Ggeago-based dna molecular cloning method and application thereof
By using GgeAgo nuclease derived from thermophilic bacteria to cleave plasmids or dsDNA and combining it with recombinant cloning methods, the efficiency and cost control problems of existing molecular cloning technologies have been solved, achieving efficient and specific DNA molecular cloning.
Patent Information
- Application Number
- CN202411698812.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-26
- Publication Date
- 2026-05-29
- Estimated Expiration
- 2044-11-26
AI Technical Summary
Current molecular cloning technology faces challenges in terms of cloning efficiency, cost control, and GC content, which limits its application in recombinant DNA technology.
A reaction system using GgeAgo nuclease derived from thermophilic bacteria to cleave plasmids or dsDNA, combined with recombinant cloning assembly methods, was developed to achieve efficient and specific DNA molecular cloning.
It achieves a wide range of target ranges and highly specific site-specific insertion, is easy to operate, requires no additional purification steps, and has high cloning efficiency, especially when the GC content is 29%-64%.
Smart Images

Figure CN119752964B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a DNA molecular cloning method based on GgeAgo and its applications. Background Technology
[0002] Molecular cloning technology plays an important role in various fields such as genetic engineering, clinical diagnosis, and animal husbandry. Currently, this technology mainly relies on restriction enzymes derived from bacteria that recognize specific DNA sequences and cut DNA at or near the recognition site. However, most of these enzymes only recognize short DNA sequences (4-8 base pairs), which greatly limits their application in recombinant DNA technology.
[0003] Prokaryotic Argonaute proteins (pAgos) are a class of nucleases that can be guided by various nucleic acids, exhibiting high diversity in guidance and target specificity. Compared to most other endonucleases, they possess advantages such as high specificity, no target sequence restrictions, and low reaction cost. These characteristics have led researchers to consider using pAgos as a tool for molecular cloning. Our earlier research on thermophilic prokaryotic-derived Argos showed that some pAgos can not only specifically cleave ssDNA targets under the guidance of gDNA, but also cleave dsDNA in vitro and produce dsDNA breaks under the guidance of a pair of complementary gDNAs. This activity makes pAgos a universal restriction endonuclease for in vitro molecular cloning.
[0004] While molecular cloning technology has made significant progress in recent years, challenges remain in areas such as cloning efficiency, cost control, and GC content. Therefore, applying novel prokaryotic Argonaute nucleic acid tool enzymes with superior properties to molecular cloning can help solve these problems and is of great significance for promoting the development of synthetic biology. Summary of the Invention
[0005] The purpose of this invention is to address the shortcomings of existing nucleic acid detection technologies by providing a DNA molecular cloning method based on the endonuclease GgeAgo and its application. This method mainly involves combining the reaction system of the Ago nuclease cleaving plasmids or dsDNA with a recombination-based cloning assembly method (such as T5 cloning) to achieve various types of molecular cloning.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] The first aspect of this invention is to provide a DNA molecular cloning method based on GgeAgo, comprising the following steps:
[0008] S1. The vector plasmid is sheared by the cleavage system; the cleavage system includes:
[0009] (a) Guided nucleic acid molecule: gDNA;
[0010] (b) A programmable endonuclease GgeAgo or / and its mutants, wherein the programmable endonuclease GgeAgo is derived from thermophilic bacteria and its amino acid sequence is shown in SEQ ID NO.1, and the amino acid sequence of the mutant of GgeAgo has at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO.1;
[0011] (c) Optional plasmid or dsDNA target;
[0012] (d) Reaction buffer solution;
[0013] S2. The vector plasmid cutting product is mixed with the exogenous fragment with homologous region and then assembled using a recombination-based cloning method.
[0014] S3. The mixture obtained in step S2 is used to transform Escherichia coli and generate recombinant plasmids.
[0015] Furthermore, the length of the homologous region is 15-45 bp.
[0016] Preferably, the length of the homologous region is 18-20 bp.
[0017] Furthermore, the plasmid or dsDNA cutting conditions are 70-75℃ for 15-60 min.
[0018] Preferably, the plasmid or dsDNA is cut at 70°C for 30 minutes.
[0019] Furthermore, the GC content of any insertion site is 29%-64%.
[0020] Furthermore, a pair of forward and reverse gDNAs are designed based on the intended insertion site of the plasmid or dsDNA to guide GgeAgo to cut the plasmid or dsDNA, and the resulting cutting products are directly used for DNA fragment insertion.
[0021] Furthermore, the gDNA is 5'-phosphorylated guide DNA.
[0022] Preferably, the gDNA is 18nt 5'-phosphorylated guide DNA.
[0023] Furthermore, in step S3, the T5 exonuclease system is added to the mixture, and the digestion of the homologous region is completed in an ice-water bath.
[0024] A second aspect of the present invention is to provide a kit for cloning target DNA into a vector, comprising the above-described cutting system or reagents for preparing said cutting system.
[0025] Compared with the prior art, the beneficial effects of the present invention are:
[0026] (1) The present invention provides a DNA molecular cloning method based on GgeAgo, which has a wide targeting range, high specificity, and can achieve site-specific insertion.
[0027] (2) The operation is simple. Plasmids or dsDNA cutting products can be directly used for the insertion of foreign gene fragments without additional purification steps.
[0028] (3) Seamless cloning can be achieved by digesting homologous arms with T5 exonuclease.
[0029] (4) When the GC content of the proposed insertion site is 29%-64%, the cloning efficiency is relatively high. Attached Figure Description
[0030] Figure 1 This is a schematic diagram illustrating the working principle of the GgeAgo-based DNA molecular cloning method.
[0031] Figure 2 This is a schematic diagram showing the GC content of the target sites in the pUC19 plasmid.
[0032] Figure 3 This diagram illustrates the effect of GgeAgo cleaving the pUC19 plasmid, where OC represents an open-loop plasmid (one strand of the plasmid is broken); LIN represents a linearized plasmid (both strands of the plasmid are broken); and SC represents a supercoiled plasmid.
[0033] Figure 4 This is a diagram showing the transformation of the sub-flat panel;
[0034] Figure 5 The sequencing results for positive recombinants are shown in the figure. Detailed Implementation
[0035] To more clearly explain the technical solution and beneficial effects of the present invention, the present invention will be described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the described accompanying drawings are only some embodiments of the present invention and are used only to explain the present invention, and should not be construed as limiting the present invention.
[0036] Unless otherwise specified, the experimental methods and conditions used in the following examples are conventional methods, referencing *Molecular Cloning: A Laboratory Manual (4th Edition)* (Chinese version), published by Science Press. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0037] This invention identifies a thermostable Argonaute nuclease, abbreviated as GgeAgo, using thermophilic bacteria as the starting strain. The recombinant plasmid pET28a-GgeAgo was constructed using PCR technology. This plasmid was transformed into *E. coli*, achieving heterologous expression of GgeAgo. The protein GgeAgo produced by the recombinant strain was then purified using a Ni NTA column.
[0038] Heterologous expression and purification of GgeAgo:
[0039] The nucleotide sequence of GgeAgo was synthesized by Jinkairui Biotechnology Co., Ltd., and cloned together with the C-terminal 6×His tag into the pET28a expression vector to obtain the pET28a-GgeAgo plasmid. This plasmid was then transformed into *E. coli* Rosetta(DE3), and single colonies were picked and inoculated into LB broth containing kanamycin. The cultures were then incubated in a shaker at 37°C until the bacterial OD... 600 When the glutaric acid concentration reaches 0.6-0.8, transfer to a shaker at 18°C and induce IPTG overnight. Collect bacterial cells by centrifugation, wash with buffer, resuspend the bacterial cells in Buffer A, add PMSF to a final concentration of 1 mM, and autoclave. Collect the supernatant by centrifugation. After filtering the supernatant, perform Ni-NTA purification. Elute using a gradient of 20 mM-500 mM imidazole, and perform SDS-PAGE analysis. Collect the eluent containing high-purity target protein. Perform a two-step purification using a molecular sieve (Superdex 200 16 / 600 column, GE Healthcare). Collect the purified protein, identify and analyze its purity using SDS-PAGE, and collect the eluent containing high-purity target protein for cryopreservation.
[0040] The final purified high-purity GgeAgo protein was identified by SDS-PAGE analysis and identified as the target protein. The GgeAgo protein band conformed to the expected size of 82.3 kDa calculated by http: / / www.expasy.org / . The amino acid sequence of GgeAgo is shown in SEQ ID NO.1.
[0041] like Figure 1 The diagram shows the working principle of the DNA molecular cloning method based on GgeAgo. GgeAgo cuts plasmids (such as pUC19) under the guidance of a pair of 5' phosphorylated gDNA, linearizing the plasmids. A foreign fragment with a homologous region is added. After transforming E. coli using a recombination-based cloning assembly method (such as T5 cloning), the foreign fragment can be efficiently and accurately inserted into the target plasmid.
[0042] The cutting system provided by this invention includes:
[0043] (a) Guide nucleic acid molecule: gDNA, wherein the gDNA is a 5'-phosphorylated single-stranded DNA molecule;
[0044] (b) A programmable endonuclease GgeAgo or / and its mutants, wherein the programmable endonuclease GgeAgo is derived from thermophilic bacteria and its amino acid sequence is shown in SEQ ID NO.1, and the amino acid sequence of the mutant GgeAgo has at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO.1;
[0045] (c) Optional plasmid or dsDNA target;
[0046] (d) Reaction buffer.
[0047] In the cutting system, GgeAgo exhibits highly efficient shear activity in the temperature range of 70-75℃, with a reaction time of 15-60 min, and the optimal shear activity is achieved at 70℃ for 30 min.
[0048] The DNA molecular cloning method will be explained in detail below using the prepared GgeAgo.
[0049] Example 1
[0050] GgeAgo identifies and cleaves vector plasmids.
[0051] This embodiment uses the pUC19 plasmid as an example to briefly describe the method steps for GgeAgo to identify and cleave vector plasmids. A schematic diagram of the pUC19 target plasmid and the GC content of different insertion sites is shown below. Figure 2 As shown. The specific implementation steps are as follows:
[0052] Based on the intended insertion location of the target plasmid, a pair of forward and reverse gDNAs complementary to the pre-cut target sequence were designed. In this example, gDNAs were designed and tested simultaneously at multiple target locations with GC contents of 29%, 39%, 45%, 53%, and 64% in the pUC19 plasmid. The sequences are shown in Table 1.
[0053] Table 1. Sequence information.
[0054]
[0055] Eight pmol of GgeAgo was individually incubated with 2.5 pmol of forward and reverse gDNA corresponding to target cleavage sites with different GC contents to form Ago-single-stranded gDNA complexes. The forward and reverse gDNA were then mixed with the complexes formed by GgeAgo, and the mixture was incubated at 70°C for 30 min to treat the empty enzyme. Then, 200 ng of pUC19 plasmid was added and incubated at 70°C for 30 min. After the reaction, 100 ng of the reaction sample was added to 5× loading buffer and analyzed by electrophoresis on a 1% agarose gel.
[0056] The results are as follows Figure 3 As shown in the figure. The results show that GgeAgo can use a pair of gDNA to convert supercoiled plasmids to a highly linear state. This indicates that GgeAgo can cleave complementary supercoiled plasmid sites under the joint guidance of forward and reverse gDNA, converting supercoiled plasmids into open circular and / or linear states for insertion of exogenous fragments.
[0057] Example 2
[0058] Molecular cloning based on GgeAgo.
[0059] Based on the high activity and high precision of GgeAgo in plasmid cleavage, this embodiment constructs a novel molecular cloning technique capable of inserting exogenous gene fragments into any desired site in a selected plasmid. Here, we describe in detail the insertion of an exogenous GFP fragment (approximately 1 kb in size) into the pUC19 plasmid as an example. The GFP sequence (SEQ ID NO.20) is shown below:
[0060] caatgacatcaattattata agccgttcgctgtgtcgcacaattcgtggacgtgggaaaattgatccc attctggtgccggatccctaagcccaatgtgtttttttctagtt
[0061] ggatttgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggca gggatggctatatttctgggagcgaactccgggcgaat
[0062] acgaagcgcttggatagcttcacttgtacagctcgtccatgccggtcgactctagaggatcctctaga tttaagaaggagatatacat ATGAGTAAAGGA
[0063] GAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATT
[0064] TTCAGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACT
[0065] ACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTCGCGTATGGTCTTCAATGCTTTGC
[0066] GAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAG
[0067] GAAAGAACCATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGT
[0068] GATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAGGATGGAAACATTCTTGGACA
[0069] CAAATTGGAATACATCTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCA
[0070] AAGTCAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACA
[0071] AAATACTCCAATTGGCGATGGCCCTGTCCTTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCC
[0072] TTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGAT
[0073] TACACATGGCATGGACGAGCTGTACAAGTGAagtatcctctagagcgctcgttgacaattaatcatcggc
[0074] The specific implementation details include:
[0075] First, the pUC19 plasmid was linearized using GgeAgo following the steps described in Example 1. The product was then used directly to insert the exogenous DNA fragment without the need for purification.
[0076] Second, two 20bp end-compatible homologous regions were introduced into the insert fragment via PCR and then mixed with the plasmid digestion product. The linearized vector and DNA fragment (molar ratio of 1:3-1:5, volume not exceeding 4μL) were added to 0.5μL of 10×T5 Exobuffer, and 0.5μL of T5Exo diluted 10-fold with ddH2O was added. The reaction system was then brought up to 5μL with ddH2O, mixed well, and reacted on ice for 7min.
[0077] Third, the mixture was transformed into E. coli DH5α competent cells to generate recombinant plasmids, which were then rapidly transformed and diluted 10-fold before being plated and cultured overnight.
[0078] The specific sequences of the guide gDNA and PCR amplification primers involved in the above steps are shown in Tables 1 and 2.
[0079] Table 2. Primer sequence list for PCR amplification.
[0080]
[0081] 20bp homologous ends to the digested backbones is underlined.
[0082] Representative transformation plate results are as follows Figure 4 As shown in the figure, the vast majority of colonies emitted green fluorescence, indicating that the exogenous GFP protein gene has most likely been successfully cloned into the pUC19 plasmid.
[0083] To further determine the accuracy and efficiency of this cloning method, this embodiment further counted all transformants and green positive clones, and then randomly selected some transformed strains for Sanger sequencing.
[0084] Sequencing results as follows Figure 5 As shown in the figure, the results indicate that the exogenous gene fragment was indeed precisely and efficiently integrated into the pUC19 plasmid at the intended insertion site. When the GC content at the intended insertion site was below 53%, the cloning accuracy exceeded 50%. These sequencing results also demonstrate that using GgeAgo to cut the plasmid DNA allows for the specific insertion of the exogenous gene fragment into the target vector plasmid, achieving precise and seamless cloning.
[0085] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.
Claims
1. A DNA molecular cloning method based on GgeAgo, characterized in that, Includes the following steps: S1, the vector plasmid or other dsDNA is cleaved by the cleavage system; the cleavage system includes: (a) 5'-phosphorylation of guide DNA; (b) A programmable endonuclease, GgeAgo, whose amino acid sequence is shown in SEQ ID NO.1; The cutting conditions are a reaction at 70-75℃ for 15-60 minutes; The GgeAgo specifically cleaves dsDNA targets and generates dsDNA breaks under the guidance of a pair of forward and reverse guide DNAs (gDNA). (c) Vector plasmids or other dsDNA targets; (d) Reaction buffer solution; S2. After the cleavage product is mixed with the exogenous fragment with the homologous region, it is assembled using a recombination-based cloning method. S3. The mixture obtained in step S2 is used to transform Escherichia coli and generate recombinant plasmids.
2. The DNA molecular cloning method as described in claim 1, characterized in that, The homologous region is 15-45 bp in length.
3. The DNA molecular cloning method as described in claim 1, characterized in that, The homologous region is 18-20 bp in length.
4. The DNA molecular cloning method as described in claim 1, characterized in that, The plasmid or dsDNA was cut at 70°C for 30 minutes.
5. The DNA molecular cloning method as described in claim 1, characterized in that, The GC content of the proposed insertion site of the vector plasmid is 29%-64%.
6. The DNA molecular cloning method as described in claim 1, characterized in that, The 5'-phosphorylated guide DNA is 18nt of 5'-phosphorylated guide DNA.
7. The DNA molecular cloning method as described in claim 1, characterized in that, In step S3, the T5 exonuclease system is added to the mixture, and the homologous region is digested in an ice-water bath.
8. The use of a kit comprising the cleavage system as described in claim 1 in cleaving dsDNA targets and generating dsDNA fragments.