A construct for mediating maize male sterility and use thereof

By constructing a maize male sterility construct containing the DsRed, MS45, ZmAmylase, and PAT genes, the problem of male sterility control in maize breeding was solved, enabling visual screening of red maintainer seeds and herbicide resistance, simplifying the screening process and reducing costs.

CN119753006BActive Publication Date: 2026-06-05LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
Filing Date
2024-11-25
Publication Date
2026-06-05

Smart Images

  • Figure CN119753006B_ABST
    Figure CN119753006B_ABST
Patent Text Reader

Abstract

The present application relates to the field of molecular crop breeding, and relates to a construct for mediating maize male sterility and application thereof, the construct comprising four functional element expression cassettes, namely a red fluorescent gene DsRed expression cassette, a male fertility restoration gene MS45 expression cassette, a tassel pollen lethal gene ZmAmylase expression cassette and a glufosinate-ammonium herbicide tolerance gene PAT expression cassette. The seed of the offspring plant with the specific construct obtained by the present application can be directly observed by naked eyes under the condition of not using other equipment, and the seed has glufosinate-ammonium herbicide resistance, so that the screening mode is greatly simplified, and a large amount of labor cost is saved; meanwhile, the herbicide resistance is generated, which has an important role for field screening or killing weeds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular crop breeding technology. Specifically, this invention relates to a construct for mediating male sterility in maize and its applications. Background Technology

[0002] corn plants ( Zea mays L. Maize exhibits a unique pattern, with male flowers on the tassel and female flowers on the ear, which can reproduce through both self-pollination and cross-pollination. Natural pollination in maize occurs when the wind carries pollen from the tassel to the silks that protrude from the tip of the initial ear. To produce crops with better traits (such as resistance to diseases and insects, heat tolerance, and drought tolerance), maize hybridization is commonly used to combine genetic material. These processes rely on specific male parents that contribute pollen to the female parent to produce the resulting hybrids.

[0003] Therefore, controlling plant viability is crucial for maize hybridization. To prevent cross-pollination under natural open conditions, artificial emasculation is generally used to remove the apical tassels of the recipient parent. However, this method requires significant manpower and resources, increasing seed production costs, and is not always thorough, still posing a risk of cross-pollination. Furthermore, the offspring of sterile lines obtained through conventional breeding cannot be used to propagate male-sterile materials; sterile and fertile plants cannot be quickly distinguished, and methods for screening positive plants are complex. Summary of the Invention

[0004] This invention provides a construct for mediating male sterility in maize and its application in maize breeding. The seeds of the offspring plants carrying the transgenic vector can be directly observed with the naked eye as red maintainer seeds without the need for other equipment, and they exhibit resistance to the herbicide glufosinate, greatly simplifying the screening process and saving a significant amount of labor costs. At the same time, the herbicide resistance is generated, which plays an important role in field screening or weed control.

[0005] One aspect of the present invention provides a construct for mediating male sterility in maize, employing the following technical solution:

[0006] A construct for mediating male sterility in maize includes four functional element expression boxes, wherein the functional element expression boxes are as follows:

[0007] a. Expression cassette of the red fluorescent gene DsRed;

[0008] b. Male fertility restoration gene MS45 expression cassette;

[0009] c. Expression cassette of ZmAmylase, a lethal gene in male pollen;

[0010] d. PAT expression cassette of glufosinate-tolerant herbicide gene;

[0011] The four functional element expression cassettes mentioned above are connected in series, and the series order is as follows: DsRed expression cassette for red fluorescent gene, MS45 expression cassette for male fertility restoration gene, ZmAmylase expression cassette for male pollen lethal gene, and PAT expression cassette for glufosinate-tolerant herbicide gene.

[0012] In the aforementioned scheme, the inventors selected DsRed as the red fluorescence color-developing gene, Ms45 as the male fertility restoration gene, ZmAmylase as the male pollen lethal gene, and PAT as the screening agent for tolerance to glufosinate-ammonium herbicide. During the experiments, they discovered that when these four genes were constructed into the expression vector in the order of DsRed, MS45, ZmAmylase, and PAT, a specific effect unexpectedly emerged: the seeds of the offspring plants could be directly observed with the naked eye as red maintainer seeds without the aid of other equipment.

[0013] Preferably, the nucleotide sequence of the red fluorescent gene DsRed is shown in SEQ ID NO:1, the nucleotide sequence of the male fertility restoration gene MS45 is shown in SEQ ID NO:2, the nucleotide sequence of the male pollen lethal gene ZmAmylase is shown in SEQ ID NO:3, and the nucleotide sequence of the glufosinate-tolerant herbicide gene PAT is shown in SEQ ID NO:4.

[0014] Preferably, the red fluorescent gene DsRed expression cassette is composed of a barley aleurone layer-specific expression protein promoter (HvLPT2) operably linked to the red fluorescent protein DsRed gene and operably linked to the potato protease inhibitor II gene terminator (tPinII).

[0015] Preferably, the male fertility restorer gene MS45 expression cassette is composed of a maize anther-specific expression promoter Ubi (pZm5126), which is operably linked to the male fertility protein MS45 maize fertility restorer gene (ZmMS45), and operably linked to a maize fertility restorer gene terminator (tZmMS45).

[0016] Preferably, the male tassel pollen lethal gene ZmAmylase expression cassette comprises a maize promoter (pZmPG47) operably linked to a maize polygalacturonase gene for enhanced expression, operably linked to a maize brittle-1 gene transport peptide, operably linked to a maize male tassel pollen lethal gene (ZmAmylase), and operably linked to a rice genome sequence terminator (tIn2).

[0017] Preferably, the glufosinate-tolerant herbicide gene PAT expression cassette consists of a maize ubiquitin gene promoter (pZmUbi1) operably linked to the glufosinate tolerance gene (PAT) encoding phosphinic acid acetyltransferase, and operably linked to the transcription terminator (tNos) of benzoyl alkaloid synthase.

[0018] In another aspect of the present invention, an application of the above-described construct for mediating male sterility in maize is provided for obtaining maize male-sterile lines and maintainer line materials.

[0019] The present invention also provides a method for controlling male sterility in maize, using the above-described construct.

[0020] A male-sterile maize line or maintainer line material was obtained using the method described above.

[0021] The present invention also provides a method for screening maintainer line seeds from offspring plants obtained by the above-described method for controlling male sterility in maize. Without the use of other equipment, the red seeds are identified by direct visual observation.

[0022] By implementing the above technical solution, the present invention has the following advantages compared with the prior art:

[0023] The seeds of progeny plants bearing the constructs of this invention obtained by means of this invention can be directly observed with the naked eye as red maintainer seeds without the need for other equipment, and they exhibit resistance to the herbicide glufosinate, which greatly simplifies the screening process and saves a lot of labor costs; at the same time, the herbicide resistance is generated, which plays an important role in field screening or weed control. Attached Figure Description

[0024] Figure 1 A diagram of the constructs provided by this invention;

[0025] Figure 2 This is an electrophoresis diagram verifying the target gene in the transgenic maize plant of this invention;

[0026] Figure 3 The color rendering of corn ears obtained by this invention.

[0027] Figure 4 The image shows the color development of corn ears obtained in the comparative experiment of this invention.

[0028] Figure 5 The male spike traits of the self-pollinated offspring of the maintainer line obtained in this invention;

[0029] Figure 6 The results of KI-I2 staining of pollen from the maintainer line transgenic maize obtained in this invention are shown. Detailed Implementation

[0030] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the reagents and equipment used in the present invention are conventional reagents and equipment in this technical field. Of course, the instruments and materials used in the embodiments are not limited to the examples listed herein, but are based on their ability to solve the technical problems of the present invention and achieve the corresponding technical effects.

[0031] Unless otherwise specified, the experimental methods described in the following examples are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, all reagents used are commercially available or publicly available.

[0032] In this invention, various vectors known in the art can be used, such as commercially available vectors, including plasmids.

[0033] Example 1: Construction, preservation and detection of recombinant expression vectors

[0034] Nanjing Genscript Biotechnology Co., Ltd. synthesized the red fluorescent gene DsRed (nucleotide sequence shown in SEQ ID NO:1), the male fertility restoration gene MS45 (nucleotide sequence shown in SEQ ID NO:2), the male pollen lethal gene ZmAmylase (nucleotide sequence shown in SEQ ID NO:3), and the glufosinate-tolerant herbicide gene PAT (nucleotide sequence shown in SEQ ID NO:4).

[0035] 1.1 Carrier Construction

[0036] Recombinant expression vectors pMs (e.g., ) were constructed using standard gene cloning techniques. Figure 1(As shown). The vector contains four tandem transgenic expression cassettes. The first expression cassette consists of a barley aleurone layer-specific expression protein promoter (HvLPT2) operably linked to the red fluorescent protein DsRed gene and operably linked to the potato protease inhibitor II gene terminator (tPinII). The second expression cassette consists of a maize anther-specific expression promoter Ubi (pZm5126) operably linked to the male fertility restorer protein MS45 maize fertility restorer gene (ZmMS45) and operably linked to the maize fertility restorer gene terminator (tZmMS45). The third expression cassette contains a gene for enhancing expression derived from... The first expression cassette consists of a pea chromosome motif (MAR1) operably linked to a maize promoter (pZmPG47) derived from the maize polygalacturonase gene, operably linked to the maize brittle-1 gene transport peptide, operably linked to the maize tassel pollen lethal gene (cZmAmylase), and operably linked to a rice genome sequence terminator (tIn2). The second expression cassette consists of a maize ubiquitin gene promoter (pZmUbi1) operably linked to a glufosinate tolerance gene (PAT) encoding phosphoserin acetyltransferase, and operably linked to a transcription terminator (tNos) for phosphatidylcholine synthase. The vector pMs was transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) using liquid nitrogen, and the transformed cells were screened using phosphoserin acetyltransferase (PAT) as a selection marker.

[0037] Simultaneously, following the same construction method described above, a recombinant expression vector pMs-CK was constructed. The only difference between pMs-CK and pMs is the order of the four tandem transgenic expression cassettes. The order of the recombinant expression vector pMs-CK is: male fertility restoration gene MS45 expression cassette, male pollen lethal gene ZmAmylase expression cassette, red fluorescent gene DsRed, and glufosinate-tolerant herbicide gene PAT. The vector pMs-CK was transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) using the liquid nitrogen method, and the transformed cells were screened using phosphinic acid acetyltransferase (PAT) as a selection marker.

[0038] 1.2 Plant Transformation

[0039] Transformation was performed using the conventional Agrobacterium infection method. Aseptically cultured homozygous male-sterile maize embryos were co-cultured with the Agrobacterium described in Example 1.1 to transfer the T-DNA from the constructed recombinant expression vectors pMs and pMs-CK into the maize chromosome set, thereby generating transgenic maize events.

[0040] For Agrobacterium-mediated maize transformation, briefly, immature embryos are isolated from maize and contacted with an Agrobacterium suspension, wherein Agrobacterium can deliver the nucleic acid sequences of the DsRed, ZmMS45, and ZmAmylase genes and the PAT gene to at least one cell of one of the embryos (step 1: infection step). In this step, the embryos are specifically immersed in the Agrobacterium suspension (OD660 = 0.4-0.6, infection medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 68.5 g / L, glucose) Inoculation was initiated with 36 g / L sugar, 40 mg / L acetylsuccinone (AS), 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), and pH 5.3. Immature embryos were co-cultured with Agrobacterium for a period of 3 days (Step 2: Co-culture Step). Specifically, after the infection step, the embryos were cultured on solid medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 20 g / L, glucose 10 g / L, acetylsuccinone (AS) 100 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, and agar 8 g / L). The embryos are cultured on MS medium (MS salt 4.3 g / L, pH 5.8). Following this co-culture phase, a selective "recovery" step can be performed. In the "recovery" step, the recovery medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, plant gel 3 g / L, pH 5.8) contains at least one known antibiotic that inhibits Agrobacterium growth (such as cephalosporin), without the addition of a selector for the plant transformant (Step 3: Recovery Step). Specifically, the immature embryos are cultured in a medium containing antibiotics but without a selector. The embryos were cultured on solid media to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the inoculated embryos were cultured on media containing a selector (N-(phosphonocarboxymethyl)glycine) and the growing transformed callus was selected (Step 4: Selection Step). Specifically, the embryos were cultured on a selection solid medium containing a selector (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, N-(phosphonocarboxymethyl)glycine 0.25 mol / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, plant gel 3 g / L, pH 5.8), resulting in selective growth of transformed cells. The callus then regenerated into plants (Step 5: Regeneration Step), specifically, the callus grown on the selector-containing medium was cultured on solid media (MS differentiation medium and MS rooting medium) to regenerate plants.

[0041] The selected resistant callus tissues were transferred to MS differentiation medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, N-(phosphonocarboxymethyl)glycine 0.125 mol / L, plant gel 3 g / L, pH=5.8) and cultured at 25℃ for differentiation. The differentiated seedlings were transferred to MS rooting medium (MS salt 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH=5.8) and cultured at 25℃ until approximately 10 cm tall, then transferred to a greenhouse for further cultivation until fruit set. In the greenhouse, the seedlings were cultured at 28℃ for 16 hours daily, followed by 8 hours at 20℃.

[0042] 1.3 Detection of transgenic plants

[0043] Approximately 100 mg of leaves from positive transgenic maize plants was collected as a sample. Genomic DNA was extracted using Qiagen's DNeasy Plant MaxiKit, and the copy numbers of DsRed, ZmMs45, ZmAmylase, and pat were detected by quantitative real-time PCR. Non-transgenic maize plants were used as controls, and the same analysis was performed. The experiment was conducted in triplicate, and the average value was used.

[0044] The specific method is as follows:

[0045] Step 1: Take 100 mg of leaves from the transgenic maize plant and grind them into a homogenate in a mortar using liquid nitrogen. Take 3 replicates for each sample.

[0046] Step 2: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. Refer to the product instructions for specific methods.

[0047] Step 3: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);

[0048] Step 4: Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μl;

[0049] Step 5: The copy number of the samples was identified using TaqMan probe-based quantitative real-time PCR. Samples with known copy numbers were used as standards, and non-transgenic maize plant samples were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative real-time PCR are as follows:

[0050] The following primers are used to detect the DsRed gene sequence:

[0051] Primer 1: TCAAGTCTATCTACATGGCCAAGAA is shown in SEQ ID NO:5 in the sequence listing;

[0052] Primer 2: GTGGGAGGTGATGTCCAGCTT is shown in SEQ ID NO:6 in the sequence listing;

[0053] Probe 1: CAGCTGCCCGGCTACTACTACGTGGA, as shown in SEQ ID NO:7 in the sequence listing.

[0054] The following primers are used to detect the ZmMS45 gene sequence:

[0055] Primer 3: AAGTTTGCTTTGCCATGGAGAA is shown in SEQ ID NO:8 in the sequence listing;

[0056] Primer 4: GGTACTGCACGATGCCATCA is shown in SEQ ID NO:9 in the sequence listing;

[0057] Probe 2: AACCTGCAGTGGCGG is shown in SEQ ID NO:10 in the sequence listing.

[0058] The following primers are used to detect the ZmAmylase gene sequence:

[0059] Primer 5: GAGTCCCCTGCATTTTCTACGA is shown in SEQ ID NO:11 in the sequence listing;

[0060] Primer 6: GCGTGGATATCTCCTGCTTCA is shown in SEQ ID NO:12 in the sequence listing;

[0061] Probe 3: ACATGTTCGACTGGAAC is shown as SEQ ID NO:13 in the sequence listing.

[0062] The following primers are used to detect the PAT gene sequence:

[0063] Primer 7: CCGCGGTTTGTGATATCGTT is shown in SEQ ID NO:14 in the sequence listing;

[0064] Primer 8: TCTTGCAACCTCTCTAGATCATCAA is shown in SEQ ID NO:15 in the sequence listing;

[0065] Probe 4: TAGGACAGAGCCACAAACACCACAAGAGTG is shown in SEQ ID NO:16 in the sequence listing.

[0066] The PCR reaction system is as follows:

[0067] 10 μl of 2×TransStartR GreenqPCR SuperMix (Transgen), 1 μl of 10 μM Forward primer, 1 μl of 10 μM Reverse primer, 0.4 μl of Passive Reference Dye I (50X), 2 μl of genomic DNA, and 5.6 μl of water (ddH2O).

[0068] The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and is stored in amber tubes at 4°C.

[0069] The PCR reaction conditions are as follows:

[0070] Step temperature time

[0071] 1. 95℃ for 5 minutes

[0072] 2 95℃ 30 seconds

[0073] 3. 60℃ for 1 minute

[0074] Go back to step 2 and repeat 40 times.

[0075] Data were analyzed using SDS2.3 software (Applied Biosystems) to obtain positive transgenic maize plants with successful insertion of T-DNA (DsRed, ZmMS45, ZmAmylase, PAT) into the recombinant expression vector pMs. Single-copy positive transgenic maize plants were screened for validation. See the verification figure below. Figure 2 , Figure 2 The study showed that the target genes DsRed, ZmMS45, ZmAmylase, and PAT had all been transferred into maize plants. Figure 2 In the diagram, NC is the negative control, PC is the positive control, WT is non-transgenic maize, and 1-15 are transgenic maize. Similarly, positive transgenic maize plants with T-DNA (ZmMS45, ZmAmylase, DsRed, PAT) successfully inserted into the above recombinant expression vector pMs-CK were also obtained.

[0076] Example 2: Creation of stable sterile lines and maintainer lines

[0077] Transgenic pMs plants (maternal parent) were crossed with a heterozygous ms45 mutant (paternal parent). Self-pollination of the offspring yielded maintainer lines with genotypes pMs / - and ms45 / ms45, and sterile lines with genotypes - / and ms45 / ms45. At maturity, the maintainer line offspring were visually observed; approximately half of the kernels were red (containing the pMs transgene), while the other half were yellow, consistent with the non-transgenic control (WT). After threshing, the number of red and yellow kernels in each ear was counted and recorded. The ratio of red to yellow seeds in each ear of the divided plant was calculated, and the p-value was determined.

[0078] The fluorescence irradiation observation method involves placing seeds under green light, with the observer wearing glasses fitted with red lenses. Genetically modified seeds containing pMs will appear red, while non-genetically modified seeds will not. The observation, recording, and statistical methods are the same as for the naked-eye observation method.

[0079] The DsRed gene in pMs maize is expressed using an endosperm-specific promoter, resulting in seeds that are distinctly red, clearly different from conventional seeds upon visual inspection. Figure 3 The seeds of pMs from generation T2 to T4 all showed obvious color differences, with the ratio of red to yellow seeds being approximately 1:1. This color difference was stable across generations. The segregation ratio of red to yellow seeds is shown in Table 1.

[0080] The color of the corn ears of the maize transferred to pMs-CK is shown in the figure (three parallel experiments). To the naked eye, all the seeds are yellow and cannot be distinguished. However, by fluorescence observation, the seeds of the maintainer line can be seen to be red under green light.

[0081]

[0082] Example 3: Identification of the effect of maize fertility restoration

[0083] After harvesting seeds from the self-pollination progeny of the maintainer line with genotype pMs- / ms45 ms45, transgenic (red maintainer line) and non-transgenic (yellow, sterile line) seeds were visually distinguished. These seeds were then sown in different regions, and pollen shedding was investigated when the plants entered the flowering stage. The results showed that plants in the non-transgenic areas did not produce pollen-shedding tassels, indicating male sterility; while plants in the transgenic areas produced normal pollen. Other agronomic traits were consistent between the maintainer line and the sterile line, and were also consistent with the control. This confirmed that the transgenic material can restore fertility in the sterile line. Figure 3 .

[0084] Example 4: Pollen Killing Efficacy Test

[0085] Self-pollination of the maintainer line seeds yielded T2-T4 generation red seeds, which were sown in the field and allowed to grow until pollen shedding. Pollen viability was assessed using the starch-potassium iodide staining method. Approximately one-third of the pollen on the tassels was removed, and the seeds were bagged. The bags were removed the following morning, and three samples each of pollen from the transgenic maize and the non-transgenic control (WT) were collected. The pollen was evenly sprinkled onto a slide, covered with two drops of KI-I2 (iodine-potassium iodide) solution, and allowed to stand for two minutes. Once distinct black pollen grains appeared, the pollen was observed under a microscope. The number of black and yellow pollen grains was counted and recorded by region. The proportions of the two types of pollen in each pollen group were analyzed, and the p-values ​​were calculated (see Table 2). The results showed that approximately half of the pollen from the transgenic maize was black (normal, viable non-transgenic pollen), and half was yellow (transgenic pollen, non-viable, with starch degraded by pollen-specific ZmAmylase, thus unable to show color), consistent with Mendel's laws of inheritance. The pollen of the non-GMO control corn was entirely black. (See also...) Figure 6 .

[0086]

[0087] Example 5: Pollen Leakage Rate Detection

[0088] Once the transgenic plants in the field reached the pollen shedding stage, artificial cross-pollination was performed using the maintainer line transgenic material (Ms) as the male parent and the conventional background material as the female parent. At harvest, ear traits were investigated. Theoretically, the offspring ears should contain only one type of yellow kernel, indicating non-transgenic material. The pMs-CK material was tested using fluorescence observation, while the pMs material was examined visually; the presence of red seeds indicated pollen leakage. Results showed that most kernels of the T4 maintainer line were yellow (transgenic seeds without pMs), as shown in Table 3. Simultaneously, the number of transgenic kernels in the pMs-CK control vector was measured. After threshing, the number of red kernels (under fluorescence) and yellow kernels in each ear were calculated and recorded. The ratio of red to yellow seeds in each ear of the divided plant was also recorded, and the p-value was calculated.

[0089] Table 3. Pollen leakage rate test results

[0090]

[0091] Example 6: Glufosinate tolerance test

[0092] This experiment used phosphonoammonium phosphate (PAP) herbicide for spraying. A randomized block design was employed with three replicates. The plot area was 15 m². 2(5m × 3m), row spacing 60cm, plant spacing 25cm, conventional cultivation management, with a 1m wide isolation strip between plots. Transgenic maize was subjected to the following two treatments: 1) no spraying; 2) spraying with phosmet at the V3 leaf stage at a dose of 1600 g ai / ha (4 times the recommended concentration), followed by a second spraying at the same dose at the V8 stage. It should be noted that different contents and formulations of glufosinate-ammonium herbicide, when converted to an equivalent amount of glufosinate-ammonium acid, apply to the following conclusions. Herbicide damage symptoms were investigated 1 week and 2 weeks after application, and plot yields were measured at harvest. The symptom grading is shown in Table 4. Herbicide damage rate was used as an evaluation index to assess herbicide tolerance in transformation events. Specifically, the herbicide damage rate (%) = ∑(number of affected plants of the same level × number of levels) / (total number of plants × highest level); where the herbicide damage rate refers to the glufosinate damage rate, which was determined based on the herbicide damage survey results two weeks after glufosinate treatment. Maize yield in each plot was calculated by weighing the total yield (weight) of the middle three rows of maize kernels in each plot. Yield differences between different treatments were measured as yield percentages, calculated as yield percentage (%) = sprayed yield / unsprayed yield. The results of herbicide tolerance and maize yield in maintainer line transgenic maize are shown in Table 5.

[0093] Table 4. Grading Standards for Herbicide Damage to Corn Caused by Glufosinate-Ammonium

[0094] Phytotoxicity level Symptom description Level 0 No pesticide damage, and growth was consistent with the control group in clean water; Level 1 Slight symptoms of pesticide damage are visible, including localized color changes, with pesticide-damaged spots covering less than 10% of the leaf area; Level 2 Mild growth inhibition or chlorosis, with pesticide-damaged spots covering less than 1 / 4 of the leaf area; Level 3 It has a significant impact on growth and development, causing leaf deformities, stunted growth, or pesticide-damaged spots covering less than half of the leaf area. Level 4 It has a significant impact on growth and development, resulting in severely deformed leaves, noticeably stunted plants, or leaf necrotic spots covering less than 3 / 4 of the leaves. Level 5 The pesticide damage was extremely severe, resulting in plant death or pesticide-damaged spots covering more than 3 / 4 of the leaf area.

[0095] Table 5. Results of tolerance to glufosinate herbicide and maize yield in transgenic maintainer lines of maize.

[0096] Project / Plant Maintaining system T2 CK- Damage rate of glufosinate (%) 0 0 Glufosinate damage rate (%) (Test result up to 1600 g ai / ha, recommended concentration 400 g ai / ha) 0 100 Yield percentage % (test yield up to 1600 g ai / ha, recommended concentration 400 g ai / ha) 102 0

[0097] The results showed that, regarding the herbicide (glufosinate) damage rate: 1) the damage rate of the transgenic retainer maize plants under glufosinate herbicide (1600 g ai / ha) treatment was basically 0. Therefore, the transgenic retainer maize plants have good glufosinate herbicide tolerance.

[0098] In terms of yield: there was no significant difference in yield between the two treatments of no spraying and spraying with 1600 g ai / ha glufosinate. After spraying with glufosinate herbicide, the yield of the transgenic retainer maize plants did not decrease significantly. This further indicates that the transgenic retainer maize plants have good tolerance to glufosinate herbicide.

Claims

1. A construct for mediating male sterility in maize, characterized in that, The cassette comprises four tandem expression cassettes, in the following order: DsRed (red fluorescent gene), MS45 (male fertility restorer gene), ZmAmylase (male pollen lethal gene), and PAT (glufosinate-ammonium herbicide resistant gene). The DsRed expression cassette consists of the promoter HvLPT2, the DsRed gene (nucleotide sequence as shown in SEQ ID NO:1), and the terminator tPinII. The MS45 expression cassette consists of the promoter Ubi pZm5126, the MS45 gene (nucleotide sequence as shown in SEQ ID NO:2), and the terminator tZmMS45. The ZmAmylase expression cassette consists of the motif MAR1, the promoter pZmPG47, the brittle-1 transport peptide, and the nucleotide sequence as shown in SEQ ID NO:

1. The gene ZmAmylase shown in NO:3 and the terminator tIn2 are composed of the glufosinate-tolerant herbicide gene PAT expression cassette. The gene PAT encoding phosphinic acid acetyltransferase, as shown in SEQ ID NO:4, and the terminator tNos are composed of the promoter pZmUbi1, the nucleotide sequence encoding phosphinic acid acetyltransferase as shown in SEQ ID NO:4, and the terminator tNos.

2. The application of the construct for mediating male sterility in maize as described in claim 1, characterized in that, Used to obtain male-sterile lines and maintainer lines of maize.

3. A method for controlling male sterility in maize, characterized in that, Use the construct as described in claim 1 to control male sterility in maize.

4. A method for identifying maize male-sterile lines or maintainer lines containing the construct described in claim 1, characterized in that, Seeds that are red when directly observed with the naked eye are maintainer seeds.

Citation Information

Patent Citations

  • CN103525809A

  • CN105018475A