OsRNE gene and the protein coded thereby are applied to rice leaf color regulation and chloroplast development
By knocking out the rice OsRNE gene using CRISPR/Cas9 gene editing technology, rice leaf color and chloroplast development were regulated, solving the problem of unknown OsRNE function in existing technologies. This enabled leaf albino marking and enhanced photosynthesis, thereby improving the purity of hybrid seeds.
Patent Information
- Application Number
- CN202411787941.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-06
- Publication Date
- 2026-07-07
- Estimated Expiration
- 2044-12-06
AI Technical Summary
The lack of existing technologies in studying the function of the rice OsRNE gene and its encoded protein in leaf color and chloroplast development makes it difficult to improve rice leaf color and increase photosynthetic efficiency through genetic engineering.
By knocking out the rice OsRNE gene using CRISPR/Cas9 gene editing technology, and regulating the expression of the OsRNE gene-encoded protein using RNAi interference technology, combined with recombinant expression vectors and recombinant strains, rice leaf color and chloroplast development were regulated, the activity of the OsRNE gene-encoded protein was reduced or increased, and leaf color and chlorophyll content were altered.
This study demonstrated how gene editing technology can be used to regulate leaf color and chloroplast development in rice, generate leaf albino markers, improve the purity of hybrid seeds, elucidate the chloroplast development mechanism, and enhance photosynthetic efficiency.
Smart Images

Figure CN119752930B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering, specifically involving the application of the OsRNE gene and its encoded protein in the regulation of rice leaf color and chloroplast development. Background Technology
[0002] Rice is one of the most important food crops, with more than half of the population relying on it as their staple food. Chloroplasts are important organelles in rice leaves, absorbing light energy to perform photosynthesis, synthesizing energy-rich organic matter from carbon dioxide and water and releasing oxygen. Furthermore, chloroplasts can synthesize chlorophyll, keeping the leaves green. Therefore, chloroplast development affects the yield and quality of rice.
[0003] Chloroplast development can be divided into three stages: plastid DNA replication and synthesis, chloroplast “building,” and photosynthetic apparatus synthesis. In the second stage, the nuclear-encoded RNA polymerase NEP is preferentially transcribed into plastid housekeeping genes to promote chloroplast gene transcription and translation. In the third stage, the plastid-encoded RNA polymerase PEP binds to nuclear-encoded proteins, forming the photosynthetic and metabolic system that controls chloroplast development. Chloroplasts are semi-autonomous organelles with their own genomes. While their genomes are small, most proteins are encoded by nuclear genes and translocated to the chloroplasts post-translation via transport peptides to perform their functions. The rice chloroplast genome is approximately 135 kb, containing 34 RNA-coding genes and 120 protein-coding genes. About 3000 proteins play important roles in chloroplast function, with over 95% encoded by nuclear genes. In summary, chloroplast development is regulated by a coordinated effort between plastid and nuclear-encoded genes. Therefore, cloning and identifying these nuclear genes should help elucidate the complex regulatory mechanisms of plant chloroplast development.
[0004] Any defect in chloroplast development can produce leaf color phenotypic mutants. Scientists have identified many mutants, such as pale green, yellow, white stripes, variegated, and albino mutants. These mutants, especially albino mutants, are ideal materials for studying the molecular mechanisms of chloroplast and leaf development. Rice leaf color mutants can serve as morphological markers for breeding three-line or two-line sterile lines carrying leaf color markers, improving the purity of hybrid seeds. Furthermore, with the rapid development of rice functional genomics, more and more genes controlling chloroplast development are being cloned. In-depth research and analysis of the molecular mechanisms by which these genes regulate rice leaf color will help us improve rice leaf color through genetic engineering, thereby increasing leaf photosynthetic efficiency and rice yield.
[0005] The rice OsRNE gene, located on chromosome 8, encodes a protein containing a CBM2 (Carbohydrate-binding module 2) domain at the N-terminus and an RNase E / G domain at the C-terminus. To date, no functional studies of the OsRNE gene and its encoded protein in rice have been reported. Previously, we obtained homozygous mutants of OsRNE using CRISPR / Cas9 site-directed editing, which affected chloroplast development and chlorophyll synthesis, leading to seedling albinism. Functional studies of the rice OsRNE gene will help elucidate its mechanisms of action and related applications in regulating rice leaf color and chloroplast development. Summary of the Invention
[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide the application of the OsRNE gene in regulating rice leaf color and / or regulating chloroplast development.
[0007] Another technical problem to be solved by this invention is to provide the application of the protein encoded by the OsRNE gene in regulating rice leaf color and / or regulating chloroplast development.
[0008] Another technical problem to be solved by this invention is to provide the application of recombinant expression vectors, expression cassettes or recombinant bacteria containing the OsRNE gene in regulating rice leaf color and / or regulating chloroplast development.
[0009] The technical problem that this invention also aims to solve is to provide an oligonucleotide, a knockout vector, and a recombinant bacterial strain.
[0010] The final technical problem to be solved by this invention is to provide the application of the oligonucleotide, the knockout vector, and the recombinant strain in changing the color of rice leaves and / or reducing chlorophyll content and / or improving chloroplast development.
[0011] Technical solution: This invention provides the application of the OsRNE gene in regulating rice leaf color and / or regulating chloroplast development, wherein the nucleotide sequence of the OsRNE gene is as shown in SEQ ID NO.1 or a mutant, allele or derivative thereof generated by inserting, substituting or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.1.
[0012] The present invention also includes the application of the protein encoded by the OsRNE gene in regulating rice leaf color and / or regulating chloroplast development, wherein the amino acid sequence of the protein is as shown in SEQ ID NO.2 or an amino acid sequence or derivative thereof generated by inserting, substituting or deleting one or more amino acids or homologous sequences of other species in the shown amino acid sequence.
[0013] The present invention also includes the application of recombinant expression vectors, expression cassettes or recombinant bacteria containing the OsRNE gene in regulating rice leaf color and / or regulating chloroplast development, wherein the nucleotide sequence of the OsRNE gene is as shown in SEQ ID NO.1 or a mutant, allele or derivative thereof generated by inserting, substituting or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.1.
[0014] The regulation method includes reducing or increasing the expression or activity of the protein encoded by the OsRNE gene.
[0015] The methods for reducing the expression or activity of the OsRNE gene-encoded protein include RNAi interference technology or gene knockout methods.
[0016] The present invention also includes an oligonucleotide, the sequence of which is shown in SEQ ID NO.3.
[0017] The present invention also includes a knockout vector, wherein the knockout vector is obtained by ligating a double-stranded DNA fragment obtained by annealing primer pairs designed according to the oligonucleotides described above with a vector.
[0018] The present invention also includes a recombinant strain, which is obtained by introducing the knockout vector into a host bacterium.
[0019] The present invention also includes the application of the oligonucleotide, the knockout vector, and the recombinant strain in altering rice leaf color and / or reducing chlorophyll content and / or improving chloroplast development.
[0020] The application includes increasing the expression levels of rpoA, rpoB, rpoC1 and rpoC2 and / or decreasing the expression levels of psaA1, psaA2, psbD1, atpA, atpB, rbcL, OsHEML, OsCHLH, OsCHLI, OsCRD1, OsCAO1 and / or OsPORA.
[0021] The specific technical steps for implementing this invention are as follows: The mutations in the leaf color regulation gene and chloroplast development gene OsRNE involved in this invention were obtained by knocking out Zhonghua 11 in conventional japonica rice using CRISPR / Cas9 gene editing technology. The mutant osrne exhibits leaf albinoing from seed germination, and seedlings die around the three-leaf stage. Its chlorophyll a, chlorophyll b, and carotenoid content are significantly reduced compared to the wild type. Transmission electron microscopy observations show that the ultrastructure of wild-type chloroplasts is normal, containing a large number of well-developed thylakoids, while the mutant osrne exhibits two types of chloroplast morphology: one with a significantly reduced number of thylakoid membranes, and the other, more severely, with virtually no thylakoids in the chloroplasts. SDS-PAGE analysis revealed a significant reduction in the content of the Rubisco large subunit RbcL in the mutant leaves. The mutant showed virtually no detectable rRNA from the 23S and 16S ribosome subunits.
[0022] The aforementioned rice leaf color regulating gene OsRNE encodes a rice chloroplast endonuclease, which is mainly responsible for the metabolic activities of rRNA in chloroplasts. Mutations in this gene lead to reduced photosynthesis in chloroplasts and severe abnormalities in the ultrastructure of chloroplasts.
[0023] Beneficial Effects: Compared to existing technologies, the advantages of this invention are as follows: This invention utilizes reverse genetics technology, CRISPR / Cas9, to verify the function of the OsRNE gene. The OsRNE gene encodes a chloroplast localizing protein; mutants exhibit leaf albinoization in the seedling stage and later plant death. Since OsRNE is involved in the metabolism of chloroplast rRNA, mutations in this gene can lead to abnormal thylakoid formation in chloroplasts, resulting in decreased leaf photosynthesis. Analyzing the biological function of OsRNE is of great significance for further understanding the chloroplast development mechanism. Furthermore, since homozygous OsRNE is lethal, future genetic engineering techniques can be used to cultivate three-line or two-line sterile lines carrying leaf albino markers, improving the purity of hybrid seeds. Attached Figure Description
[0024] Figure 1 Genotypes and seedling phenotypes of OsRNE knockout mutants obtained using CRISPR / Cas9. Figure 1 A represents the gRNA sequence for the knockout target site; Figure 1 B is the sequencing peak diagram of the knockout mutant target site; Figure 1 C represents the normal phenotype of wild-type seedlings; Figure 1 D represents the albino phenotype of osrne-1 mutant seedlings.
[0025] Figure 2 Analysis of pigment content and rRNA in wild-type and osrne-1 mutants. Figure 2A represents the content of chlorophyll a, chlorophyll b, and carotenoids in the wild type and osrne-1 mutant; Figure 2 B represents the content of RbcL protein in wild-type and osrne-1 mutants analyzed by SDS-PAGE; Figure 2 C and Figure 2 D represents the detection of rRNA from the 23S and 16S subunits of chloroplast ribosomes in wild-type and osrne-1 mutants.
[0026] Figure 3 Ultrastructural observation of chloroplasts in wild-type and osrne-1 mutant. Figure 3 A and Figure 3 B represents the observation of wild-type chloroplast structure, in which... Figure 3 B is Figure 3 Enlarged view of the area within box A; Figure 3 C- Figure 3 F represents the observation of chloroplast structure in the osrne-1 mutant. Figure 3 D and Figure 3 F are respectively Figure 3 C and Figure 3 Enlarged view of the area within box E; compared to the wild type. Figure 3 D and Figure 3 F represents two different types of thylakoid changes in the mutant, where Figure 3 F contains almost no thylakoids.
[0027] Figure 4 The expression levels of OsRNE in various tissues of rice. Figure 4 A represents the results of gene expression database analysis; Figure 4 B and Figure 4 C represents OsRNE during the heading stage ( Figure 4 B) and the three-leaf stage ( Figure 4 C) Relative expression levels in different tissues of rice. R represents root; C represents stem; L represents leaf; LS represents leaf sheath; P represents panicle; YR represents young root at the three-leaf stage; YS represents young stem at the three-leaf stage; L2 represents the second leaf at the three-leaf stage; L3 represents the third leaf at the three-leaf stage.
[0028] Figure 5 Subcellular localization of OsRNE protein in tobacco and rice. Figure 5 A represents the localization of OsRNE-GFP in tobacco mesophyll cells; Figure 5 B represents the localization of OsRNE-GFP in rice protoplasts.
[0029] Figure 6 Expression analysis of chlorophyll metabolism and chloroplast development genes in wild-type and osrne-1. Figure 6 A represents the expression level of genes related to chloroplast biosynthesis detected by qRT-PCR; Figure 6 B represents the detection of the expression levels of photosynthesis-related genes by qRT-PCR; Figure 6 C represents the expression level of chlorophyll synthesis-related genes detected by qRT-PCR. Detailed Implementation
[0030] The present invention will be further described below through specific embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods.
[0031] The background material selected for this invention is Zhonghua 11 (ZH11), a conventional rice variety. The base editing receptor variety is from Wuhan Boyuan Biotechnology Co., Ltd. The wild-type OsRNE gene sequence of ZH11 is shown in SEQ ID NO.1, and the amino acid sequence of the OsRNE protein is shown in SEQ ID NO.2.
[0032] SEQ ID NO.1:
[0033]
[0034]
[0035]
[0036]
[0037] SEQ ID NO.2
[0038]
[0039] Example 1: Selection of CRISPR / Cas9 Knockout Targets
[0040] The OsRNE gene (LOC_Os08g23430) contains 14 exons and 13 introns. The full-length CDS of the gene is 3258 bp, encoding 1085 amino acids. Figure 1 A). To obtain a mutant with complete loss of OsRNE function, a suitable target site was designed on its first exon, and the primer sequence is as follows:
[0041] Target: GACGCCATGGATACCGGCGTG (SEQ ID NO.3) Figure 1 A)
[0042] The following oligonucleotides were synthesized by Nanjing Qingke Biotechnology Co., Ltd. for targeting this sequence: CR-OsRNE-F:5'-TGTGTGACGCCGGTATCCATGCGTC-3' (SEQ ID NO.4); CR-OsRNE-R:5'-AAACGACGCATGGATACCGGCGTCA-3' (SEQ ID NO.5).
[0043] The synthesized 10 μM primer working solution was mixed in the following ratio: 8 μL ddH2O + 1 μL CR-OsRNE-F + 1 μL CR-OsRNE-R, and annealed to obtain a double-stranded DNA fragment with adapter. The CRISPR / Cas9 editing vector (CRISPR / Cas9 was provided by Professor Zhang Hui of Shanghai Normal University; the article on this vector is: Generation of new glutinous rice by CRISPR / Cas9-targeted mutagenesis of the Waxy gene in eliterice varieties. Zhang J, Zhang H, Botella JR, Zhu JK) was digested with BsaI, and the linear vector fragment was recovered by agarose gel electrophoresis. The digested vector was ligated to the annealed double-stranded DNA with sticky ends and transformed into DH5α E. coli. Positive clones were identified and sequenced for verification.
[0044] The constructed OsRNE knockout vector was transformed into callus tissue of japonica rice Zhonghua 11 by Wuhan Boyuan Biotechnology Co., Ltd., resulting in transgenic families. Genotyping identification yielded knockout mutants osrne-1 and osrne-2, with single-base insertions of A and T in the first exon of OsRNE, respectively. Figure 1 B) causes frameshift translation of OsRNE, leading to premature protein termination. Compared to the wild-type Zhonghua 11, the homozygous mutant seedlings exhibit leaf albinoization and gradually die during the seedling stage. Figure 1 (C, D). The above results indicate that knocking out the OsRNE gene using gene editing technology can produce a leaf leukoplakia-like lethal phenotype.
[0045] Example 2: Phenotypic analysis of OsRNE knockout mutants
[0046] The determination of photosynthetic pigment content revealed that the contents of chlorophyll a, chlorophyll b, and carotenoids in the mutant osrne-1 were significantly lower than those in the wild type. Figure 2 A). SDS-PAGE results showed that the RbcL protein content in mutant seedlings was significantly reduced compared to the wild type. Figure 2B). Furthermore, rRNA from the 23S and 16S subunits of the chloroplast ribosome is almost undetectable in the mutant. Figure 2 C,D).
[0047] To further clarify the changes in chloroplast morphology, the ultrastructure of wild-type and mutant osrne-1 chloroplasts was observed using transmission electron microscopy. Wild-type chloroplasts were well-developed, containing numerous thylakoids, and the thylakoid membrane structure was clearly visible. Figure 3 A, B), while the mutants exhibit severe changes in chloroplasts, containing two types: one with a very small number of thylakoid membranes ( Figure 3 C, D), another type contains almost no thylakoids ( Figure 3 E, F). In summary, the mutant osrne-1 exhibits defects in chloroplast development, leading to abnormal thylakoid development, impaired photosynthetic pigment synthesis, and reduced rRNA content in the 23S and 16S subunits.
[0048] Example 3: Tissue expression analysis of the OsRNE gene and subcellular localization of the encoded protein
[0049] The expression pattern of OsRNE was analyzed using the website (https: / / bar.utoronto.ca / efprice / cgi-bin / efpWeb.cgi). The results showed that OsRNE exhibited a constitutive expression pattern, with higher expression levels in leaves. Figure 4 A). Subsequently, we designed and synthesized the quantitative real-time primers qRT-OsRNE-F: 5'-TTGCCATGGTATTGGCCGTGTG-3' (SEQ ID NO.6) and qRT-OsRNE-R: 5'-GCAAGGCGTCGACAGATTTCAC-3' (SEQ ID NO.7). RNA was extracted from various tissues of Zhonghua 11 and from the endosperm at different developmental stages after flowering using the Trizol method, and reverse transcribed into cDNA for qRT-PCR. The results showed that the OsRNE gene was expressed in roots, stems, leaves, leaf sheaths, and spikes, with the highest expression level in leaves (…). Figure 4 B). Tissue analysis of seedlings at the three-leaf stage revealed the highest expression level in the L3 leaf. Figure 4 C). The above results indicate that OsRNE is mainly expressed in the green tissue leaves of rice, and participates in leaf color regulation and chloroplast development.
[0050] To investigate the subcellular localization pattern of OsRNE protein, we constructed a truncated OsRNE-GFP fusion expression vector containing an N-terminal transport peptide. The primers were SL-OsRNE-F: 5'-GGACTAGTATGGCCGCCCGCGCGCT-3' (SEQ ID NO. 8) and SL-OsRNE-R: 5'-CGCGGATCCTTTCATCCACAGATCTTTC-3' (SEQ ID NO. 9). The OsRNE-GFP fusion protein was expressed using transient expression systems in tobacco and rice protoplasts, respectively. Observation of the OsRNE-GFP fusion protein expression using laser confocal microscopy revealed overlap between the green fluorescence and the chloroplast autofluorescence signal. Figure 5 (A, B). The above results indicate that OsRNE is located in chloroplasts.
[0051] Example 4: Expression analysis of chlorophyll metabolism and chloroplast development genes in wild-type and mutant seedlings
[0052] To further investigate the effects of the OsRNE mutation on the expression of other genes related to chlorophyll biosynthesis and chloroplast development, we analyzed qRT-PCR for four chloroplast development genes (rpoA, rpoB, rpoC1, and rpoC2), seven photosynthesis-related genes (psaA1, psaA2, psbD1, atpA, atpB, rbcL, and RCA), and six chlorophyll biosynthesis genes (OsHEML, OsCHLH, OsCHLI, OsCRD1, OsCAO1, and OsPORA). Figure 6 The expression levels of rpoA, rpoB, rpoC1, and rpoC2, which are involved in chloroplast development, were significantly increased in the mutant. Figure 6 A), while the expression of photosynthesis-related genes, including nuclear-coding genes (RCA) and plastid-coding genes (psaA1, psaA2, psbD1, atpA, atpB, and rbcL), was significantly reduced in osrne-1. Figure 6 B). Furthermore, the transcriptional levels of chlorophyll synthesis genes (OsHEML, OsCHLH, OsCHLI, OsCRD1, OsCAO1, and OsPORA) were significantly reduced in the mutant osrne-1. Figure 6 C).
Claims
1. Knockout OsRNE The application of the gene in downregulating rice leaf color and / or inhibiting chloroplast development is characterized by, The OsRNE The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. Knockout OsRNE The application of a gene-encoded protein in downregulating rice leaf color and / or inhibiting chloroplast development, characterized by: The amino acid sequence of the protein is shown in SEQ ID NO.
2.
3. The application of oligonucleotides, knockout vectors, or recombinant strains in downregulating rice leaf color and / or reducing chlorophyll content and / or inhibiting chloroplast development, characterized in that... The sequence of the oligonucleotide is shown in SEQ ID NO.
3. The knockout vector is obtained by annealing the double-stranded DNA fragment obtained by designing primer pairs based on the oligonucleotide and ligating them with the vector. The recombinant strain is obtained by introducing the knockout vector into the host bacteria.
4. The application according to claim 3, wherein the application includes adding... rpoA , rpoB , rpoC1 and rpoC2 Expression level and / or decrease psaA1 , psaA2 , psbD1 , atpA , atpB , rbcL , OsHEML , OsCHLH , OsCHLI , OsCRD1 , OsCAO1 and / or OsPORA The amount of expression.
Citation Information
Patent Citations
Gene YL-1 for controlling paddy rice chlorophyll synthesis and use thereof
CN106467916A