Tandem repeat related gene mutation detection system and method for non-disease diagnosis purpose

Abstract

The invention relates to a tandem repeat related gene mutation detection system and a non-disease diagnosis purpose method. The system comprises an acquisition module, a Y-shaped pre-library preparation module, a targeted enrichment module, a single molecule real-time sequencing library construction module and a single molecule real-time sequencing analysis module, wherein target genes comprise ATXN1, ATXN3, ZFHX3, CACNA1A, ATXN7, ATXN8OS, ATXN10, PPP2R2B, TBP, FGF14, BEAN1-TK2, NOP56, DAB1, THAP11, FXN, GLS, RFC1, LRP12, GIPC1, RILPL1, VWA1, AR and DMPK; detection is carried out through three-generation sequencing, mutation setting is accurate, and the problem that an existing detection scheme is not practical is solved.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a tandem repeat-related gene detection system and a method for non-disease diagnosis purposes. Background Art

[0002] Tandem repeats (TRs) are a special type of DNA sequence in the genome, in which copies of the sequence are closely arranged together to form continuous blocks of repeats. These repeats are important for both genome structure and function, but their presence also increases the complexity of sequencing and genome assembly, because traditional short-read sequencing technologies have difficulty traversing these highly similar repeat sequences and accurately reconstructing their arrangement in the genome.

[0003] TRs are common genetic mutations throughout the human genome, with lengths ranging from 2 bases (bp) to more than 100 bp. Currently, more than 70 diseases are known to be associated with dynamic mutations in TRs. The molecular characteristics of TRs include dynamic changes in the number of repeats, high GC content, and complex sequence composition, which pose great challenges to traditional RP-PCR and AL-PCR that rely on PCR. In addition, minor variations on both sides of the repeat region may lead to false negatives / false positives. Southern blot technology is limited in its widespread clinical application due to factors such as low resolution, lack of specific sequence information, complicated processes, large DNA sample requirements, and low throughput. In recent years, high-throughput sequencing (NGS) has made significant progress in the field of genetic disease diagnosis, but its preference for GC content and short read length have hindered its widespread application in clinical diagnosis. Summary of the invention

[0004] In view of the above-mentioned deficiencies in the prior art, the present invention aims to provide a tandem repeat-related gene mutation detection system and a method for non-disease diagnosis purposes, so as to detect complex variation types and unknown mutations of tandem repeat-related genes.

[0005] In order to solve the above problems, the present invention adopts the following technical solutions:

[0006] In one aspect, the present invention provides a tandem duplication-related gene mutation detection system, wherein the tandem duplication-related genes include 17 ataxia-related genes, 11 neuromuscular disease-related genes, 13 other neurological disease-related genes, 10 developmental disorder-related genes, 1 respiratory disorder-related gene, and 2 malnutrition-related genes;

[0007] The 17 ataxia disease-related genes include 18 genes, namely ATXN1, ATXN2, ATXN3, ZFHX3, CACNA1A, ATXN7, ATXN8OS, ATXN10, PPP2R2B, TBP, FGF14, BEAN1-TK2, NOP56, DAB1, THAP11, FXN, GLS, and RFC1;

[0008] The 11 neuromuscular disease-related genes included 12 genes, namely LRP12, GIPC1, RILPL1, VWA1, AR, DMPK, C9orf72, PABPN1, CNBP, NUTM2B-AS1, SAMD12, and PLIN4;

[0009] 13 other neurological disease-related genes included 14 genes, namely CSTB, FMR1, HTT, ATN1, TNRC6A, YEATS2, PRNP, STARD7, DIP2B, MARCHF6, NOTCH2NLC, JPH3, ARX, and SOX3;

[0010] The 10 developmental disorder-related genes include 10 genes, namely HOXA13, RUNX2, ZIC2, EIF4A3, FOXL2, AFF3, AFF2, HOXD13, CBL, and XYLT1;

[0011] One respiratory disorder disease-related gene contains one gene, PHOX2B;

[0012] The two malnutrition disease-related genes include two genes, TCF4 and DMD;

[0013] A tandem repeat-related gene mutation detection system, comprising an acquisition module, a Y-shaped pre-library preparation module, a targeted enrichment module, a single-molecule real-time sequencing library construction module and a single-molecule real-time sequencing analysis module;

[0014] The collection module is used to collect peripheral blood of the subject to be tested and to extract, shear and screen high molecular weight DNA;

[0015] The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the extracted and sheared high molecular weight DNA, perform Y-shaped adapter connection and fragment screening, and then use a long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library;

[0016] The targeted enrichment module is used to denature the Y-shaped pre-library and the probe and use a biotin-labeled capture probe to hybridize the target gene, perform targeted enrichment, and perform long-fragment PCR amplification after capture to obtain a capture library;

[0017] The single-molecule real-time sequencing library construction module is used to perform DNA damage repair, end repair, purification, sequencing adapter connection and digestion according to the captured library to obtain a single-molecule real-time sequencing library;

[0018] The single-molecule real-time sequencing analysis module is used to perform single-molecule real-time sequencing with a single-molecule real-time sequencing library, obtain sequencing data of a target region, decompose the sequencing data of the target region, and analyze and obtain the variation type of tandem duplication-related genes.

[0019] As an implementation method, the target region capture range of the target region capture probe labeled with biotin is:

[0020] ATXN1: GRCh38 / hg38, chr6: 16327535-16327822;

[0021] ATXN3: GRCh38 / hg38, chr14: 92070910-92071140;

[0022] ZFHX3: GRCh38 / hg38, chr16: 72787594-72787857;

[0023] CACNA1A: GRCh38 / hg38, chr19: 13207758-13207997;

[0024] ATXN7: GRCh38 / hg38, chr3: 63912585-63912815;

[0025] ATXN8OS: GRCh38 / hg38, chr13: 70139283-70139528;

[0026] ATXN10: GRCh38 / hg38, chr22: 45795254-45795524;

[0027] PPP2R2B: GRCh38 / hg38, chr5: 146878628-146878858;

[0028] TBP: GRCh38 / hg38, chr6: 170561807-170562115;

[0029] FGF14: GRCh38 / hg38, chr13: 102161476-102161826;

[0030] BEAN1-TK2:GRCh38 / hg38,chr16:66490298-66490566;

[0031] NOP56:GRCh38 / hg38,chr20:2652633-2652857;

[0032] DAB1:GRCh38 / hg38,chr1:57366943-57367218;

[0033] THAP11:GRCh38 / hg38,chr16:67842763-67843050;

[0034] FXN:GRCh38 / hg38,chr9:69037186-69037404;

[0035] GLS:GRCh38 / hg38,chr2:190880772-190881020;

[0036] RFC1:GRCh38 / hg38,chr4:39348324-39348585;

[0037] LRP12:GRCh38 / hg38,chr8:104588872-104589099;

[0038] GIPC1:GRCh38 / hg38,chr19:14495941-14496174;

[0039] RILPL1:GRCh38 / hg38,chr12:123533620-123533851;

[0040] VWA1:GRCh38 / hg38,chr1:1435698-1435918;

[0041] AR:GRCh38 / hg38,chrX:67545216-67545485;

[0042] DMPK:GRCh38 / hg38,chr19:45770104-45770364;

[0043] C9orf72:GRCh38 / hg38,chr9:27573428-27573646;

[0044] PABPN1:GRCh38 / hg38,chr14:23321372-23321590;

[0045] CNBP:GRCh38 / hg38,chr3:129172476-129172756;

[0046] NUTM2B-AS1:GRCh38 / hg38,chr10:79826277-79826503;

[0047] SAMD12:GRCh38 / hg38,chr8:118366715-118367019;

[0048] PLIN4:GRCh38 / hg38,chr19:4512708-4513408;

[0049] CSTB:GRCh38 / hg38,chr21:43776343-43776579;

[0050] HTT:GRCh38 / hg38,chr4:3074776-3075033;

[0051] ATN1:GRCh38 / hg38,chr12:6936628-6936873;

[0052] TNRC6A:GRCh38 / hg38,chr16:24613339-24613629;

[0053] YEATS2:GRCh38 / hg38,chr3:183712087-183712322;

[0054] PRNP:GRCh38 / hg38,chr20:4699270-4699545;

[0055] STARD7:GRCh38 / hg38,chr2:96196966-96197221;

[0056] DIP2B:GRCh38 / hg38,chr12:50504903-50505124;

[0057] MARCHF6:GRCh38 / hg38,chr5:10356247-10356507;

[0058] NOTCH2NLC:GRCh38 / hg38,chr1:149390702-149390929;

[0059] JPH3:GRCh38 / hg38,chr16:87604187-87604429;

[0060] ARX:GRCh38 / hg38,chrX:25013549-25013797;

[0061] SOX3:GRCh38 / hg38,chrX:140504216-140504461;

[0062] HOXA13:GRCh38 / hg38,chr7:27199824-27200066;

[0063] RUNX2:GRCh38 / hg38,chr6:45422650-45422901;

[0064] ZIC2:GRCh38 / hg38,chr13:99985348-99985593;

[0065] EIF4A3:GRCh38 / hg38,chr17:80146892-80147239;

[0066] FOXL2:GRCh38 / hg38,chr3:138945920-138946162;

[0067] AFF3:GRCh38 / hg38,chr2:100104698-100104922;

[0068] HOXD13:GRCh38 / hg38,chr2:176092958-176093203;

[0069] CBL:GRCh38 / hg38,chr11:119206189-119206422;

[0070] XYLT1:GRCh38 / hg38,chr16:17470807-17471022;

[0071] TCF4:GRCh38 / hg38,chr18:55586055-55586327;

[0072] DMD:GRCh38 / hg38,chrX:31284457-31284705;

[0073] PHOX2B:GRCh38 / hg38,chr4:41745871-41746131;

[0074] ATXN2: GRCh38 / hg38, chr12: 111598850-111599119;

[0075] FMR1: GRCh38 / hg38, chrX: 147911950-147912210;

[0076] AFF2: GRCh38 / hg38, chrX: 148500538: 148500783.

[0077] Furthermore, the Y-shaped pre-library and the probe are denatured and the target gene is hybridized, targeted enriched and captured by a capture probe labeled with biotin, and the long-fragment PCR amplification is performed to obtain a capture library, including:

[0078] The biotin-labeled capture probe and Y-shaped pre-library were vacuum concentrated to a dry powder state and resuspended;

[0079] The resuspended product is subjected to denaturation of the Y-shaped pre-library and probe;

[0080] Add 20 μl of hybridization buffer preheated at 65°C for at least 5 min to the denatured prelibrary and probe mixture to perform hybridization reaction;

[0081] The hybridization product was eluted using streptavidin magnetic beads;

[0082] The eluted product is subjected to long-fragment PCR amplification after capture using a long-fragment-specific amplification enzyme;

[0083] The product after long-fragment PCR amplification is purified using magnetic beads to obtain a capture library.

[0084] Furthermore, the denaturation temperature of the Y-shaped pre-library and the probe is 95° C. and the time is 10 min.

[0085] Furthermore, the hybridization temperature and time for hybridizing the target gene using the biotin-labeled capture probe are 72° C. and 20 h.

[0086] Furthermore, the DNA damage repair reagent includes 5 μl 10× DNA damage repair buffer, 0.5 μl 10× NAD + , 5 μl 10 mM ATP, 2 μl DNA damage repair enzyme mixture, 1 μg capture product DNA, and make up to 50 μl with water;

[0087] The reagents for sequencing adapter ligation include 30 μl of captured product DNA after end repair purification, 1 μl of PacBio platform sequencing adapter, 4 μl of 10× ligation buffer, 2 μl of 1 mM ATP and 1 μl of DNA ligase, and the mixture is filled to 40 μl with water.

[0088] Furthermore, the single molecule real-time sequencing analysis module is used for:

[0089] Lima software was used to split PacBio sequencing data and divide the raw sequencing data into different samples according to different index sequences;

[0090] Use Minimap2 to compare the cleaned sample data with the reference genome hg38 to ensure the accuracy of the data;

[0091] Perform quality control statistical analysis to control the sequencing data of the target region, including data volume, alignment rate, and fragment length;

[0092] Trgt software was used to process BAM files and analyze BAM files, including genotyping of tandem repeat sequences, composition of repeat sequences, and number of repeats;

[0093] The number of repetitions of the repeated sequence in the analysis results is compared with the number of repetitions of the corresponding clinical pathogenic related sequences to determine the positive or negative nature of the sample.

[0094] In another aspect, the present invention provides a method for detecting tandem duplication-related gene mutations for non-disease diagnosis purposes, characterized in that it comprises:

[0095] Collect peripheral blood from the subjects and perform high molecular weight DNA extraction, shearing and fragment screening;

[0096] The extracted and sheared high molecular weight DNA is subjected to end repair and 3'A-tailing reaction, and Y-shaped adapter ligation and fragment screening are performed, and then long-fragment PCR amplification is performed using a long-fragment amplification enzyme to obtain a Y-shaped pre-library;

[0097] Denaturing the Y-shaped pre-library and probes and using biotin-labeled capture probes to hybridize the target gene, perform targeted enrichment, and perform long-fragment PCR amplification after capture to obtain a capture library;

[0098] Based on the captured library, DNA damage repair, end repair, purification, sequencing adapter ligation and digestion are performed to obtain a single-molecule real-time sequencing library;

[0099] Single-molecule real-time sequencing is performed using a single-molecule real-time sequencing library to obtain sequencing data of the target region, the sequencing data of the target region is disassembled, and the variation types of tandem duplication-related genes are analyzed;

[0100] The target genes include ATXN1, ATXN3, ZFHX3, CACNA1A, ATXN7, ATXN8OS, ATXN10, PPP2R2B, TBP, FGF14, BEAN1-TK2, NOP56, DAB1, THAP11, FXN, GLS, RFC1, LRP12, GIPC1, RILPL1, VWA1, AR, DMPK, C9orf72, PABPN1, CNBP, NUTM2B-AS1 , SAMD12, PLIN4, CSTB, HTT, ATN1, TNRC6A, YEATS2, PRNP, STARD7, DIP2B, MARCHF6, NOTCH2NLC, JPH3, ARX, S OX3, HOXA13, RUNX2, ZIC2, EIF4A3, FOXL2, AFF3, HOXD13, CBL, XYLT1, PHOX2B, TCF4, ATXN2, FMR1, AFF2 and DMD.

[0101] The beneficial effects of the present invention are as follows: the present invention only includes the upstream and downstream regions of the tandem repeats (the flanking regions), which can reduce the problem of non-specific capture of other similar region fragments by the probe due to the low complexity of the STR region, thereby increasing the effective fragment ratio and reducing the sequencing cost;

[0102] The tandem repeat detection of the present invention has a wide coverage, including 57 genes, 57 loci, involving ataxia, neuromuscular disease and other neurological diseases, developmental disorders, respiratory disorders, corneal degenerative diseases and other 55 diseases.

[0103] The present invention has accurate detection. It uses the advantages of long read length, high precision and high uniformity of the third-generation Pacbio Hifi mode to accurately identify the number of repeating units and provide patients with a basis for accurate treatment.

[0104] The present invention independently designs a high-precision algorithm for each tandem repeat to improve the accuracy and speed of identifying tandem repeat sequences. The self-built database accurately records the number of pathogenic repeat units and continuously integrates the latest research findings and clinical data to help clinicians quickly interpret them. BRIEF DESCRIPTION OF THE DRAWINGS

[0105] Figure 1 This is a quality inspection diagram of the fragment length distribution of the captured library of the present invention; wherein, Migration time represents the migration time, LM20 represents a band with a size of 20 bp in the quality inspection marker, and LM1000 represents a band with a size of 1000 bp in the quality inspection marker. DETAILED DESCRIPTION

[0106] The present invention is further described in detail below in conjunction with specific embodiments.

[0107] It should be noted that these embodiments are only used to illustrate the present invention rather than to limit the present invention. Simple improvements to the method based on the concept of the present invention all fall within the scope of protection claimed by the present invention.

[0108] Example 1 Construction of a tandem duplication-related gene mutation detection process

[0109] 1. Collect 10 mL of peripheral blood from the patient using an EDTA anticoagulant tube.

[0110] 2. Extraction of genomic DNA.

[0111] The peripheral blood of the subjects to be tested was extracted using a special high molecular weight DNA extraction kit to obtain high molecular weight gDNA, and the concentration was measured and the integrity of the genomic DNA was detected by agarose gel electrophoresis.

[0112] 3. Shearing of high molecular weight gDNA

[0113] (1) Take 2 μg of high molecular weight gDNA from the subject to be tested and wash with ddH 2 HO and dilute to 150 μL.

[0114] (2) Place the diluted sample into the top of the g-TUBE (Covaris, 520079) device and close the lid tightly.

[0115] (3) Place the g-TUBE containing the sample into a centrifuge and set the interruption condition to 6000 rpm for 2 min. The interruption condition mentioned here is based on the use of an Eppendorf 5424 centrifuge. If the centrifuge is replaced, the interruption condition needs to be retested.

[0116] (4) Flip the g-TUBE device over and centrifuge under the same conditions. If there is still residual sample at the top, centrifuge the sample at a higher speed for 5 seconds. Repeat the high-speed centrifugation until all the sample is in the bottom chamber of the g-TUBE.

[0117] (5) Transfer the sample to a new 1.5 mL low-absorbency centrifuge tube for later use.

[0118] 4. Screening of fragmented DNA

[0119] (1) AmpureXP beads (Beckman, A63881) were diluted 2× using 1 mM Tris-HCl pH 8.

[0120] (2) Mix the fragmented DNA to be screened and the diluted fragment screening magnetic beads in a ratio of 1:4.

[0121] (3) Briefly centrifuge the tube to concentrate the magnetic bead / DNA mixture at the bottom of the tube. Place the tube on a magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0122] (4) Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, remove the 80% ethanol with a pipette.

[0123] (5) Eluting the cleaned magnetic beads to obtain fragmented DNA after fragment screening.

[0124] 5. Use the S3 cartridge for large fragment detection (Bioptic, c105106) to perform Qsep100 quality inspection on the fragmented DNA after fragment screening. The proportion of fragments below 3 kbp should be less than 10%, otherwise it will be regarded as unqualified fragmented DNA.

[0125] 6. Preparation of pre-library

[0126] (1) Use a long fragment library construction kit to construct a long fragment Y-shaped pre-library. Dilute the purified fragmented DNA that has passed the quality inspection to 50 μL, and prepare the end repair and 3'A-tailing reactions according to Table 1.

[0127] Table 1 Preparation of end repair and 3'A-tailing reaction reagents

[0128]

[0129] Set up the PCR program according to Table 2 to perform end repair and 3'A-tailing reactions.

[0130] Table 2 End repair and 3'A-tailing reaction PCR program

[0131]

[0132] (2) Adapter ligation: Add the following components in order according to Table 3 to the end repair and 3'A-tailing reaction products.

[0133] Table 3 Connector connection reagents

[0134]

[0135] Adapter sequence

[0136] A.ACACTCTTTCCCTACACGACGCTCTTCCGATC*T

[0137] BP-GATCGGAAGAGCACACGTCT

[0138] P: Phosphorylation*Phosphorylation

[0139] Vortex to mix, centrifuge briefly to ensure that all the solution is at the bottom of the tube, and immediately incubate at 20°C for 1 h in a PCR instrument with the heated lid set to 85°C.

[0140] (3) Fragment screening of adapter ligation products

[0141] ① Dilute AmpureXP beads (Beckman, A63881) in 1 mM Tris-HCl pH 8 at a 2× dilution ratio.

[0142] ② Mix the adapter ligation product to be screened with the diluted fragment screening magnetic beads in a ratio of 1:4.

[0143] ③ Centrifuge momentarily to concentrate the magnetic beads / DNA mixture at the bottom of the tube. Place the centrifuge tube on the magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the centrifuge tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0144] ④ Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, aspirate the 80% ethanol with a pipette.

[0145] ⑤ Elute the cleaned magnetic beads to obtain the adapter connection product after fragment screening.

[0146] (3) The ligation product was subjected to long-fragment PCR amplification using a dedicated enzyme for long-fragment amplification, and the reaction system was configured according to Table 4; the dedicated enzyme for long-fragment amplification was Takara LA Taq DNA Polymerase Hot-Start Version (Takara, RR042A).

[0147] Table 4 Long fragment PCR amplification reagents

[0148]

[0149] Index primer sequence

[0150] Sequence 1:

[0151] CAAGCAGAAGACGGCATACGAGATNNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

[0152] Sequence 2:

[0153] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNAACACTCTTTCCCTACACGAGCTCTTCCGATCT.

[0154] N is any base of A, T, C or G.

[0155] Different tags can be single nucleotide sequences of lengths such as 8nt, 10nt, or 12nt.

[0156] Carry out PCR reaction according to Table 5.

[0157] Table 5 Long fragment PCR amplification program

[0158]

[0159]

[0160] (4) The Y-shaped pre-library PCR products were screened for fragments, aiming to control short fragments below 3 kb to less than 10%.

[0161] ① Dilute AmpureXP beads (Beckman, A63881) in 1 mM Tris-HCl pH 8 at a 2× dilution ratio.

[0162] ② Mix the Y-shaped pre-library PCR product to be screened with the diluted fragment screening magnetic beads in a ratio of 1:4.

[0163] ③ Centrifuge momentarily to concentrate the magnetic beads / DNA mixture at the bottom of the tube. Place the centrifuge tube on the magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the centrifuge tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0164] ④ Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, aspirate the 80% ethanol with a pipette.

[0165] ⑤ Elute the cleaned magnetic beads to obtain the Y-shaped pre-library PCR product after fragment screening.

[0166] ⑥ Use the S3 card holder for large fragment detection (Bioptic, c105106) to perform Qsep100 quality inspection on the Y-shaped pre-library PCR product after fragment screening. The proportion of fragments below 3kbp should be less than 10%, otherwise it will be regarded as an unqualified Y-shaped pre-library PCR product.

[0167] 7. Hybridization of the Y-shaped pre-library with the biotin-labeled double-stranded DNA probe

[0168] The components of the capture kit used in this example refer to patent ZL202011284834.1

[0169] (1) In this embodiment, the GRCh38 / hg38 gene sequence is used as the reference genome sequence, and the target capture region is selected as the upstream and downstream regions of the tandem repeat region of the target gene. Continuous probes are designed in this region, and the coding region and non-coding region of the target gene are required to be fully covered. The capture region of each gene is shown below. The capture probe used to enrich the target gene and the flanking region is a biotin-labeled double-stranded DNA probe. The probe sequence is shown in Table 6.

[0170] ATXN1: GRCh38 / hg38, chr6: 16327535-16327822;

[0171] ATXN3: GRCh38 / hg38, chr14: 92070910-92071140;

[0172] ZFHX3: GRCh38 / hg38, chr16: 72787594-72787857;

[0173] CACNA1A: GRCh38 / hg38, chr19: 13207758-13207997;

[0174] ATXN7: GRCh38 / hg38, chr3: 63912585-63912815;

[0175] ATXN8OS: GRCh38 / hg38, chr13: 70139283-70139528;

[0176] ATXN10: GRCh38 / hg38, chr22: 45795254-45795524;

[0177] PPP2R2B: GRCh38 / hg38, chr5: 146878628-146878858;

[0178] TBP: GRCh38 / hg38, chr6: 170561807-170562115;

[0179] FGF14: GRCh38 / hg38, chr13: 102161476-102161826;

[0180] BEAN1-TK2: GRCh38 / hg38, chr16: 66490298-66490566;

[0181] NOP56:GRCh38 / hg38,chr20:2652633-2652857;

[0182] DAB1:GRCh38 / hg38,chr1:57366943-57367218;

[0183] THAP11:GRCh38 / hg38,chr16:67842763-67843050;

[0184] FXN:GRCh38 / hg38,chr9:69037186-69037404;

[0185] GLS:GRCh38 / hg38,chr2:190880772-190881020;

[0186] RFC1:GRCh38 / hg38,chr4:39348324-39348585;

[0187] LRP12:GRCh38 / hg38,chr8:104588872-104589099;

[0188] GIPC1:GRCh38 / hg38,chr19:14495941-14496174;

[0189] RILPL1:GRCh38 / hg38,chr12:123533620-123533851;

[0190] VWA1:GRCh38 / hg38,chr1:1435698-1435918;

[0191] AR:GRCh38 / hg38,chrX:67545216-67545485;

[0192] DMPK:GRCh38 / hg38,chr19:45770104-45770364;

[0193] C9orf72:GRCh38 / hg38,chr9:27573428-27573646;

[0194] PABPN1:GRCh38 / hg38,chr14:23321372-23321590;

[0195] CNBP:GRCh38 / hg38,chr3:129172476-129172756;

[0196] NUTM2B-AS1:GRCh38 / hg38,chr10:79826277-79826503;

[0197] SAMD12:GRCh38 / hg38,chr8:118366715-118367019;

[0198] PLIN4:GRCh38 / hg38,chr19:4512708-4513408;

[0199] CSTB:GRCh38 / hg38,chr21:43776343-43776579;

[0200] HTT:GRCh38 / hg38,chr4:3074776-3075033;

[0201] ATN1:GRCh38 / hg38,chr12:6936628-6936873;

[0202] TNRC6A:GRCh38 / hg38,chr16:24613339-24613629;

[0203] YEATS2:GRCh38 / hg38,chr3:183712087-183712322;

[0204] PRNP:GRCh38 / hg38,chr20:4699270-4699545;

[0205] STARD7:GRCh38 / hg38,chr2:96196966-96197221;

[0206] DIP2B:GRCh38 / hg38,chr12:50504903-50505124;

[0207] MARCHF6:GRCh38 / hg38,chr5:10356247-10356507;

[0208] NOTCH2NLC:GRCh38 / hg38,chr1:149390702-149390929;

[0209] JPH3:GRCh38 / hg38,chr16:87604187-87604429;

[0210] ARX:GRCh38 / hg38,chrX:25013549-25013797;

[0211] SOX3:GRCh38 / hg38,chrX:140504216-140504461;

[0212] HOXA13:GRCh38 / hg38,chr7:27199824-27200066;

[0213] RUNX2:GRCh38 / hg38,chr6:45422650-45422901;

[0214] ZIC2:GRCh38 / hg38,chr13:99985348-99985593;

[0215] EIF4A3:GRCh38 / hg38,chr17:80146892-80147239;

[0216] FOXL2:GRCh38 / hg38,chr3:138945920-138946162;

[0217] AFF3:GRCh38 / hg38,chr2:100104698-100104922;

[0218] HOXD13:GRCh38 / hg38,chr2:176092958-176093203;

[0219] CBL:GRCh38 / hg38,chr11:119206189-119206422;

[0220] XYLT1:GRCh38 / hg38,chr16:17470807-17471022;

[0221] TCF4:GRCh38 / hg38,chr18:55586055-55586327;

[0222] DMD:GRCh38 / hg38,chrX:31284457-31284705;

[0223] PHOX2B:GRCh38 / hg38,chr4:41745871-41746131;

[0224] ATXN2:GRCh38 / hg38,chr12:111598850-111599119;

[0225] FMR1: GRCh38 / hg38, chrX: 147911950-147912210; AFF2: GRCh38 / hg38, chrX: 148500538: 148500783.

[0226] Table 6 Probe sequence list

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235] (2) The hybridization reaction can be performed as a single hybrid or a multi-hybrid. For a multi-hybrid, multiple Y-shaped pre-libraries need to be mixed at equal molecular weights according to the following formula: fmol = (concentration * 10 6 ) / [650*length(bp)].

[0236] (3) Vacuum concentrate a single library or a mixed library of equal molecular weight to a dry powder state, and resuspend the library according to the components in Table 7.

[0237] Table 7 Library resuspension reagents

[0238]

[0239] (4) Denaturation of the resuspended library and the probe: the denaturation time was set to three different time gradients, namely 95°C, 5 min, 95°C, 10 min, and 95°C, 15 min.

[0240] (5) Add 20 μl of hybridization buffer preheated at 65°C for at least 5 min to the denatured prelibrary and probe mixture, with the hot cover at 85°C, and test different hybridization temperatures and times: 60°C, 16 h, 60°C, 20 h; 65°C, 16 h, 65°C, 20 h; 68°C, 16 h, 68°C, 20 h; 70°C, 16 h, 70°C, 20 h; 72°C, 16 h, 72°C, 20 h.

[0241] 8. Targeted Enrichment

[0242] (1) Preheat the streptavidin magnetic beads at 65°C for at least 10 min, and then transfer the hybridization products directly from the 65°C condition to the 65°C streptavidin magnetic beads.

[0243] (2) After the hybridization product is bound to the streptavidin magnetic beads, the hybridization product and the streptavidin magnetic beads are rinsed and eluted.

[0244] (3) The eluted product was captured by a long-fragment high GC-specific amplification enzyme for long-fragment PCR, and the different amplification systems shown in Tables 8 to 11 were tested.

[0245] Table 8 Amplification conditions 1 System configuration

[0246]

[0247] Table 9 Amplification Condition 2 System Configuration

[0248]

[0249] Table 10 Amplification Condition 3 System Configuration

[0250]

[0251] Table 11 Amplification Condition 4 System Configuration

[0252]

[0253] Universal primer sequences:

[0254] F: AATGATACGGCGACCACCGAGATCTACAC; R: ATCTCGTATGCCGTCTTCTGCTTG.

[0255] Amplify according to the amplification program in Table 12.

[0256] Table 12 Capture library amplification program

[0257]

[0258]

[0259] (4) Purify the PCR product using 0.8* purification magnetic beads to obtain a capture library.

[0260] (5) The captured library is tested for concentration and fragment length distribution by Qubit and Qsep100. The length of the captured library should be 3k-10k. Figure 1 .

[0261] 9. PacBio third-generation library construction (kit from PacBio, PN: 103-381-200)

[0262] (1) DNA damage repair

[0263] Configure the DNA damage repair system according to Table 13.

[0264] Table 13 Damage repair system

[0265]

[0266] The prepared reaction solution was shaken and mixed. The reaction conditions were: 37°C, 20 min; maintained at 4°C.

[0267] (2) End repair and purification

[0268] Configure the end repair and purification reaction system according to Table 14.

[0269] Table 14 End repair and purification reaction system

[0270]

[0271]

[0272] The prepared reaction solution was shaken and mixed. The reaction conditions were: 25°C, 5 min; maintained at 4°C.

[0273] (3) Connector connection

[0274] Configure the adapter ligation reaction system according to Table 15.

[0275] Table 15 Linker connection reaction system

[0276]

[0277] The PacBio platform sequencing adapters are provided by the official website of PacBio, and technicians in this field can synthesize them themselves or purchase them directly as needed.

[0278] The prepared reaction solution was shaken and mixed. The reaction conditions were: 25°C, 24h; 65°C, 10min; maintained at 4°C.

[0279] (4) Digestion of failed ligation DNA and adapter sequences.

[0280] Configure the reaction system according to Table 16:

[0281] Table 16 Digestion reaction system

[0282]

[0283] The prepared reaction solution was shaken and mixed. The reaction conditions were: 37°C, 1h; maintained at 4°C.

[0284] 10. Sequencing and result analysis

[0285] The prepared library was sequenced using a third-generation single-molecule sequencer (PacBio Revio), so that the average sequencing depth of the target region reached more than 50×.

[0286] The obtained data is split and analyzed. The specific analysis method is as follows:

[0287] 1) Use Lima software to split PacBio sequencing data: divide the original sequencing data into different samples according to different index sequences.

[0288] 2) Use Minimap2 for comparison: compare the cleaned sample data (cleandata) with the reference genome (such as hg38) to ensure the accuracy of the data.

[0289] 3) Perform quality control statistical analysis: Perform quality control on the sequencing data of the target region to evaluate the quality and reliability of the data. The analysis includes indicators such as data volume, alignment rate, and fragment length.

[0290] 4) Use Trgt software to process BAM files: Further analysis is performed on the BAM files, including genotyping of tandem repeat sequences, composition analysis of repeat sequences, and statistics of repeat times.

[0291] 5) Compare the number of repeats with the number of clinical pathogenic repeats: Compare the number of repeat sequences in the analysis results with the number of repeat sequences related to clinical pathogenicity to determine the positive or negative nature of the sample.

[0292] According to the above construction process, a tandem repeat-related gene mutation detection system was constructed, including an acquisition module, a Y-shaped pre-library preparation module, a targeted enrichment module, a single-molecule real-time sequencing library construction module, and a single-molecule real-time sequencing analysis module;

[0293] The collection module is used to collect peripheral blood from the subject and perform high molecular weight DNA extraction, shearing and fragment screening;

[0294] The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the extracted and sheared high molecular weight DNA, and perform Y-shaped adapter ligation and fragment screening, and then use long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library;

[0295] The targeted enrichment module is used to denature the Y-shaped pre-library and probes and use biotin-labeled capture probes to hybridize the target gene, perform targeted enrichment, and perform long-fragment PCR amplification after capture to obtain a capture library;

[0296] The single-molecule real-time sequencing library construction module is used to perform DNA damage repair, end repair, purification, sequencing adapter connection and digestion based on the captured library to obtain a single-molecule real-time sequencing library;

[0297] The single-molecule real-time sequencing analysis module is used to perform single-molecule real-time sequencing with a single-molecule real-time sequencing library, obtain sequencing data of the target region, decompose the sequencing data of the target region, and analyze the variation type of tandem duplication-related genes;

[0298] Target genes include ATXN1, ATXN3, ZFHX3, CACNA1A, ATXN7, ATXN8OS, ATXN10, PPP2R2B, TBP, FGF14, BEAN1-TK2, NOP56, DAB1, THAP11, FXN, GLS, RFC1, LRP12, GIPC1, RILPL1, VWA1, AR, DMPK, C9orf72, PABPN1, CNBP, NUTM2B-AS1, SAMD12, PLIN4, CSTB, HTT, ATN1, TNRC6A, YEATS2, PRNP, STARD7, DIP2B, MARCHF6, NOTCH2NLC, JPH3, ARX, SO X3, HOXA13, RUNX2, ZIC2, EIF4A3, FOXL2, AFF3, HOXD13, CBL, XYLT1, PHOX2B, TCF4, ATXN2, FMR1, AFF2 and DMD.

[0299] Example 2

[0300] The experimental operation was performed according to the tandem repeat-related gene mutation detection system in Example 1, and different experimental conditions were tested to obtain the optimal conditions, and then the optimal conditions were used to test the relevant positive samples.

[0301] The test results of the Y-type pre-library and probe denaturation time in the present invention show that the optimal denaturation time for hybridization of long fragments with high GC regions (generally GC content equal to or greater than 80%) is 95°C, 10 min. Table 17 compares the capture efficiency of different denaturation times.

[0302] Table 17 Comparison of capture efficiency at different denaturation times

[0303]

[0304] The test results of the hybridization temperature and time of the Y-shaped pre-library and the capture probe in the present invention show that the optimal hybridization temperature and time for the long fragment high GC region are 72°C and 20h. Table 18 compares the capture efficiency at different hybridization temperatures and times.

[0305] Table 18 Comparison of capture efficiency at different hybridization temperatures and times

[0306]

[0307]

[0308] The present invention tests different amplification conditions for capture library Long-PCR, and the test results show that the most efficient amplification condition for long fragments and high GC fragments is to add 5M betaine and 14M DMSO to the conventional amplification system of KOD FX Neo (Toyobo, KFX-201). Table 19 is a comparison of the detection results of 3 myotonic dystrophy (DM1) positive samples (DMPK gene CTG repeat number) under different amplification conditions: the repeat number of sample 1 CE and Sanger sequencing results is about 3 / >50, the repeat number of sample 2 CE and Sanger sequencing results is about 19 / >50, and the repeat number of sample 3 CE and Sanger sequencing results is about 19 / 5.

[0309] Table 19 Comparison of detection results under different amplification conditions

[0310]

[0311] The optimal hybridization capture and amplification conditions screened by the present invention were used to detect 26 positive samples of tandem repeat-related genes. The test results are shown in Table 20.

[0312] Table 20 Test sample test results

[0313]

[0314]

[0315] In summary, the present invention can detect mutations in positive samples of tandem duplication-related genes. Compared with conventional CE and Sanger detection methods, the present invention can accurately detect the number of copies of samples with multiple copies, without the need for family verification and negative sample control, and has certain guiding significance for clinical medication according to the severity of the disease.

[0316] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes may be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A tandem duplication-related gene mutation detection system, characterized in that: It includes acquisition module, Y-shaped pre-library preparation module, targeted enrichment module, single-molecule real-time sequencing library construction module and single-molecule real-time sequencing analysis module; The collection module is used to collect peripheral blood of the subject to be tested and to extract, shear and screen high molecular weight DNA; The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the extracted and sheared high molecular weight DNA, perform Y-shaped adapter connection and fragment screening, and then use a long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library; The targeted enrichment module is used to denature the Y-shaped pre-library and the probe and use a biotin-labeled capture probe to hybridize the target gene, perform targeted enrichment, and perform long-fragment PCR amplification after capture to obtain a capture library; The single-molecule real-time sequencing library construction module is used to perform DNA damage repair, end repair, purification, sequencing adapter connection and digestion according to the captured library to obtain a single-molecule real-time sequencing library; The single-molecule real-time sequencing analysis module is used to perform single-molecule real-time sequencing with a single-molecule real-time sequencing library to obtain sequencing data of a target region, decompose the sequencing data of the target region, and analyze and obtain the variation type of tandem duplication-related genes; The target genes include ATXN1, ATXN3, ZFHX3, CACNA1A, ATXN7, ATXN8OS, ATXN10, PPP2R2B, TBP, FGF14, BEAN1-TK2, NOP56, DAB1, THAP11, FXN, GLS, RFC1, LRP12, GIPC1, RILPL1, VWA1, AR, DMPK, C9orf72, PABPN1, CNBP, NUTM2B-AS1 , SAMD12, PLIN4, CSTB, HTT, ATN1, TNRC6A, YEATS2, PRNP, STARD7, DIP2B, MARCHF6, NOTCH2NLC, JPH3, ARX, S OX3, HOXA13, RUNX2, ZIC2, EIF4A3, FOXL2, AFF3, HOXD13, CBL, XYLT1, PHOX2B, TCF4, ATXN2, FMR1, AFF2 and DMD.

2. The tandem duplication-related gene mutation detection system according to claim 1, characterized in that: The target region capture range of the target region capture probe labeled with biotin is: ATXN1: GRCh38 / hg38, chr6: 16327535-16327822; ATXN3: GRCh38 / hg38, chr14: 92070910-92071140; ZFHX3: GRCh38 / hg38, chr16: 72787594-72787857; CACNA1A: GRCh38 / hg38, chr19: 13207758-13207997; ATXN7: GRCh38 / hg38, chr3: 63912585-63912815; ATXN8OS:GRCh38 / hg38,chr13:70139283-70139528; ATXN10:GRCh38 / hg38,chr22:45795254-45795524; PPP2R2B:GRCh38 / hg38,chr5:146878628-146878858; TBP:GRCh38 / hg38,chr6:170561807-170562115; FGF14:GRCh38 / hg38,chr13:102161476-102161826; BEAN1-TK2:GRCh38 / hg38,chr16:66490298-66490566; NOP56:GRCh38 / hg38,chr20:2652633-2652857; DAB1:GRCh38 / hg38,chr1:57366943-57367218; THAP11:GRCh38 / hg38,chr16:67842763-67843050; FXN:GRCh38 / hg38,chr9:69037186-69037404; GLS:GRCh38 / hg38,chr2:190880772-190881020; RFC1:GRCh38 / hg38,chr4:39348324-39348585; LRP12:GRCh38 / hg38,chr8:104588872-104589099; GIPC1:GRCh38 / hg38,chr19:14495941-14496174; RILPL1:GRCh38 / hg38,chr12:123533620-123533851; VWA1:GRCh38 / hg38,chr1:1435698-1435918; AR:GRCh38 / hg38,chrX:67545216-67545485; DMPK:GRCh38 / hg38,chr19:45770104-45770364; C9orf72:GRCh38 / hg38,chr9:27573428-27573646; PABPN1:GRCh38 / hg38,chr14:23321372-23321590; CNBP:GRCh38 / hg38,chr3:129172476-129172756; NUTM2B-AS1:GRCh38 / hg38,chr10:79826277-79826503; SAMD12:GRCh38 / hg38,chr8:118366715-118367019; PLIN4:GRCh38 / hg38,chr19:4512708-4513408; CSTB:GRCh38 / hg38,chr21:43776343-43776579; HTT:GRCh38 / hg38,chr4:3074776-3075033; ATN1:GRCh38 / hg38,chr12:6936628-6936873; TNRC6A:GRCh38 / hg38,chr16:24613339-24613629; YEATS2:GRCh38 / hg38,chr3:183712087-183712322; PRNP:GRCh38 / hg38,chr20:4699270-4699545; STARD7:GRCh38 / hg38,chr2:96196966-96197221; DIP2B:GRCh38 / hg38,chr12:50504903-50505124; MARCHF6:GRCh38 / hg38,chr5:10356247-10356507; NOTCH2NLC:GRCh38 / hg38,chr1:149390702-149390929; JPH3:GRCh38 / hg38,chr16:87604187-87604429; ARX:GRCh38 / hg38,chrX:25013549-25013797; SOX3:GRCh38 / hg38,chrX:140504216-140504461; HOXA13:GRCh38 / hg38,chr7:27199824-27200066; RUNX2:GRCh38 / hg38,chr6:45422650-45422901; ZIC2:GRCh38 / hg38,chr13:99985348-99985593; EIF4A3:GRCh38 / hg38,chr17:80146892-80147239; FOXL2:GRCh38 / hg38,chr3:138945920-138946162; AFF3:GRCh38 / hg38,chr2:100104698-100104922; HOXD13:GRCh38 / hg38,chr2:176092958-176093203; CBL:GRCh38 / hg38,chr11:119206189-119206422; XYLT1:GRCh38 / hg38,chr16:17470807-17471022; TCF4:GRCh38 / hg38,chr18:55586055-55586327; DMD: GRCh38 / hg38, chrX: 31284457-31284705; PHOX2B: GRCh38 / hg38, chr4: 41745871-41746131; ATXN2: GRCh38 / hg38, chr12: 111598850-111599119; FMR1: GRCh38 / hg38, chrX: 147911950-147912210; AFF2: GRCh38 / hg38, chrX: 148500538: 148500783.

3. The tandem duplication-related gene mutation detection system according to claim 1, characterized in that: The Y-shaped pre-library and the probe are denatured and the target gene is hybridized, targeted enriched and captured by using a capture probe labeled with biotin, and the long fragment is amplified by PCR to obtain a capture library, including: The biotin-labeled capture probe and Y-shaped pre-library were vacuum concentrated to a dry powder state and resuspended; The resuspended product is subjected to denaturation of the Y-shaped pre-library and probe; Add 20 μl of hybridization buffer preheated at 65°C for at least 5 min to the denatured prelibrary and probe mixture to perform hybridization reaction; The hybridization product was eluted using streptavidin magnetic beads; The eluted product is subjected to long-fragment PCR amplification after capture using a long-fragment-specific amplification enzyme; The product after long-fragment PCR amplification is purified using magnetic beads to obtain a capture library.

4. The tandem duplication-related gene mutation detection system according to claim 3, characterized in that: The denaturation temperature of the Y-shaped pre-library and the probe was 95° C. and the time was 10 min.

5. The tandem duplication-related gene mutation detection system according to claim 3, characterized in that: The hybridization temperature and time for hybridizing the target gene using the biotin-labeled capture probe are 72° C. and 20 h.

6. The tandem duplication-related gene mutation detection system according to claim 3, characterized in that: The reagents for the captured long-fragment PCR amplification include 35 μL of eluted product, 100 μL of 2×PCR Buffer for KOD FX Neo, 40 μL of 2 mM dNTPs, 6 μL of universal primers, 4 μL of KOD FX Neo, 5 μL of 5 M betaine, 0.125 μL of 14.1 M DMSO, and enzyme-free water is used to make up to 200 μL; the PCR program for the long-fragment PCR amplification is 94° C., 2 min; 98° C., 10 s, 58.8° C., 30 s, 68° C., 15 min, repeated 12 times; 68° C., 10 min; and maintained at 4° C.

7. The tandem duplication-related gene mutation detection system according to claim 1, characterized in that: The DNA damage repair reagent includes 5 μl 10× DNA damage repair buffer, 0.5 μl 10× NAD + , 5 μl 10 mM ATP, 2 μl DNA damage repair enzyme mixture, 1 μg capture product DNA, and make up to 50 μl with water; The reagents for sequencing adapter ligation include 30 μl of captured product DNA after end repair purification, 1 μl of PacBio platform sequencing adapter, 4 μl of 10× ligation buffer, 2 μl of 1 mM ATP and 1 μl of DNA ligase, and the mixture is filled to 40 μl with water.

8. The tandem duplication-related gene mutation detection system according to claim 1, characterized in that: The single molecule real-time sequencing analysis module is used for: Lima software was used to split PacBio sequencing data and divide the raw sequencing data into different samples according to different index sequences; Use Minimap2 to compare the cleaned sample data with the reference genome hg38 to ensure the accuracy of the data; Perform quality control statistical analysis to control the sequencing data of the target region, including data volume, alignment rate, and fragment length; Trgt software was used to process BAM files and analyze BAM files, including genotyping of tandem repeat sequences, composition of repeat sequences, and number of repeats; The number of repetitions of the repeated sequence in the analysis results is compared with the number of repetitions of the corresponding clinical pathogenic related sequences to determine the positive or negative nature of the sample.

9. A method for detecting tandem repeat-related gene mutations for non-disease diagnosis purposes, characterized in that: include: Collect peripheral blood from the subjects and perform high molecular weight DNA extraction, shearing and fragment screening; The extracted and sheared high molecular weight DNA is subjected to end repair and 3'A-tailing reaction, and Y-shaped adapter ligation and fragment screening are performed, and then long-fragment PCR amplification is performed using a long-fragment amplification enzyme to obtain a Y-shaped pre-library; Denaturing the Y-shaped pre-library and probes and using biotin-labeled capture probes to hybridize the target gene, perform targeted enrichment, and perform long-fragment PCR amplification after capture to obtain a capture library; Based on the captured library, DNA damage repair, end repair, purification, sequencing adapter ligation and digestion are performed to obtain a single-molecule real-time sequencing library; Single-molecule real-time sequencing is performed using a single-molecule real-time sequencing library to obtain sequencing data of the target region, the sequencing data of the target region is disassembled, and the variation types of tandem duplication-related genes are analyzed; The target genes include ATXN1, ATXN3, ZFHX3, CACNA1A, ATXN7, ATXN8OS, ATXN10, PPP2R2B, TBP, FGF14, BEAN1-TK2, NOP56, DAB1, THAP11, FXN, GLS, RFC1, LRP12, GIPC1, RILPL1, VWA1, AR, DMPK, C9orf72, PABPN1, CNBP, NUTM2B-AS1 , SAMD12, PLIN4, CSTB, HTT, ATN1, TNRC6A, YEATS2, PRNP, STARD7, DIP2B, MARCHF6, NOTCH2NLC, JPH3, ARX, S OX3, HOXA13, RUNX2, ZIC2, EIF4A3, FOXL2, AFF3, HOXD13, CBL, XYLT1, PHOX2B, TCF4, ATXN2, FMR1, AFF2 and DMD.

10. The method for detecting tandem duplication-related gene mutations for non-disease diagnosis purposes according to claim 9, characterized in that: The target region capture range of the target region capture probe labeled with biotin is: ATXN1: GRCh38 / hg38, chr6: 16327535-16327822; ATXN3: GRCh38 / hg38, chr14: 92070910-92071140; ZFHX3: GRCh38 / hg38, chr16: 72787594-72787857; CACNA1A: GRCh38 / hg38, chr19: 13207758-13207997; ATXN7: GRCh38 / hg38, chr3: 63912585-63912815; ATXN8OS:GRCh38 / hg38,chr13:70139283-70139528; ATXN10:GRCh38 / hg38,chr22:45795254-45795524; PPP2R2B:GRCh38 / hg38,chr5:146878628-146878858; TBP:GRCh38 / hg38,chr6:170561807-170562115; FGF14:GRCh38 / hg38,chr13:102161476-102161826; BEAN1-TK2:GRCh38 / hg38,chr16:66490298-66490566; NOP56:GRCh38 / hg38,chr20:2652633-2652857; DAB1:GRCh38 / hg38,chr1:57366943-57367218; THAP11:GRCh38 / hg38,chr16:67842763-67843050; FXN:GRCh38 / hg38,chr9:69037186-69037404; GLS:GRCh38 / hg38,chr2:190880772-190881020; RFC1:GRCh38 / hg38,chr4:39348324-39348585; LRP12:GRCh38 / hg38,chr8:104588872-104589099; GIPC1:GRCh38 / hg38,chr19:14495941-14496174; RILPL1:GRCh38 / hg38,chr12:123533620-123533851; VWA1:GRCh38 / hg38,chr1:1435698-1435918; AR:GRCh38 / hg38,chrX:67545216-67545485; DMPK:GRCh38 / hg38,chr19:45770104-45770364; C9orf72:GRCh38 / hg38,chr9:27573428-27573646; PABPN1:GRCh38 / hg38,chr14:23321372-23321590; CNBP:GRCh38 / hg38,chr3:129172476-129172756; NUTM2B-AS1:GRCh38 / hg38,chr10:79826277-79826503; SAMD12:GRCh38 / hg38,chr8:118366715-118367019; PLIN4:GRCh38 / hg38,chr19:4512708-4513408; CSTB:GRCh38 / hg38,chr21:43776343-43776579; HTT:GRCh38 / hg38,chr4:3074776-3075033; ATN1:GRCh38 / hg38,chr12:6936628-6936873; TNRC6A:GRCh38 / hg38,chr16:24613339-24613629; YEATS2:GRCh38 / hg38,chr3:183712087-183712322; PRNP:GRCh38 / hg38,chr20:4699270-4699545; STARD7:GRCh38 / hg38,chr2:96196966-96197221; DIP2B:GRCh38 / hg38,chr12:50504903-50505124; MARCHF6:GRCh38 / hg38,chr5:10356247-10356507; NOTCH2NLC:GRCh38 / hg38,chr1:149390702-149390929; JPH3:GRCh38 / hg38,chr16:87604187-87604429; ARX:GRCh38 / hg38,chrX:25013549-25013797; SOX3:GRCh38 / hg38,chrX:140504216-140504461; HOXA13:GRCh38 / hg38,chr7:27199824-27200066; RUNX2:GRCh38 / hg38,chr6:45422650-45422901; ZIC2:GRCh38 / hg38,chr13:99985348-99985593; EIF4A3:GRCh38 / hg38,chr17:80146892-80147239; FOXL2:GRCh38 / hg38,chr3:138945920-138946162; AFF3:GRCh38 / hg38,chr2:100104698-100104922; HOXD13:GRCh38 / hg38,chr2:176092958-176093203; CBL:GRCh38 / hg38,chr11:119206189-119206422; XYLT1:GRCh38 / hg38,chr16:17470807-17471022; TCF4:GRCh38 / hg38,chr18:55586055-55586327; DMD:GRCh38 / hg38,chrX:31284457-31284705; PHOX2B:GRCh38 / hg38,chr4:41745871-41746131。 ATXN2:GRCh38 / hg38,chr12:111598850-111599119; FMR1:GRCh38 / hg38,chrX:147911950-147912210; AFF2:GRCh38 / hg38,chrX:148500538:148500783。

Images