A mutant strain of Thiobacillus denitrificans and a construction method thereof, a bacterial agent and its application

Abstract

The present invention discloses a denitrifying Thiobacillus mutant strain and a construction method thereof, a bacterial agent and an application thereof, and belongs to the field of microbial technology. The present invention constructs a conjugation transfer system of denitrifying Thiobacillus for the first time, and provides a convenient, rapid and efficient genetic operating system for the creation of engineered denitrifying Thiobacillus based on synthetic biology and its molecular biology research. The strain can be used as a biological denitrifier in the treatment of aquatic animal breeding wastewater, domestic sewage, industrial wastewater and black and odorous water bodies in rivers, and can achieve carbon fixation and emission reduction while removing sulfur and nitrogen from sewage, and green production.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a denitrifying Thiobacillus mutant strain and a construction method thereof, a bacterial agent and an application thereof. Background Art

[0002] Recycled water reuse is an important way to alleviate the water resource crisis. However, traditional biological denitrification processes have secondary pollution problems such as high operating costs, large sludge production, and high chemical oxygen demand (COD). In view of these current situations, new biological denitrification processes are effective solutions to the above problems, such as sulfur autotrophic denitrification, anaerobic ammonia oxidation, and short-range nitrification and denitrification. The sulfur autotrophic denitrification technology based on denitrifying bacteria Thiobacillus denitrifying is a green and low-carbon sewage denitrification process. Denitrifying Thiobacillus is the main bacterial microorganism for biological treatment of various types of sulfur-containing and nitrogen-containing wastewaters. For example, patents CN104445834B, CN112661364B, CN113121013B, CN113024047B, CN113999836B, and CN115029221B respectively provide ways to purify water by combining denitrifying Thiobacillus with other microorganisms. However, denitrifying Thiobacillus has problems such as low tolerance to pH, sulfide concentration, slow growth and inhibition by organic matter. Therefore, it is necessary to use synthetic biology methods to construct engineered strains to meet the needs of actual production.

[0003] Due to the special cell characteristics and cultivation environment of Denitrifying Thiobacillus, the currently commonly used gene transfer methods are not effective. For example, the success rate of electrotransformation is low, and chemical transformation has not been successful (Development of a genetic systemfor the chemolithoautotrophic bacterium Thiobacillus denitrificans , source https: / / doi.org / 10.1128 / AEM.02928-06), in addition, no bacteriophages were found in this strain, so there is an urgent need to build a more efficient gene transfer method.

[0004] Although conjugation transfer has been successfully applied in many bacteria, yeast, and plant and animal cells, the effective removal of sulfide and nitrate in wastewater can only be achieved under anaerobic conditions by denitrifying Thiobacillus, which makes cultivation and gene editing difficult. More importantly, denitrifying Thiobacillus grows slowly and is inhibited by organic matter, and it is difficult to recover cells after conjugation transfer. In view of this, there has been no successful report on the conjugation transfer method before the application of the present invention. In addition, there are few studies on the high-density production process of strains and the performance test after genetic manipulation. Therefore, the construction of genetic manipulation methods for denitrifying Thiobacillus, the preparation of bacterial agents and their application are of great significance for the green and low-carbon deep denitrification of sewage. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present invention provides a denitrifying Thiobacillus mutant strain and a construction method thereof, a bacterial agent and an application thereof, which solve at least one technical problem in the background technology.

[0006] As one aspect of the present invention, a mutant strain of Thiobacillus denitrificans is provided, which overexpresses SoxAX gene; SoxAX The gene sequence is shown in SEQ ID NO:3.

[0007] In one embodiment of the present invention, the denitrifying Thiobacillus is denitrifying Thiobacillus DSM 12475.

[0008] As a second aspect of the present invention, a method for constructing a mutant strain of Thiobacillus denitrificans is provided: SoxAX The fragment of the coding gene of SoxAX Denitrifying Thiobacillus gene; SoxAX The gene sequence is shown in SEQ ID NO:3.

[0009] Said SoxAX The coding gene fragment is introduced through a recombinant expression vector; the construction method of the recombinant expression vector includes: selecting a restriction endonuclease XB I and Hind III. Construct the recombinant plasmid pJRD215-Ptac-TdSoxAX by restriction enzyme ligation.

[0010] In the embodiment of the present invention, in the method for constructing the mutant strain of Thiobacillus denitrificans, the method of conjugation transfer is used to transfer SoxAX The entire or partial nucleotide sequence of the gene was transferred from Escherichia coli to Thiobacillus denitrificans using IncQ plasmid pJRD215; the frequency of conjugative transfer could reach 1.76±0.02×10 -3 .

[0011] In an embodiment of the present invention, a method for constructing a mutant strain of Thiobacillus denitrificans is provided, comprising the following steps:

[0012] S1, donor bacteria preparation, grow E. coli SM10 containing plasmid pJRD215-Ptac-TdSoxAX to OD 600 =0.4~0.6;

[0013] S2, recipient bacteria preparation, grow the culture of Thiobacillus denitrificans to OD 600 =0.1~0.25;

[0014] S3, conjugation transfer, in which the cell number ratio of donor bacteria to recipient bacteria is 1:1~6, and the conjugation system is 100~500 μL. After being fully mixed, it is spotted on the filter membrane on the solid conjugation medium of Thiobacillus denitrificans, and the plate is cultured upright;

[0015] Subsequently, the bacteria on the filter membrane are washed off with a conjugation washing solution and spread on a solid culture medium containing denitrifying Thiobacillus with corresponding resistance for culture.

[0016] In an embodiment of the present invention, in step S2, the recipient bacteria are cultured in a denitrifying Thiobacillus modified liquid culture medium, and the formula of the denitrifying Thiobacillus modified liquid culture medium is: 2 g / L potassium dihydrogen phosphate, 5 g / L potassium nitrate, 1 g / L ammonium chloride, 1 g / L magnesium sulfate heptahydrate, 5 g / L sodium thiosulfate pentahydrate, 1-5 g / L sodium bicarbonate, 2 mg / L ferrous sulfate heptahydrate, 2 mL / L trace element liquid SL-4, and 0.5-2 g / L yeast powder or peptone.

[0017] In an embodiment of the present invention, in step S3, the solid conjugation medium of Thiobacillus denitrificans is a liquid medium of Thiobacillus denitrificans in which 0.5 g / L of yeast powder and 15 g / L of agar powder are added; the formula of the liquid medium of Thiobacillus denitrificans is: 2 g / L of potassium dihydrogen phosphate, 5 g / L of potassium nitrate, 1 g / L of ammonium chloride, 0.8 g / L of magnesium sulfate heptahydrate, 5 g / L of sodium thiosulfate pentahydrate, 1 g / L of sodium bicarbonate, 2 mg / L of ferrous sulfate heptahydrate, and 2 mL / L of commercially available trace element liquid SL-4.

[0018] In the embodiment of the present invention, the formula of the joint washing solution is 2 g / L of potassium dihydrogen phosphate, 2 g / L of potassium nitrate, 1 g / L of ammonium chloride, 0.8 g / L of magnesium sulfate heptahydrate, and 2 mL / L of commercially available trace element liquid SL-4.

[0019] As a third aspect of the present invention, a bacterial agent is provided, wherein the active ingredient is obtained by fermentation culture of Denitrifying Thiobacillus DSM12475 or the Denitrifying Thiobacillus mutant provided by the present invention.

[0020] As a fourth aspect of the present invention, it is to provide the application of the bacterial agent in wastewater treatment. Further, the application includes the treatment of aquatic animal breeding wastewater, domestic sewage, industrial wastewater and black and smelly water in rivers, especially the application in reducing nitrite content.

[0021] Furthermore, the application includes inoculating the bacterial agent into the wastewater to be treated at a volume ratio of not less than 1%.

[0022] Based on the above technical scheme, the technical scheme of a denitrifying Thiobacillus mutant strain and a construction method thereof, a bacterial agent and its application provided by the present invention includes at least one of the following technical effects:

[0023] (1) The genetic manipulation method of Thiobacillus denitrificans provided by the present invention is simple, has high transformation efficiency, and achieves overexpression of exogenous or native genes, such as endogenous SoxAX Overexpression of the gene increased the growth rate and denitrification rate of the strain.

[0024] (2) The conjugation transfer method provided by the present invention can make up for the shortcomings of the currently used conjugation transfer methods and provide a convenient, rapid and efficient gene introduction method for genetic engineering breeding, genetics and molecular biology research of Denitrifying Thiobacillus.

[0025] (3) Denitrifying Thiobacillus and its mutant bacterial agents can be used in the treatment of aquatic animal breeding wastewater, domestic sewage, industrial wastewater and black and smelly water in rivers. They are ideal green and low-carbon biological denitrifiers. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0027] Figure 1 This is a graph showing the PCR verification result of the conjugative transfer sub-colony of Denitrifying Thiobacillus DSM 12475 in Example 1 of the present invention; wherein, lane 1 is the negative control Denitrifying Thiobacillus genome, lane 2 is the positive control plasmid pJRD215, and lane 3 is the positive transformant.

[0028] Figure 2 This is a growth curve of Thiobacillus denitrificans DSM 12475 and its mutants in Example 2 of the present invention;

[0029] Figure 3 This is a growth curve of Denitrifying Thiobacillus DSM 12475 under different concentrations of sodium bicarbonate in Example 3 of the present invention;

[0030] Figure 4 This is a growth curve of Denitrifying Thiobacillus DSM 12475 in Example 3 of the present invention under different concentrations of sodium thiosulfate pentahydrate;

[0031] Figure 5 This is a growth curve of Denitrifying Thiobacillus DSM 12475 under different concentrations of yeast powder in Example 3 of the present invention;

[0032] Figure 6 This is a growth curve of Denitrifying Thiobacillus DSM 12475 in Example 3 of the present invention under different concentrations of peptone. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments and drawings. It should be noted that the specific embodiments below are only for illustration and are not intended to limit the present invention.

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0035] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0036] The present invention is aimed at the commercially available Thiobacillus denitrificans with the function of desulfurization and denitrification of sewage ( Thiobacillus denitrificans , T. denitrificans ) DSM 12475 was used to create a molecular genetic system and develop a culture process to achieve faster denitrification rates and higher density culture, which is beneficial to its practical application.

[0037] Thiobacillus denitrificans Thiobacillus denitrificans , T. denitrificans ) DSM 12475 was purchased from Zhili Zhongte (Wuhan) Biotechnology Co., Ltd., product number bio-82442.

[0038] The formula of liquid culture medium for Thiobacillus denitrificans: 2 g / L potassium dihydrogen phosphate, 5 g / L potassium nitrate, 1 g / L ammonium chloride, 0.8 g / L magnesium sulfate heptahydrate, 5 g / L sodium thiosulfate pentahydrate, 1 g / L sodium bicarbonate, 2 mg / L ferrous sulfate heptahydrate, 2 mL / L commercial trace element liquid SL-4, pH = 7. Add 15 g / L agar powder to obtain the solid culture medium for Thiobacillus denitrificans.

[0039] The solid conjugation culture medium of Thiobacillus denitrificans is prepared by adding 0.5 g / L yeast powder and 15 g / L agar powder to the liquid culture medium of Thiobacillus denitrificans.

[0040] The formula of the joint washing solution is 2 g / L potassium dihydrogen phosphate, 2 g / L potassium nitrate, 1 g / L ammonium chloride, 0.8 g / L magnesium sulfate heptahydrate, and 2 mL / L of commercially available trace element liquid SL-4.

[0041] The plasmid pJRD215 was constructed according to (Davison et al., 1987).

[0042] Davison, J., Heusterspreute, M., Chevalier, N., Ha-Thi, V., and Brunel, F. (1987). Vectors with restriction site banks. V. pJRD215, a wide-host-rangecosmid vector with multiple cloning sites. Gene 51, 275-280.

[0043] Example 1, Construction of Genetic Manipulation Methods of Thiobacillus denitrificans DSM 12475

[0044] (1) Preparation of donor bacteria: Plasmid pJRD215 was transformed into the host commercial Escherichia coli SM10, which was then inoculated into commercial Luria-Bertani medium (LB medium) with a final concentration of 100 μg / mL of streptomycin, at 150-200 r / min, and activated overnight at 37°C. Subsequently, the inoculum was inoculated into fresh LB medium at a 1% inoculum volume, with a final concentration of 100 μg / mL of streptomycin, at 150-200 r / min, and at 37°C until the bacterial solution OD 600 =0.4~0.6.

[0045] (2) Preparation of recipient bacteria: In the anaerobic operation station, inoculate the denitrifying Thiobacillus DSM 12475 into the deoxygenated denitrifying Thiobacillus liquid culture medium and incubate at 30°C until the bacterial liquid OD reaches 600 =0.1~0.25.

[0046] (3) Joint transfer operation process:

[0047] In the anaerobic operation table, add the deoxygenated donor bacteria and the recipient bacteria to a 1.5 mL tube at the same time and mix thoroughly. Use a pipette to evenly apply it to the 0.22 μM filter placed on the solid conjugation medium of Thiobacillus denitrificans. The plate is placed in a 30°C incubator and cultured for 3 to 5 days. The conjugation transfer parameters at this time are: the cell number ratio of the donor bacteria to the recipient bacteria is 1:2, and the conjugation system is 200 μL.

[0048] In the anaerobic operating table, gently wash the bacteria on the 0.22 μM filter membrane with 1 mL of the conjugation wash solution to obtain a bacterial suspension. -4 ~10 -7 The bacterial suspension of the concentration was spread on a solid culture medium of Thiobacillus denitrificans containing streptomycin and cultured at 30°C for 8 days.

[0049] (4) In an anaerobic operating table, use a sterile toothpick to pick up the colonies on the plate and dissolve them in 15 μL of deoxygenated sterile ultrapure water. Take 5 μL of the above sample as a template and use the PCR primer sequences of the streptomycin resistance gene (targeting the streptomycin resistance gene on plasmid pJRD215) (SF: 5'-TGGCAGGAGGAACAGGA-3', SR: 5'-GGAAAGGCACCCATAAGC-3') for single colony PCR verification. The sense strand and antisense strand of the primer sequence are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.

[0050] (5) Colony PCR reaction system and reaction procedure:

[0051] PCR reaction system: 5 μL template, 2 μL primer, 25 μL Premix Taq (TaKaRa, product number: DRR003A), 18 μL sterile ultrapure water.

[0052] PCR reaction procedure:

[0053] ① Pre-denaturation at 94℃ for 5 min

[0054] ② Denaturation at 94℃ for 30 s

[0055] ③ Annealing at 52℃ for 30 s

[0056] ④ Extension 72℃ 90 s

[0057] ⑤ Final extension at 72℃ for 10 min.

[0058] (6) Detect PCR products by agarose gel electrophoresis.

[0059] The results are as follows Figure 1 As shown, the lane where the positive control (plasmid pJRD215) is located will produce a PCR product band of 1343 bp; the negative control (Thiobacillus denitrificans genome) has no PCR product band in the corresponding region; in the selected verification samples, if a band similar to the positive control is produced in the corresponding region, it indicates a positive transformant, and if no band similar to the negative control is produced, it indicates a false positive.

[0060] (7) Optimization of the conjugation conditions between the donor bacteria and the recipient bacteria, including the centrifugal force for collecting cells, the conjugation ratio, and the conjugation system. The conjugation transfer frequency was calculated and the results are as follows:

[0061] The formula for calculating the junction transfer frequency is:

[0062] Conjugative transfer frequency = number of conjugates / number of recipient bacteria.

[0063] Table 1 Optimization of centrifugal force for collecting donor and recipient bacterial cells

[0064]

[0065] As shown in Table 1, when the centrifugal force is greater than or equal to 8000 xg When the centrifugal force was 6000 xg When the conjugation transfer frequency was 1.05±0.27×10 -6 , and when the centrifugal force is 0 xg When the culture was static for 8 days, the number of conjugates was the highest, and the frequency of conjugative transfer was 1.73±0.07×10 -5 .

[0066] Table 2 Optimization of the cell ratio of donor and recipient bacteria

[0067]

[0068] As shown in Table 2, when the cell number ratio of donor bacteria to recipient bacteria was 1:1-4, conjugants could be produced after 5-8 days of culture, the number of conjugants was 55-700, and the conjugative transfer frequency was 1.50±0.1×10 -5 ~1.90±0.3×10 -4 When the cell ratio of donor bacteria to recipient bacteria was 1:5-6, conjugants were produced on the 9th day of culture, with the number of conjugants being 42 and 28, respectively, and the conjugative transfer frequencies being 1.10±0.1×10 -5 and 7.50±1.6×10 -6 The optimal ratio of donor to recipient cells was 1:1, and the conjugation transfer frequency was 1.90±0.3×10 after 5 days of culture. -4 .

[0069] Table 3 Optimization of bonding system

[0070]

[0071] As shown in Table 3, the highest frequency of conjugation transfer was 1.84±0.25×10 -3 .

[0072] In summary, in order to achieve a higher conjugation efficiency, the centrifugal force during cell collection during the conjugation transfer operation should be less than 6000. xg The cell number ratio of donor bacteria to recipient bacteria is 1:1~4, and the conjugation system is 100~500 μL.

[0073] Embodiment 2, SoxAX Gene overexpression in Thiobacillus denitrificans DSM 12475

[0074] (1) Endogenous SoxAX

[0075] The sequence of the tac promoter is: CGACATCATAACGGTTCTGGCAAATATTCTGAAATGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAAATTC, as shown in SEQ ID NO:4.

[0076] (2) Overexpression plasmid construction process

[0077] Select restriction enzyme XB I and Hind III, using promoter Ptac primers 215-Ptac-F: 5'-TCTTAAGGCCTAGGTCTAGACGACATCATAACGGTTCTGG-3' (SEQ ID NO: 5) / Ptac-R: 5'-CCGGGCGTCGCCGTCCGGGTGAATTTGTTTCCTGTGTGAA-3' (SEQ ID NO: 6) and SoxAX Gene fragments SoxAX and Ptac were obtained by PCR amplification using gene primers Ptac-SoxAX-F: 5'-TTCACACAGGAAACAAATTCACCCGGACGGCGACGCCCGG-3' (SEQ ID NO: 7) / SoxAX-R: 5'-TAAACTACCGCATTAAAGCTTCCCTGTTCTCCTTGAATAA-3' (SEQ ID NO: 8), and then ligated to vector pJRD215 by enzyme digestion and ligation to construct the recombinant plasmid pJRD215-Ptac-TdSoxAX.

[0078] (3) Joint transfer process

[0079] The recombinant plasmid pJRD215-Ptac-TdSoxAX was transformed into the host commercially available E. coli SM10, and the conjugation transfer process was as shown in Example 1. The cells were collected at a centrifugal force of 3000 xg The cell number ratio of donor bacteria Escherichia coli SM10 (pJRD215-Ptac-TdSoxAX) and recipient bacteria Thiobacillus denitrificans DSM 12475 was 1:1, and the conjugation system was 500 μL; the conjugation transfer frequency could reach 1.76±0.02×10 -3 .

[0080] (4) Growth of overexpression strains

[0081] The strain culture process is as shown in (2) of Example 1. Figure 2 As shown, denitrifying Thiobacillus DSM 12475 (pJRD215-Ptac-TdSoxAX) has an obvious growth advantage, which is significantly higher than the control strain denitrifying Thiobacillus DSM 12475 (pJRD215), and the strain reaches the stable phase in a shorter time.

[0082] (5) Sulfate generation and nitrite degradation

[0083] Sulfate and nitrite were detected using Greencare kits (GLS-NO2 and GLS-SO4) and Greencare GL-900 spectrophotometer. The test results are as follows:

[0084] Table 4 Nitrite degradation rate of overexpression strains

[0085]

[0086] As shown in Table 4, the rate of nitrite degradation by Denitrifying Thiobacillus DSM 12475 (pJRD215-Ptac-TdSoxAX) was significantly higher than that by Denitrifying Thiobacillus DSM 12475 (pJRD215). Denitrifying Thiobacillus DSM 12475 (pJRD215-Ptac-TdSoxAX) could achieve complete degradation of nitrite within 3 days. In addition, the amount of sulfate generated on the 4th day was higher than that by Denitrifying Thiobacillus DSM 12475 (pJRD215), indicating that the overexpressed endogenous SoxAX Genes can improve the ability of strains to denitrite.

[0087] Example 3, Preparation of bacterial agents of Thiobacillus denitrificans DSM 12475 strain and its mutant strains

[0088] 1. The raw materials used in this embodiment are as follows:

[0089] The formula of liquid culture medium for Thiobacillus denitrificans: 2 g / L potassium dihydrogen phosphate, 5 g / L potassium nitrate, 1 g / L ammonium chloride, 1 g / L magnesium sulfate heptahydrate, 5 g / L sodium thiosulfate pentahydrate, 1 g / L sodium bicarbonate, 2 mg / L ferrous sulfate heptahydrate, 2 mL / L commercial trace element liquid SL-4, pH = 7. Add 15 g / L agar powder to obtain the solid culture medium for Thiobacillus denitrificans.

[0090] The formula of the modified liquid culture medium for Thiobacillus denitrificans is: 2 g / L potassium dihydrogen phosphate, 5 g / L potassium nitrate, 1 g / L ammonium chloride, 1 g / L magnesium sulfate heptahydrate, 5 g / L sodium thiosulfate pentahydrate, 1-5 g / L sodium bicarbonate, 2 mg / L ferrous sulfate heptahydrate, 2 mL / L commercially available trace element liquid SL-4, and 0.5-2 g / L yeast powder or peptone.

[0091] The concentration of streptomycin stock solution was 100 mg / mL.

[0092] During fermentation in a fermenter, streptomycin is directly added to the powdered drug.

[0093] 2. Preparation steps of bacterial agent:

[0094] (1) On a sterile anaerobic operating table, open the culture tube of Denitrifying Thiobacillus DSM 12475, inoculate it on the Denitrifying Thiobacillus solid culture medium, and incubate it at 30°C in the anaerobic operating table for 5 days.

[0095] (2) Use a sterile pipette to transfer three single colonies into the liquid culture medium of Thiobacillus denitrificans and culture at 30°C for 5 days to obtain the seed solution.

[0096] (3) The seed liquid obtained in step (2) was inoculated at 1% (volume ratio) into a 10 L fermenter filled with a modified liquid culture medium of Thiobacillus denitrificans, and fermented at 30°C for 2 to 4 days. The tank pressure was 0.06 MPa, the rotation speed was 10 rpm, the air content in the fermenter was between 0.8% and 5%, and no ventilation was performed. The exhaust port of the fermenter was sealed with water.

[0097] (4) After the fermentation is completed, the fermentation broth of Denitrifying Thiobacillus DSM 12475 is obtained, which is the bacterial agent. The number of live bacteria in the fermentation broth is determined by microscopic examination and microscopic counting method. The results show that the number of live bacteria can reach 1×10 8 Pieces / mL.

[0098] 3. Comparative experiment of culture medium effect:

[0099] In order to control costs and ensure a higher density of fermentation broth, the present invention studies the effects of the dosage of sodium thiosulfate pentahydrate, sodium bicarbonate, yeast powder and peptone on the fermentation effect. The method is as follows: Step (1) and Step (2) are the same as in "2, strain preparation step", and the seed liquid in Step (3) is inoculated into fermentation tanks containing culture media with different components. The culture media in the fermentation tanks are the following components in which different amounts of the above components are added separately: 2 g / L potassium dihydrogen phosphate, 5 g / L potassium nitrate, 1 g / L ammonium chloride, 1 g / L magnesium sulfate heptahydrate, 2 mg / L ferrous sulfate heptahydrate, and 2 mL / L of commercially available trace element liquid SL-4. Through a single factor experiment, the growth of strains in culture media with different components was compared using quadruple parallel tanks, and the results are as follows:

[0100] like Figure 3 As shown in the figure, 10 g / L sodium bicarbonate significantly inhibited the growth of Denitrifying Thiobacillus DSM 12475, while the growth was good in the range of 1-5 g / L sodium bicarbonate concentration, and there was little difference in growth, with no obvious promoting effect.

[0101] like Figure 4 As shown, the growth of Denitrifying Thiobacillus DSM 12475 was similar under the conditions of 5 g / L and 10 g / L sodium thiosulfate pentahydrate, and 10 g / L sodium thiosulfate pentahydrate had no obvious promoting effect on the strain.

[0102] like Figure 5 As shown in the figure, yeast powder can significantly promote the growth of Denitrifying Thiobacillus DSM 12475, especially at a concentration of 2 g / L, the density of the bacterial solution is about 2.5 times that of the control group. Figure 6 As shown, peptone also showed similar results.

[0103] Therefore, the optimized culture formula was determined as follows: 2 g / L potassium dihydrogen phosphate, 5 g / L potassium nitrate, 1 g / L ammonium chloride, 1 g / L magnesium sulfate heptahydrate, 5 g / L sodium thiosulfate pentahydrate, 1-5 g / L sodium bicarbonate, 2 mg / L ferrous sulfate heptahydrate, 2 mL / L commercially available trace element liquid SL-4, and 0.5-2 g / L yeast powder or peptone.

[0104] Through the above comparative experiments, it can be seen that the modified liquid culture medium formula of Thiobacillus denitrificans has a significant promoting effect on the growth of the strain.

[0105] 4. Preparation of Thiobacillus denitrificans DSM 12475 (pJRD215-Ptac-TdSoxAX)

[0106] (1) In a sterile anaerobic operating table, open the culture storage tube of Denitrifying Thiobacillus DSM 12475 (pJRD215-Ptac-TdSoxAX), inoculate it on a Denitrifying Thiobacillus solid culture medium containing streptomycin at a final concentration of 100 μg / mL, and incubate it at 30°C in an anaerobic operating table for 5 days; wherein, streptomycin mother solution was measured in advance and added to the Denitrifying Thiobacillus solid culture medium to obtain a Denitrifying Thiobacillus solid culture medium containing streptomycin at a final concentration of 100 μg / mL.

[0107] (2) Use a sterile pipette to transfer three single colonies to the liquid culture medium of Thiobacillus denitrificans. At the same time, add the streptomycin stock solution to the liquid culture medium of Thiobacillus denitrificans to make the final concentration of 100 μg / mL; incubate at 30°C for 5 days to obtain the seed solution.

[0108] (3) The seed liquid obtained in step (2) was inoculated into a 10 L fermentation tank containing a modified liquid culture medium of Thiobacillus denitrificans at 1% (volume ratio), and streptomycin powder was weighed and added to the modified liquid culture medium of Thiobacillus denitrificans to make a final concentration of 100 μg / mL; the tank pressure was 0.06 Mpa, the rotation speed was 10 rpm, the air content in the fermentation tank was between 0.8% and 5%, no ventilation was performed, and the exhaust port of the fermentation tank was sealed with water. Fermentation was carried out at 30°C for 2 to 4 days. Streptomycin was added to the modified liquid culture medium of Thiobacillus denitrificans through the inoculation port at the same time as the strain.

[0109] (4) After the fermentation is completed, the morphology of the strain is examined under a microscope to obtain a fermentation broth of Thiobacillus denitrificans DSM 12475 (pJRD215-Ptac-TdSoxAX) with an effective viable bacterial count of not less than 100 million per milliliter, which is the bacterial agent.

[0110] Example 4: Treatment of shrimp farming wastewater by Thiobacillus denitrificans DSM 12475

[0111] (1) Preparation of liquid bacterial agent of Thiobacillus denitrificans DSM 12475

[0112] The preparation of the liquid bacterial agent Thiobacillus denitrificans DSM 12475 is shown in Example 3, and the effective viable bacteria count is about 100 million per ml.

[0113] (2) Shrimp farming wastewater treatment process

[0114] Nitrite was detected using the Greencare GLS-SO4 kit and Greencare GL-900 spectrophotometer.

[0115] The initial nitrite concentration in shrimp aquaculture wastewater was 2.45~3.20 mg / L.

[0116] 800 mL of shrimp aquaculture wastewater was added to a 1 L anaerobic bottle, followed by 0.4 g of sodium thiosulfate pentahydrate. The experimental group was added with 8 mL of liquid bacterial agent Denitrifying Thiobacillus DSM 12475, and the control group was added with 8 mL of sterilized liquid bacterial agent Denitrifying Thiobacillus DSM 12475. The bottles were sealed and cultured at 30 °C. 5 mL of water samples were taken every 24 hours for nitrite content determination. In addition, the group that added the liquid bacterial agent Denitrifying Thiobacillus DSM 12475 for the first time was set as the first time, and the group that treated shrimp aquaculture wastewater again from the first group was set as the second time. The inoculation amount was 1%, and the treatment conditions remained unchanged.

[0117] As shown in Table 5, in the first treatment with the bacterial agent, the nitrite concentration in the shrimp farming wastewater tended to 0.00 mg / L after the 4th day, while the nitrite concentration was 0.00 mg / L on the 4th day of the second treatment, reaching the safe concentration for aquaculture.

[0118] Table 5 Nitrite content in different treatment groups

[0119]

[0120] Therefore, the above embodiments show that the genetic manipulation method of denitrifying Thiobacillus, the preparation of the bacterial agent and its application provided by the present invention provide a convenient and efficient genetic operating system for the creation of engineered denitrifying Thiobacillus and its molecular biology research based on synthetic biology, and can be used as a biological denitrifier in the treatment of aquatic animal breeding wastewater, domestic sewage, industrial wastewater and black and smelly water bodies in rivers.

[0121] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A mutant strain of Thiobacillus denitrificans, characterized in that Overexpression in Thiobacillus denitrificans SoxAX gene; SoxAX The gene sequence is shown in SEQ ID NO:3; The denitrifying Thiobacillus is Denitrifying Thiobacillus DSM 12475.

2. A method for constructing a mutant strain of Thiobacillus denitrificans, characterized in that: will contain SoxAX The fragment of the coding gene of SoxAX Denitrifying Thiobacillus gene; SoxAX The gene sequence is shown in SEQ ID NO:3; The denitrifying Thiobacillus is Denitrifying Thiobacillus DSM 12475.

3. The method for constructing a mutant strain of Thiobacillus denitrificans according to claim 2, characterized in that: The method of joint transfer SoxAX The gene was transferred from Escherichia coli into Thiobacillus denitrificans using IncQ plasmid pJRD215.

4. The method for constructing a mutant strain of Thiobacillus denitrificans according to claim 3, characterized in that: Said SoxAX The coding gene fragment is introduced through a recombinant expression vector; the construction method of the recombinant expression vector includes: selecting a restriction endonuclease XB I and Hind III. The recombinant plasmid pJRD215-Ptac-TdSoxAX was constructed by restriction digestion and ligation, wherein Ptac is the promoter.

5. The method for constructing a mutant strain of Thiobacillus denitrificans according to claim 4, characterized in that: The steps include: S1, donor bacteria preparation, E. coli SM10 containing plasmid pJRD215-Ptac-TdSoxAX was grown to OD 600 =0.4~0.6; S2, recipient bacteria preparation, grow the culture of Thiobacillus denitrificans to OD 600 =0.1~0.25; S3, conjugation transfer, in which the cell number ratio of donor bacteria to recipient bacteria is 1:1~6, and the conjugation system is 100~500 μL. After being fully mixed, it is spotted on the filter membrane on the solid conjugation medium of Thiobacillus denitrificans, and the plate is cultured upright; Subsequently, the bacteria on the filter membrane are washed off with a conjugation washing solution and spread on a solid culture medium containing denitrifying Thiobacillus with corresponding resistance for culture.

6. The method for constructing a mutant strain of Thiobacillus denitrificans according to claim 5, characterized in that: In step S2, the recipient bacteria are cultured in a liquid culture medium modified by Thiobacillus denitrificans, wherein the formula of the liquid culture medium modified by Thiobacillus denitrificans is: 2 g / L potassium dihydrogen phosphate, 5 g / L potassium nitrate, 1 g / L ammonium chloride, 1 g / L magnesium sulfate heptahydrate, 5 g / L sodium thiosulfate pentahydrate, 1-5 g / L sodium bicarbonate, 2 mg / L ferrous sulfate heptahydrate, 2 mL / L trace element liquid SL-4, and 0.5-2 g / L yeast powder or peptone; In step S3, the solid conjugation medium of Thiobacillus denitrificans is prepared by adding 0.5 g / L yeast powder and 15 g / L agar powder to the liquid medium of Thiobacillus denitrificans; the formula of the liquid medium of Thiobacillus denitrificans is as follows: 2 g / L potassium dihydrogen phosphate, 5 g / L potassium nitrate, 1 g / L ammonium chloride, 0.8 g / L magnesium sulfate heptahydrate, 5 g / L sodium thiosulfate pentahydrate, 1 g / L sodium bicarbonate, 2 mg / L ferrous sulfate heptahydrate, and 2 mL / L commercially available trace element liquid SL-4; The formula of the joint washing solution is 2 g / L potassium dihydrogen phosphate, 2 g / L potassium nitrate, 1 g / L ammonium chloride, 0.8 g / L magnesium sulfate heptahydrate, and 2 mL / L of commercially available trace element liquid SL-4.

7. A bacterial agent, characterized in that The active ingredient is obtained by fermenting and culturing the denitrifying Thiobacillus mutant strain described in claim 1.

8. Use of the bacterial agent according to claim 7 in wastewater treatment.

9. The use of the bacterial agent in wastewater treatment according to claim 8, characterized in that: The application includes inoculating the bacterial agent into the wastewater to be treated at a volume ratio of not less than 1%.

Images