments are carried out according to the reaction conditions or kit instructions provided by the plasmid or DNA template supplier, and can be adjusted by simple tests if necessary.

[0086] Materials and methods

[0087] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2. (LB solid medium plus 20 g / L agar powder)

[0088] TB medium: 24 g / L yeast extract, 12 g / L tryptone, 16.43 g / L K2HPO4.3H2O, 2.31 g / L KH2PO4, 5 g / L glycerol, pH 7.0-7.5. (TB solid medium plus 20 g / L agar powder)

[0089] Detection method of substrate, product P1 and product P2:

[0090] HPLC was used for the analysis and determination of substrate, product P1 and product P2. The instrument model was SHIMADZU LC-2030Plus, and the column model was YMC Xtimate C18 (4.6x300mm, 5μm). The specific conditions were as follows: mobile phase: methanol (0.1% formic acid), ultrapure water; 0-15 min: methanol (0.1% formic acid) concentration from 60% to 90%; 15-16 min: 90% methanol (0.1% formic acid); 16-20 min: 60% methanol (0.1% formic acid); flow rate: 1.0 mL / min; column temperature: 25°C; detection wavelength: 280 nm; detection time: 20 min; injection volume: 20μL.

[0091] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. For convenience in the description, a strain number, a plasmid number, an enzyme number, and an enzyme-encoding gene number can be used together in the examples, which is easily understood by those skilled in the art, i.e., the same number can refer to different biological forms in different contexts.

[0092] Example 1 Construction of TleB / TleB-CYP116B46 genetically engineered bacteria

[0093] The amino acid sequence of P450 enzyme TleB is shown as SEQ ID NO: 1, the encoding nucleotide sequence of which is shown as SEQ ID NO: 7, the amino acid sequence of the reductive domain of CYP116B46 is shown as SEQ ID NO: 6, and the encoding nucleotide sequence of which is shown as SEQ ID NO: 12.

[0094] The plasmid pET28a-TleB carrying the TleB gene was synthesized, and the plasmid pET28a-CYP116B46 carrying the reductive domain of CYP116B46 was synthesized.

[0095] The amplification primers of pET28a-TleB are as follows:

[0096] Primer pET28a-TleB-F: AAGCTTGCGGCCGCACT (SEQ ID NO: 13)

[0097] Primer pET28a-TleB-R: CCACAGAACCGGCAGTTCCAGC (SEQ ID NO: 14)

[0098] The amplification primers of the reductive domain of CYP116B46 are as follows:

[0099] Primer CYP116B46-F1: CTGCCGGTTCTGTGGGACCCGGCGCAGAAT CCGGAAC (SEQ ID NO: 15)

[0100] Primer CYP116B46-R1: TGCGGCCGCAAGCTTTTATCAGGTCCAGAAC CAGAC (SEQ ID NO: 16)

[0101] The E. coli BL21 (DE3) / pET28a-TleB and E. coli BL21 (DE3) / pET28a-CYP116B46 strains were cultured in LB medium at 37°C, 200 rpm for 12-16 h, and then the cells were collected and the genomic DNA was extracted using TransZolTM UP Plus Genomic DNA Extraction Kit. pET28a-TleB was amplified using pET28a-TleB as the template and pET28a-TleB-F and pET28a-TleB-R as the primers, and the reductive domain sequence of CYP116B46 was amplified using pET28a-CYP116B46 as the template and CYP116B46-F1 and CYP116B46-R1 as the primers.

[0102] PCR reaction system (50 μL): 1-50 ng template, 2 μL (10 μM) of each pair of upstream and downstream primers, Prime STAR Max DNA polymerase (2x) 25 μL, sterile water to 50 μL.

[0103] PCR amplification procedure: (1) 98℃ pre-denaturation for 3 min; (2) 98℃ denaturation for 10 s; (3) 58℃ annealing for 5 sec; (4) 72℃ extension for 80 s / 20 s, with pET28a-TleB as the template, extension for 80 s, with pET28a-CYP116B46 as the template, extension for 20 s; steps (2)-(4) were repeated for 30 cycles, and finally 72℃ extension for 5 min, 12℃ preservation of the PCR product.

[0104] The two PCR products obtained by amplification were detected by 1% agarose gel nucleic acid electrophoresis and recovered by cutting the gel using an OMEGA gel recovery kit. The two recovered PCR products were digested by T5 exonuclease for 3-5 min to obtain the recombinant expression vector pET28a-TleB-CYP116B46. Then pET28a-TleB-CYP116B46 was transformed into DH5α competent cells, and uniformly coated on LB solid medium containing 50 μg / mL kanamycin, and incubated in a 37℃ incubator overnight. Single colonies were picked, colony PCR was verified, and sequencing was sent to the company. The strain with correct sequencing was picked and cultured, the plasmid was extracted, and retransformed into E. coli BL21 (DE3) competent cells. The culture medium was added and incubated at 37℃ for 45-60 min, coated on LB solid medium containing 50 μg / mL kanamycin, and incubated at 37℃ overnight. The recombinant transformant E. coli BL21 (DE3) / pET28a-TleB-CYP116B46 strain for expressing TleB-CYP116B46 enzyme was obtained.

[0105] Example 2 Construction of TleB / TleB-CYP116B46 site-directed mutant library

[0106] Site-directed mutagenesis was performed on multiple sites around the active pocket of TleB and TleB / TleB-CYP116B46 to construct a mutant library.

[0107] Taking the mutation of the 85th position of TleB and TleB / TleB-CYP116B46 to glycine (L85G) as an example,

[0108] Template: pET28a-TleB or pET28a-TleB-CYP116B46

[0109] Primer TleB L85G-F: CGAGCATCGGTGGTATGGATTCTCCGG (SEQ ID NO: 17)

[0110] Primer TleB L85G-R: CAGCACGACGACGCACCATCAGCTGAGC (SEQ ID NO: 18)

[0111] PCR reaction system (20 μL): 1-50 ng of template, 0.5 μL of each pair of upstream and downstream primers (10 μM), PrimeSTAR Max DNA polymerase (2x) 10 μL, sterile water to 20 μL.

[0112] The PCR amplification program is: (1) 98°C pre-denaturation for 3 min; (2) 98°C denaturation for 10 s, (3) 58°C annealing for 5 s, (4) 72°C extension for 80 s, steps (2)-(4) for a total of 30 cycles, finally 72°C extension for 5 min, 12°C preservation of PCR product.

[0113] The amplified PCR product was digested with Dpn I at 37°C for 3-6 h, then inactivated at 80°C for 20 min, transferred to E. coli BL21 (DE3) competent cells, added with culture medium, incubated at 37°C for 45-60 min, spread on LB solid medium containing kanamycin, incubated at 37°C overnight, and single colonies were picked for sequencing. The sequencing result peak chart was viewed by SnapGene biological analysis software to determine the correct mutation of the amino acid mutation site.

[0114] Example 3 Construction of TleB or TleB / TleB-CYP116B 46-point saturated mutant library

[0115] According to the screening results of the site-directed mutant library, the L85 site of TleB or TleB-CYP116B46 was subjected to point saturation mutation to construct a mutant library.

[0116] Template: pET28a-TleB or pET28a-TleB-CYP116B46

[0117] Primer L85-F: CGAGCATCGGTNNKATGGATTCTCCGG (SEQ ID NO: 19)

[0118] Primer L85-R: CAGCACGACGACGCACCATCAGCTGAGC (SEQ ID NO: 20).

[0119] PCR reaction system, PCR amplification procedure and subsequent steps were the same as example 2 except for the template and primers. The single clone was picked and sent to company for sequencing. The sequencing result peak chart was viewed by SnapGene biological analysis software to obtain all 19 kinds of mutants.

[0120] Example 4 Screening of TleB / TleB-CYP116B46 mutants

[0121] The expression strains pET28a-TleB, pET28a-TleB-CYP116B46 obtained in example 1 and the corresponding mutants obtained in example 3 were inoculated into 2 mL LB liquid medium containing kanamycin, and cultured at 37℃, 220 rpm for 5-6 h. Then, 1 v / v% of the inoculum was inoculated into 100 mL TB medium containing kanamycin, and the OD 600 was adjusted to 0.6-0.8. Then, IPTG was added to a final concentration of 0.2 mM, and the culture was induced at 25℃, 220 rpm for 18 h. The bacterial cells were collected by centrifugation at 4000 rpm for 10 min, and washed twice with 0.1 M potassium phosphate buffer, pH 7.0. The obtained cells were resuspended in 0.1 M potassium phosphate buffer, pH 6.5, and the OD 600 was adjusted to 20. Then, 10 mL of the resuspended cells were placed in an ice water bath, and ultrasonically broken at 500 W for 3-5 min. The lysate was collected by centrifugation at 12000 rpm for 5 min at 4℃, and the supernatant was used for catalytic reaction.

[0122] The crude enzyme catalytic reaction system (2 mL) was as follows: 0.25 mM substrate; 2 mM TCEP; 1 mM NADP + ; 1 U GDH; 5% (m / V) glucose; and the crude enzyme supernatant was supplemented. The reaction was carried out in a 25 mL reaction bottle at 25℃, 220 rpm for 2 h. After the reaction was completed, 500 μL of the reaction solution was taken into a clean 2 mL EP tube, 1 mL of ethyl acetate was added to terminate the reaction, and the mixture was fully extracted by vortexing. Then, the mixture was centrifuged at 12000 rpm for 5 min, 900 μL of the supernatant was taken into a clean 1.5 mL EP tube, the tube cap was opened, and the tube was placed in a fume hood to volatilize. After the ethyl acetate was completely volatilized, 200 μL of acetonitrile was added, the mixture was vortexed and centrifuged briefly, and then transferred into a 96-well plate for HPLC analysis. The proportion of the two products was calculated by peak area integration, and the mutants were screened.

[0123] The mutants obtained by screening and the catalytic products are shown in the following table:

[0124] Table 1 Catalytic performance of TleB, TleB-CYP116B46 and their mutants

[0125]

[0126] Example 5 Expression and purification of TleB / TleB-CYP116B46 / TleB-CYP116B46 mutants

[0127] Example 5 Expression and purification of TleB / TleB-CYP116B46 / TleB-CYP116B46 mutants 600

[0128] 4000rpm, 10min, centrifugal collection of bacterial cells, and washing twice with 0.1M, pH 7.0 potassium phosphate buffer, and then resuspending the obtained cells with 0.1M, pH 7.0 potassium phosphate buffer (containing 10mM imidazole), ice bath ultrasonic disruption, high-speed centrifugal collection of supernatant, 0.45μm filter membrane filtration, and purification using a nickel column in a 4℃ refrigerator. 5 times column washing with ultrapure water; 5 times column washing with equilibration Buffer; loading the filtered broken supernatant onto the nickel column, as many times as possible to make the target protein all hang on the column, eluting the protein with different concentrations of equilibration Buffer (10mM, 20mM, 250mM imidazole), and then desalting, ultrafiltration and concentration, liquid nitrogen quick freezing, and storage at -80℃.

[0129] TleB and TleB-CYP116B46 mutants were expressed and purified by the above method.

[0130] Example 6 Pure enzyme catalytic reaction

[0131] TleB or TleB mutant pure enzyme catalytic system: 10μM TleB or TleB mutant, 10μM iron-sulfur cluster-containing ferredoxin (Fdx), 10μM FAD-containing ferredoxin reductase (Fdr), 2mM NADPH, 2mM TCEP (tris(2-carboxyethyl) phosphine), 0.1mM substrate, reaction temperature 25℃, reaction time 2h.

[0132] TleB-CYP116B46 or its mutant pure enzyme catalytic system: 10μM TleB-CYP116B46 or its mutant, 2mM NADPH, 2mM TCEP (tris(2-carboxyethyl) phosphine), 0.1mM substrate, reaction temperature 25℃, reaction time 2h.

[0133] The HPLC chromatograms of the products catalyzed by TleB and TleB-CYP116B46 are as follows:​Figure 1 As shown, no enzyme liquid was added in the control group.

[0134] HPLC chromatograms of catalytic products of TleB M1 and TleB M1-CYP116B46 are shown in FIG. 1 and FIG. 2, respectively. Figure 2 As shown, no enzyme liquid was added in the control group.

[0135] Example 7

[0136] Fusion proteins were prepared using the reductase domains of CYP107E49, CYP107E50, CYP107E51, CYP107E52 and CYP116B46, respectively, and site-directed mutation and saturation mutation were performed.

[0137] The other steps were the same as in Examples 1-6 except for the primers.

[0138] The upstream primers of the amplification primers of pET28a-CYP107E49, pET28a-CYP107E50, pET28a-CYP107E51 and pET28a-CYP107E52 were as follows:

[0139] pET28a-CYP107E-F: GAACGTCTGGTTCTGGACCTGTAAAAGCTTG CGGCCGCACTCGAG (SEQ ID NO: 21)

[0140] The downstream primers were as follows:

[0141] pET28a-CYP107E49-R: TCCGGATTCTGCGCCGGGTCCCACTGAACCGGCAGTTGCAGCAGGCTACG (SEQ ID NO: 22)

[0142] pET28a-CYP107E50-R: TCCGGATTCTGCGCCGGGTCCCACAGAACCGGCAGACGCAGCAGGC (SEQ ID NO: 23)

[0143] pET28a-CYP107E51-R: TCCGGATTCTGCGCCGGGTCCCAGGTGATCGGCAGACGCAGCAGGCTACG (SEQ ID NO: 24)

[0144] pET28a-CYP107E52-R: TCCGGATTCTGCGCCGGGTCCCAAGCAACCGGCAGTTTCAGCAGGCTACG (SEQ ID NO: 25).

[0145] The primers for amplifying the CYP116B46 reductive domain are as follows:

[0146] CYP116B46-F2: GACCCGGCGCAGAATCCGGAACGTCGCGATCCGG AC (SEQ ID NO: 26)

[0147] CYP116B46-R2: TTACAGGTCCAGAACCAGACGTTCGGTTTTAGCA CGAGAGC (SEQ ID NO: 27)

[0148] The primers for CYP107E49, CYP107E49-CYP116B46 site-directed mutation (L89G) and saturation mutation are CYP107E49-L89G-F and CYP107E49-L89G-R.

[0149] The primers for CYP107E50, CYP107E50-CYP116B46 site-directed mutation (L93G) and saturation mutation are CYP107E50-L93G-F and CYP107E50-L93G-R.

[0150] The primers for CYP107E51, CYP107E51-CYP116B46 site-directed mutation (L85G) and saturation mutation are CYP107E51-L85G-F and CYP107E51-L85G-R.

[0151] The primers for CYP107E52, CYP107E52-CYP116B46 site-directed mutation (L89G) and saturation mutation are CYP107E52-L89G-F and CYP107E52-L89G-R.

[0152] The nucleotide sequences of the primers are shown in the following table:

[0153] Table 2 Point mutation primers for CYP107E49, CYP107E50, CYP107E51, CYP107E52 and fusion proteins

[0154]

[0155]

[0156] The catalytic results of CYP107E49 M1-CYP116B46 (L89G), CYP107E50 M1-CYP116B46 (L93G), CYP107E51 M1-CYP116B46 (L85G), CYP107E52 M1-CYP116B46 (L89G) are specifically given below.

[0157] CYP107E49, CYP107E50, CYP107E51, CYP107E52, fusion proteins thereof, and mutants selected by screening catalyze the production of products from substrates as shown in the following table:

[0158]

[0159] The above description is merely that of the preferred embodiments of the application and is not intended to limit the application. Any modification, equivalent replacements, improvements, and the like made within the spirit and principle of the application shall be included in the protection scope of the application.

Claims

1. A P450 enzyme mutant, characterized in that, The mutant is selected from any of the following: (a) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:1, with the 85th amino acid mutated to glycine, alanine, or cysteine; (b) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:2, with the 89th amino acid mutated to glycine, alanine, or cysteine; (c) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:3, with the 93rd amino acid mutated to glycine, alanine or cysteine; (d) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:4, with the 85th amino acid mutated to glycine, alanine, or cysteine. (e) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:5, with the 89th amino acid mutated to glycine, alanine or cysteine.

2. The P450 enzyme mutant according to claim 1, characterized in that, The amino acid at position 85 of the amino acid sequence shown in SEQ ID NO:1 is mutated to glycine; the amino acid at position 89 of the amino acid sequence shown in SEQ ID NO:2 is mutated to glycine; the amino acid at position 93 of the amino acid sequence shown in SEQ ID NO:3 is mutated to glycine; the amino acid at position 85 of the amino acid sequence shown in SEQ ID NO:4 is mutated to glycine; and the amino acid at position 89 of the amino acid sequence shown in SEQ ID NO:5 is mutated to glycine.

3. The P450 enzyme mutant according to claim 1 or 2, characterized in that, The mutant may also be selected from the following: (f) A polypeptide formed by adding a tag sequence or signal sequence to one or both ends of any of the amino acid sequences in (a) to (e).

4. A P450 enzyme mutant fusion protein, characterized in that, The fusion protein includes: (i) A fusion protein formed by linking a CYP116B46 reductase domain to the C-terminus of the P450 enzyme mutant of claim 1, wherein the amino acid sequence of the CYP116B46 reductase domain is as shown in SEQ ID NO:6; or (ii) A polypeptide formed by adding a tag sequence or signal sequence to one or both ends of the amino acid sequence of the fusion protein described in (i).

5. A polynucleotide, characterized in that, Encodes the P450 enzyme mutant as described in any one of claims 1-3 or the P450 enzyme mutant fusion protein as described in claim 4.

6. An expression carrier, characterized in that, It comprises the polynucleotide of claim 5.

7. A genetically engineered host cell, characterized in that, It includes the expression vector as described in claim 6.

8. The use of the P450 enzyme mutant according to any one of claims 1-3, the P450 enzyme mutant fusion protein according to claim 4, the expression vector according to claim 6, or the genetically engineered host cell according to claim 7 in catalyzing CS bonding within substrate molecules, characterized in that, This substrate is used to catalyze the following substrate reaction, improving the selectivity for the catalytic product P1. The structural formula of the substrate is as follows: The catalytic reaction formula is as follows: 。

Citation Information

Patent Citations

  • Application of cytochrome P450 monooxygenase in catalyzing lithocholic acid to produce ursodesoxycholic acid

    CN112831536A