Preparation method of ID3 mRNA lipid nanoparticles and application of ID3 mRNA lipid nanoparticles in cornea disease treatment

Abstract

The invention belongs to the field of ophthalmic biological medicine, and particularly relates to a preparation method of lipid nanoparticles highly expressing ID3mRNA and application of the lipid nanoparticles in cornea injury repair and scar treatment, the obtained lipid nanoparticles can efficiently express ID3mRNA genes in vivo and in vitro, and the lipid nanoparticles highly expressing ID3mRNA are applied to treatment of various cornea diseases. According to the technical scheme, the preparation method of the lipid nanoparticles for highly expressing ID3mRNA comprises the following steps: (1) carrying out PCR (Polymerase Chain Reaction) amplification on an mRNA carrier; 2) inserting an ORF fragment of an ID3 target gene into the mRNA vector for coding to obtain an mRNA vector plasmid containing the target gene; 3) carrying out transformation and extraction on the mRNA vector plasmid containing the target gene; (4) carrying out in-vitro transcription on the extracted mRNA vector plasmid, and synthesizing a linearized mRNA plasmid containing a target gene; and 5) preparing the mRNA lipid nanoparticles.

Description

Technical Field

[0001] The present invention belongs to the field of ophthalmic biomedicine, and in particular relates to a method for preparing lipid nanoparticles with high expression of ID3 mRNA and applications thereof in corneal injury repair and scar treatment. Background Art

[0002] The cornea is located in the outermost layer of the eyeball and is easily affected by external factors. Various pathogenic microorganisms, chemical burns, mechanical injuries, ionizing radiation, and immune diseases such as Steven-Johnsons syndrome can cause corneal damage to varying degrees. The difficulty in treating various types of corneal injuries lies in the repair of corneal structure and the corneal scars formed during the repair process. Stubborn corneal scars can permanently affect vision. At present, drug treatments that promote corneal injury repair are limited to various types of epidermal growth factor support treatments. However, various types of epidermal growth factors have poor permeability in corneal cells, and can last for a short time, and can also have non-specific effects on surrounding tissues. At present, there is a lack of drugs that can significantly promote corneal injury repair and inhibit corneal scarring to improve vision, which is a bottleneck in current clinical treatment.

[0003] In the prior art, the mRNA vector has low self-expression efficiency and low delivery efficiency in the ocular environment, making it difficult to achieve efficient and stable gene expression. Therefore, developing a system that can effectively deliver mRNA to ocular cells to achieve high mRNA expression is of great significance for improving the treatment effect of ocular diseases. Summary of the invention

[0004] An object of the present invention is to overcome the shortcomings of the above-mentioned background technology and provide a method for preparing lipid nanoparticles that highly express ID3 mRNA. The obtained lipid nanoparticles can efficiently express the ID3 mRNA gene in vivo and in vitro.

[0005] The second purpose of the present invention is to use the lipid nanoparticles that highly express ID3 mRNA for treating various corneal diseases.

[0006] The objective of the present invention is achieved through the following technical solutions:

[0007] A method for preparing lipid nanoparticles that highly express ID3 mRNA is carried out according to the following steps:

[0008] 1. PCR amplification of mRNA vector

[0009] 1) The mRNA vector comprises:

[0010] T7 promoter sequence: taatacgactcactata,

[0011] 5'UTR sequence: agactcttctggtccccacagactcagagagaacccacc,

[0012] Kozak sequence: gccacc,

[0013] 3'UTR sequence:

[0014] gctggagcctcggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttcctgcacccgtacccccg tggtctttgaataaaagtctgagtgggcggca,

[0015] The polynucleotide tail element is 120 nt of consecutive adenylate nucleotides;

[0016] aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

[0017] 2) PCR amplification conditions:

[0018] 95℃10s

[0019] 58℃5s

[0020] 72℃10s

[0021] Amplify in PCR instrument for 40 cycles.

[0022] 2. The ORF fragment of the ID3 target gene is inserted into the mRNA vector for encoding to obtain an mRNA vector plasmid containing the target gene:

[0023] The ORF fragment of the ID3 target gene is the following open reading frame sequence fragment of the human ID3 gene: atgaaggcgctgagcccggtgcgcggctgctacgaggcggtgtgctgcctgtcggaacgcagtctggccatcgcccggggccgagggaagggcccggcagctgaggagccgctgagcttgctggacgacatgaaccactgctactcccgcctgcgggaactggtacccggagtcccgagaggcactcagcttagccaggtggaaatcctacagcgcgtcatcgactacattctcgacctgcaggtagtcctggccgagccagcccctggaccccctgatggcccccaccttcccatccagacagccgagctcactccggaacttgtcatctccaacgacaaaaggagcttttgccactga

[0024] The encoding steps are:

[0025] (1) Place the centrifuge tube and reagents on ice and prepare the following coding reaction system in the PCR centrifuge tube:

[0026]

[0027] (2) Mix the above reagents thoroughly and place in a PCR machine for reaction at 37°C for 1.5 h.

[0028] 3. Transform and extract the mRNA vector plasmid containing the target gene, including the following steps:

[0029] (1) The PCR product was transferred into DH5α competent cells for transformation and placed on ice for 30 min;

[0030] (2) The competent cells were heat shocked in 42°C warm water for 90 seconds and immediately placed on ice for 10 minutes;

[0031] (3) Add 100 μl of competent cells to preheated LB medium; spread the bacterial solution on an LB plate containing the corresponding resistance of the plasmid, and invert and culture in a 37°C incubator overnight;

[0032] (4) Select the monoclonal antibody grown in the LB plate and shake it in LB medium containing resistance for 16 h;

[0033] (5) Centrifuge the bacterial solution at 3000 rpm, discard the supernatant, and use a plasmid extraction kit to extract the mRNA vector plasmid in the precipitate;

[0034] 4. Perform in vitro transcription on the extracted mRNA vector plasmid to synthesize the linearized mRNA plasmid containing the target gene;

[0035] The in vitro transcription comprises the following steps:

[0036] 1) Prepare the following transcription system in a PCR centrifuge tube:

[0037]

[0038] 2) In vitro transcription conditions include:

[0039] Connect in a 37°C PCR machine for 2 hours; then add the following reagents to the above transcription system to form a capped mRNA structure:

[0040] 2'O-methyltransferase 2 μl

[0041] GTP solution 2 μl

[0042] S-adenosylmethionine 2 μl

[0043] The reaction was continued at 37°C for 1 hour;

[0044] 3) Linearized mRNA purification:

[0045] (1) adding DNase (2 U / μl) to the linearized mRNA solution transcribed in step (2) to digest the residual DNA template plasmid;

[0046] (2) purifying the obtained linearized mRNA using an RNA purification kit;

[0047] (3) Collecting the purified linearized mRNA and dissolving it in a weakly acidic buffer, and measuring the mRNA concentration using a nanodrop instrument;

[0048] (4) The purified plasmid solution containing linearized mRNA was aliquoted and stored in a -80°C refrigerator.

[0049] 5. Prepare mRNA lipid nanoparticles for use in ophthalmic preparations; the preparation method is:

[0050] (1) preparing cationic liposome SM-102, distearoylphosphatidylcholine, cholesterol, and DMG-PEG polymer anhydrous ethanol solutions respectively, and the concentrations of the four reagents are 15 mM, 25 mM, 50 mM, and 5 mM, respectively;

[0051] (2) adding the above solutions into a centrifuge tube respectively to obtain a mixed solution in which the mass ratio of the four reagents is 50:38.5:10:1.5;

[0052] (3) using a sodium succinate citrate solution at pH 4.0 to dissolve the linearized mRNA plasmid in the linearized mRNA plasmid solution at a ratio of 6 ul sodium succinate citrate solution per 1 ug mRNA;

[0053] (4) quickly adding the mixed solution in step (2) to the dissolved solution obtained in step (3), and vortexing for 30 seconds; the mass ratio of SM-102 to mRNA plasmid is 1:4.5-5:1, preferably 1:5.827;

[0054] (5) Slowly add an appropriate amount of PBS solution to the mixed solution obtained in step (4) under vortexing, and continue vortexing for 30 seconds;

[0055] (6) diluting the solution obtained in step (5) with PBS to make the final concentration of mRNA lipid nanoparticles in the solution be 0.2 μg / μl;

[0056] (7) The synthesized mRNA lipid nanoparticle solution of the ophthalmic preparation was stored at 4°C.

[0057] The mRNA lipid nanoparticles can promote corneal damage repair and inhibit corneal scarring, and can be used as a drug for treating corneal burns, corneal epithelial damage, corneal stem cell damage, corneal scarring and limbal stem cell deficiency.

[0058] The beneficial effects of the present invention are as follows: the eye drops prepared using mRNA lipid nanoparticles can prolong the retention time of mRNA on the corneal ocular surface, promote the penetration and absorption of the entire corneal layer, and have extremely low toxicity and immunogenicity, and can significantly reduce the frequency of medication and medication compliance; thus, they are effectively used in corneal damage repair and inhibition of corneal scars, and in the treatment of corneal burns, corneal epithelial damage, corneal stem cell damage, corneal scars, and limbal stem cell deficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 Fluorescence image of green fluorescent protein EGFP-mRNA lipid nanoparticles (EGFP-mRNA@LNP) expressed in primary corneal limbal stem cells.

[0060] Figure 2 Fluorescence image of green fluorescent protein EGFP-mRNA@LNP expressed in 3T3 fibroblasts.

[0061] Figure 3 This is a comparison chart of the expression levels of ID3 gene in corneal epithelial cells and 3T3 fibroblasts detected by fluorescence quantitative PCR.

[0062] Figure 4This is a bar graph of quantitative analysis of the gene expression levels of TGFβR, TGFβ1, PDGF and α-SMA genes in 3T3 fibroblasts after treatment with TGF-β recombinant protein and ID3-mRNA lipid nanoparticles (ID3-mRNA@LNP).

[0063] Figure 5 Chemiluminescent imaging of firefly luciferase F-luciferase-mRNA lipid nanoparticles (F-luciferase-mRNA@LNP) in mouse cornea.

[0064] Figure 6 Slit lamp photos of mouse corneas treated with alkali burn and ID3-mRNA@LNP.

[0065] Figure 7 Optical coherence tomography (OCT) images of mouse corneas treated with alkali burn and ID3-mRNA@LNP, and Masson staining images of mouse corneal frozen sections. DETAILED DESCRIPTION

[0066] The following is a further description with reference to the embodiments shown in the accompanying drawings.

[0067] First, the present invention tests the expression efficiency, expression effect and related therapeutic effect of lipid nanoparticles containing mRNA; specifically, during the preparation process, the mouse ID3 gene open reading frame is used for detection and comparison, and the EGFP gene (enhanced green fluorescent protein) open reading frame and the F-luciferase (firefly luciferase) gene open reading frame are used to enhance the visual effect;

[0068] in:

[0069] The open reading frame of the mouse ID3 gene is:

[0070] atgaaggcgctgagcccggtgcgcggctgctacgaggcggtgtgctgcctgtcggaacgtagcctggccattgcgcgagg

[0071] ccgcggtaagagcccgtcgaccgaggagcctcttagcctcttggacgacatgaaccactgctactcgcgcctgcgggaac

[0072] tggtgccgggagtcccgcgaggcactcagcttagccaggtggaaatcctgcagcgtgtcatagactacatcctcgacctt

[0073] caggtggtcctggcagagccggcgcctggacccccggacggtccgcatctcccgatccagacagctgagctcactccgga

[0074] acttgtgatctccaaggacaagaggagcttttgccactga

[0075] The open reading frame of the EGFP gene is:

[0076] Atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa

[0077] The open reading frame of the firefly luciferase gene is:

[0078] atggaagacgccaaaaacataaagaaaggcccggcgccattctatccgctggaagatggaaccgctggagagcaactgca

[0079] taaggctatgaagagatacgccctggttcctggaacaattgcttttacagatgcacatatcgaggtggacatcacttacg

[0080] ctgagtacttcgaaatgtccgttcggttggcagaagctatgaaacgatatgggctgaatacaaatcacagaatcgtcgta

[0081] tgcagtgaaaactctcttcaattctttatgccggtgttgggcgcgttatttatcggagttgcagttgcgcccgcgaacga

[0082] catttataatgaacgtgaattgctcaacagtatgggcatttcgcagcctaccgtggtgttcgtttccaaaaaggggttgc

[0083] aaaaaattttgaacgtgcaaaaaaagctcccaatcatccaaaaaattattatcatggattctaaaacggattaccaggga

[0084] tttcagtcgatgtacacgttcgtcacatctcatctacctcccggttttaatgaatacgattttgtgccagagtccttcga

[0085] tagggacaagacaattgcactgatcatgaactcctctggatctactggtctgcctaaaggtgtcgctctgcctcatagaa

[0086] ctgcctgcgtgagattctcgcatgccagagatcctatttttggcaatcaaatcattccggatactgcgattttaagtgtt

[0087] gttccattccatcacggttttggaatgtttactacactcggatatttgatatgtggatttcgagtcgtcttaatgtatag

[0088] atttgaagaagagctgttctgaggagccttcaggattacaagattcaaagtgcgctgctggtgccaaccctattctcct

[0089] tcttcgccaaaagcactctgattgacaaatacgatttatctaatttacacgaaattgcttctggtggcgctcccctctct

[0090] aaagtcggggaaagcggttgccaagaggttccatctgccaggtatcaggcaaggatatgggctcactgagactacatc

[0091] agctattctgattacgcccgaggggatgataaaccgggcgcggtcggtaaagttgttccattttttgaagcgaaggttg

[0092] tggatctggataccgggaaaacgctgggcgttaatcaaagaggcgaactgtgtgtgagaggtcctatgattatgtccggt

[0093] tatgtaaacaatccggaagcgaccaacgccttgattgacaaggatggatggctacattctggagacatagcttactggga

[0094] cgaagacgaacacttcttcatcgttgaccgcctgaagtctctgattaagtacaaaggctatcaggtggctcccgctgaat

[0095] tggaatccatcttgctccaacaccccaaacatcttcgacgcaggtgtcgcaggtcttcccgacgatgacgccggtgaactt

[0096] cccgccgccgttgttgttttggagcacggaaagacgatgacggaaaaagagatcgtggattacgtcgccagtcaagtaac

[0097] aaccgcgaaaaagttgcgcggaggagttgtgtttgtggacgaagtaccgaaaggtcttaccggaaaactcgacgcaagaa

[0098] aaatcagagagatcctcataaaggccaagaagggcggaaagatcgccgtgtaa

[0099] 2. Test instructions

[0100] 1. The present invention detects the expression efficiency of lipid nanoparticles containing mRNA in limbal stem cells; Figure 1 The figure shows the expression efficiency test results of mRNA@LNP of the common green fluorescent protein EGFP gene on cells. The left side is the control group (without EGFP), the middle is the single EGFP-mRNA (enhanced green fluorescent protein + mRNA), and the right side is EGFP-mRNA@LNP (enhanced green fluorescent protein + lipid nanoparticles containing mRNA); the figure shows that after 24 hours of treatment and culture, the three groups of cells have no green fluorescence expression in the control group and the EGFP-mRNA group, while the green fluorescence expression rate of cells in the EGFP-mRNA@LNP group exceeds 70%. This suggests that the mRNA@LNP system described in the present invention can efficiently express the target protein in limbal stem cells.

[0101] 2. The present invention tests the expression efficiency of lipid nanoparticles containing mRNA in 3T3 fibroblasts; Figure 2 The figure shows the expression efficiency test results of mRNA@LNP of the common green fluorescent protein EGFP gene on cells. The left side is the control group (without EGFP), the middle is the single EGFP-mRNA, and the right side is EGFP-mRNA@LNP; the figure shows that after 24 hours of treatment and culture, the three groups of cells have no green fluorescence expression in the control group and the EGFP-mRNA group, while the green fluorescence expression rate of cells in the EGFP-mRNA@LNP group exceeds 90%. This suggests that the mRNA@LNP system described in the present invention can efficiently express the target protein in 3T3 fibroblasts.

[0102] 3. The present invention compares the expression levels of lipid nanoparticles containing mRNA and simple linearized ID3 mRNA in corneal epithelial cells and 3T3 fibroblasts; wherein:

[0103] Figure 3 Figure A is a bar chart of quantitative analysis of ID3 gene expression in corneal epithelial cells; the results show that simply adding linearized ID3 mRNA cannot significantly increase the expression of ID3 gene in corneal epithelial cells, and mRNA lipid nanoparticles packaged with ID3 can significantly increase the expression of ID3 gene in corneal epithelial cells by about 300 times (Control vs ID3-mRNA vs ID3-mRNA@LNP is 1.00±0.07vs 1.72±0.04vs 345.69±51.03);

[0104] Figure 3 Figure B is a bar chart of quantitative analysis of ID3 gene expression in 3T3 fibroblasts; the results show that simply adding linearized ID3 mRNA cannot significantly increase the expression of ID3 gene in 3T3 fibroblasts, and mRNA lipid nanoparticles packaged with ID3 can significantly increase the expression of ID3 gene in 3T3 fibroblasts by about 4000 times (Control vs ID3-mRNA vs ID3-mRNA@LNP is 1.00±0.06vs 2.20±0.07vs 4720.25±111.94);

[0105] Among them, **** means p<0.001, and the statistical method is ANOVA analysis of variance.

[0106] 4. The present invention quantitatively analyzed the gene expression levels of TGFβR, TGFβ1, PDGF and α-SMA genes in 3T3 fibroblasts after treatment with TGF-β recombinant protein and ID3-mRNA@LNP. Figure 4 As shown in the figure, after treating 3T3 fibroblasts with 5ng / mL of TGF-β recombinant protein, TGF-β protein can promote the transformation of fibroblasts into myofibroblasts, thereby forming corneal scars. As shown in the figure, TGFβR, TGFβ1, PDGF and α-SMA are specific markers of scar formation; and the addition of ID3-mRNA@LNP can reverse the transformation process of fibroblasts into myofibroblasts. Among them:

[0107] Figure 4Figure A is a quantitative analysis bar graph of the gene expression level of TGF-β1; it can be seen that: when the concentration of TGF-β recombinant protein is 5 ng / mL, ID3-mRNA@LNP can significantly inhibit the gene expression of TGF-β1 in 3T3 fibroblasts (TGF-β vs TGF-β + ID3-mRNA@LNP is 1.52±0.03 vs 0.99±0.01);

[0108] Figure 4 Figure B is a quantitative analysis bar graph of the gene expression level of TGF-βR; it can be seen that: when the concentration of TGF-β recombinant protein is 5 ng / mL, ID3-mRNA@LNP can significantly inhibit the gene expression of TGF-βR in 3T3 fibroblasts (TGF-β vs TGF-β + ID3-mRNA@LNP is 3.55±0.15 vs 0.74±0.04);

[0109] Figure 4 Figure C is a quantitative analysis bar graph of the gene expression level of α-SMA; it can be seen that: at a TGF-β recombinant protein concentration of 5 ng / mL, ID3-mRNA@LNP can significantly inhibit the gene expression of α-SMA in 3T3 fibroblasts (TGF-β vs TGF-β + ID3@LNP is 7.61±0.40 vs 3.85±0.11);

[0110] Figure 4 Figure D is a quantitative analysis bar graph of the gene expression level of PDGF; it can be seen that: when the concentration of TGF-β recombinant protein is 5 ng / mL, ID3-mRNA@LNP can significantly inhibit the gene expression of PDGF in 3T3 fibroblasts (TGF-β vs TGF-β+ID3@LNP is 2.42±0.12 vs 1.26±0.11);

[0111] This suggests that ID3-mRNA@LNP can significantly inhibit the conversion of fibroblasts to myofibroblasts induced by TGF-β protein, thereby inhibiting scar formation.

[0112] 5. The present invention tested the expression effect of F-luciferase-mRNA@LNP in mouse cornea; Figure 5 In the figure, the left side shows the luminescence image of both eyes of mice in the control group, and the right side shows the luminescence image of both eyes of mice 6 hours after F-luciferase-mRNA@LNP eye drops. Both eyes of mice in the control group showed negative chemiluminescence, while both eyes of mice in the F-luciferase-mRNA@LNP group showed uniform luminescence imaging 6 hours after eye drops, indicating that the F-luciferase-mRNA@LNP preparation can successfully transfect the mouse cornea and express the target protein.

[0113] 6. The present invention tested the therapeutic effect of ID3-mRNA@LNP on mouse corneal damage; Figure 6 middle:

[0114] Figure 6 Figure A shows the front diffuse light slit lamp photos of the cornea of ​​mice in the alkali burn group and the alkali burn + ID3-mRNA@LNP treatment group. The left picture shows that the mouse cornea after alkali burn showed obvious opacity, corneal epithelial damage, corneal stromal scarring and neovascularization; while in the left picture, the cornea of ​​the mouse in the alkali burn + ID3-mRNA@LNP treatment group was basically transparent, with no obvious corneal epithelial damage, only slight corneal clouding, and no neovascularization.

[0115] Figure 6 Figure B shows the side diffuse light slit lamp photos of the cornea of ​​mice in the alkali burn group and the alkali burn + ID3-mRNA@LNP treatment group. The left picture shows that the corneal stem cells of the mice were severely damaged after alkali burn, new blood vessels grew from the corneal limbus into the central cornea, and the cornea was turbid; while in the left picture, the corneal limbus of the mice in the alkali burn + ID3-mRNA@LNP treatment group was clearly visible, with fewer abnormal blood vessels and a transparent cornea.

[0116] Figure 6 Figure C shows the sodium fluorescein staining + cobalt blue light slit lamp photos of the cornea of ​​mice in the alkali burn group and the alkali burn + ID3-mRNA@LNP treatment group. The left picture shows that after alkali burn, the cornea of ​​the mouse has obvious fluorescent aggregation area, that is, corneal epithelial damage; while in the left picture, the mice in the alkali burn + ID3-mRNA@LNP treatment group have no obvious fluorescent staining, and the corneal epithelial damage is repaired.

[0117] Apparently: Figure 6 These results suggest that ID3-mRNA@LNP can treat corneal epithelial damage, corneal stem cell damage and corneal scarring after corneal burns in mice, and has a good repairing effect on corneal damage.

[0118] 7. The present invention tested the therapeutic effect of ID3-mRNA@LNP on corneal alkali burns in mice (see Figure 7 ); The left picture of Figure A is an OCT photo of the cornea of ​​mice in the alkali burn group, and the right picture of Figure A is an OCT photo of the cornea of ​​mice in the alkali burn + ID3-mRNA@LNP treatment group. The left picture of Figure B is a Masson staining photo of the frozen section of the cornea of ​​mice in the alkali burn group, and the right picture of Figure B is a Masson staining photo of the frozen section of the cornea of ​​mice in the alkali burn + ID3-mRNA@LNP treatment group. The picture shows that alkali burns can thicken the cornea of ​​mice and form corneal stromal scars, while ID3-mRNA@LNP can reduce corneal edema and thickness and inhibit the formation of corneal scars.

[0119] The collection of limbal stem cells described in the present invention has been approved by the ethics committee.

[0120] The above test results indicate that mRNA lipid nanoparticles combine the specific therapeutic potential of mRNA and the efficient delivery ability of lipid nanoparticle delivery systems, allowing drugs to act directly, stably and effectively on corneal tissue. mRNA lipid nanoparticles can overcome the limitations of protein drugs and traditional drugs, and achieve specific gene regulation of corneal damage repair and scars by precisely regulating the sequence of mRNA expressed for corneal repair. Lipid nanoparticles not only protect mRNA molecules from degradation in the ocular environment, but also significantly improve their uptake and expression efficiency in corneal cells. In addition, lipid nanoparticles, as a delivery platform, also have good biocompatibility and safety, reducing the irritation and discomfort that may be caused by traditional ophthalmic preparations. This makes mRNA lipid nanoparticles a more comfortable and convenient way of administration suitable for ocular surface delivery, improving patients' treatment compliance and satisfaction; it has brought a revolutionary breakthrough in the treatment of corneal damage repair and anti-scarring.

[0121]

[0122]

[0123]

Claims

1. A method for preparing lipid nanoparticles that highly express ID3 mRNA, according to the following steps: 1) PCR amplification of mRNA vector The mRNA vector comprises: T7 promoter sequence: taatacgactcactata, 5'UTR sequence: agactcttctggtccccacagactcagagagaacccacc, Kozak sequence: gccacc, 3'UTR sequence: gctggagcctcggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttcctgcacccgtacccccg tggtctttgaataaaagtctgagtgggcggca, Polynucleotide tail element: aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa; 2) The ORF fragment of the ID3 target gene is inserted into the mRNA vector for encoding to obtain an mRNA vector plasmid containing the target gene The ORF fragment of the ID3 target gene is the following open reading frame sequence fragment of the human ID3 gene: atgaaggcgctgagcccggtgcgcggctgctacgaggcggtgtgctgcctgtcggaacgcagtctggccatcgcccggggccgagggaagggcccggcagctgaggagccgctgagcttgctggacgacatgaaccactgctactcccgcctgcgggaactggtacccggagtcccgaga ggcactcagcttagccaggtggaaatcctacagcgcgtcatcgactacattctcgacctgcaggtagtcctggccgagccagcccctggaccccctgatggcccccaccttcccatccagacagccgagctcactccggaacttgtcatctccaacgacaaaaggagcttttgccactga 3) Transform and extract the mRNA vector plasmid containing the target gene; 4) The extracted mRNA vector plasmid is transcribed in vitro to synthesize a linearized mRNA plasmid containing the target gene; 5) Preparation of mRNA lipid nanoparticles.

2. The method for preparing lipid nanoparticles that highly express ID3 mRNA according to claim 1, characterized in that: The PCR amplification conditions in step 1) are: 95℃10s 58℃5s 72℃10s Amplify in PCR instrument for 40 cycles.

3. The method for preparing lipid nanoparticles that highly express ID3 mRNA according to claim 2, characterized in that: The encoding step in step 2) includes: (1) Place the centrifuge tube and reagents on ice and prepare the following coding reaction system in the PCR centrifuge tube: (2) Mix the above reagents thoroughly and place in a PCR machine for reaction at 37°C for 1.5 h.

4. The method for preparing lipid nanoparticles that highly express ID3 mRNA according to claim 3, characterized in that: The step 3) transforms and extracts the mRNA vector plasmid containing the target gene, comprising the following steps: (1) The PCR product was transferred into DH5α competent cells for transformation and placed on ice for 30 min; (2) The competent cells were heat shocked in 42°C warm water for 90 seconds and immediately placed on ice for 10 minutes; (3) Add 100 μl of competent cells to preheated LB medium; spread the bacterial solution on an LB plate containing the corresponding resistance of the plasmid, and invert and culture in a 37°C incubator overnight; (4) Select the monoclonal antibody grown in the LB plate and shake it in LB medium containing resistance for 16 h; (5) Centrifuge the bacterial solution at 3000 rpm, discard the supernatant, and extract the mRNA vector plasmid in the precipitate.

5. The method for preparing lipid nanoparticles that highly express ID3 mRNA according to claim 4, characterized in that: The in vitro transcription in step 4) comprises the following steps: 1) Prepare the following transcription system in a PCR centrifuge tube: 2) In vitro transcription conditions include: First, connect in a 37℃ PCR machine for 2 hours; then add the following reagents to the above transcription system to form a capped mRNA structure: 2'O-methyltransferase 2 μl GTP solution 2 μl S-adenosylmethionine 2 μl The reaction was continued at 37°C for 1 hour; 3) Linearized mRNA purification: (1) adding DNase to the linearized mRNA solution generated by transcription in step 2) to digest the residual DNA template plasmid; (2) purifying the obtained linearized mRNA using an RNA purification kit; (3) collecting the purified linearized mRNA and dissolving it in a weakly acidic buffer, and measuring the mRNA concentration; (4) The purified plasmid solution containing linearized mRNA was aliquoted and stored in a -80°C refrigerator.

6. The method for preparing lipid nanoparticles that highly express ID3 mRNA according to claim 5, characterized in that: The preparation method of mRNA lipid nanoparticles in step 5) is: (1) preparing anhydrous ethanol solutions of cationic liposome SM-102, distearoylphosphatidylcholine, cholesterol, and DMG-PEG polymer, the concentrations of the four reagents being 15 mM, 25 mM, 50 mM, and 5 mM, respectively; (2) adding the above solutions into a centrifuge tube respectively to obtain a mixed solution in which the mass ratio of the four reagents is 50:38.5:10:1.5; (3) using a sodium succinate citrate solution at pH 4.0 to dissolve the linearized mRNA plasmid in the linearized mRNA plasmid solution; (4) The mixed solution in step (2) was quickly added to the dissolved solution obtained in step (3), and vortexed for 30 seconds; the mass ratio of SM-102 to mRNA plasmid was 1:4.5-5:1; (5) Slowly add the PBS solution to the mixed solution obtained in step (4) under vortexing, and continue vortexing for 30 seconds; (6) diluting the solution obtained in step (5) with PBS to make the final concentration of mRNA lipid nanoparticles in the solution be 0.2 μg / μl; (7) The synthesized mRNA lipid nanoparticle solution was stored at 4°C.

7. The method for preparing lipid nanoparticles that highly express ID3 mRNA according to claim 6, characterized in that: In the transformation and extraction of step 3), a plasmid extraction kit is used to extract the mRNA vector plasmid in the precipitate.

8. The lipid nanoparticles highly expressing ID3 mRNA according to claim 1 can be used for repairing corneal damage and inhibiting corneal scarring, and can be used as a drug for treating corneal burns, corneal epithelial damage, corneal stem cell damage, corneal scarring, and limbal stem cell deficiency.

Images