Inhibition of polyomavirus replication

Abstract

The present invention relates to antisense molecules and methods for modulating polyoma virus T antigen precursor mRNA splicing. In one aspect, the invention relates to an antisense oligonucleotide having a length of 12 to 30 nucleobases, preferably 17, 18, 19 or 20 to 30 nucleobases, comprising a sequence which is a continuously extending reverse complementary sequence of at least 12 nucleobases of a polyoma virus T antigen precursor mRNA, and which antisense oligonucleotide can modulate splicing of said large T-antigen precursor mRNA in a cell.

Description

[0001] This application is a divisional application with a filing date of March 1, 2019, Chinese patent application number 201980029743.2, and invention name “Inhibition of polyomavirus replication”. Technical Field

[0002] The present invention relates to molecules that specifically bind to polyomavirus RNA. In some embodiments, the molecule comprises an antisense oligonucleotide that recognizes a precursor mRNA with a polyomavirus T antigen coding region. Examples of polyomaviruses are human polyomaviruses, such as JC virus (JCV), BK virus (BKV) or Merkel cell virus (MCV). Background Art

[0003] Polyomaviruses are small, non-enveloped, double-stranded DNA viruses whose natural hosts are usually mammals and birds. Infection in adults is mostly asymptomatic, but can become pathological when the immune system is compromised. Non-limiting examples of human polyomaviruses are BK virus, JC virus, and Merkel cell virus.

[0004] Both JCV and BKV are opportunistic pathogens that infect humans in early childhood (Leploeg, MD et. al., Clinical Infectious Diseases, 2001). The seroprevalence in adults is high. Both viruses are thought to remain latent in the host's renal cells (Wunderink, HF et. al., American Journal of Transplantation, 2017). For example, reactivation can occur in immunosuppressed individuals (Wunderink, HF et. al., American Journal of Transplantation, 2017; Parajuli, S. et. al., Clinical Transplantation, 2018; Gard, L. et. al., PLoS One, 2017).

[0005] Polyomaviruses have a common genomic structure. They have genes that are expressed both early and late in the infection cycle. Both early and late genes produce RNA that can translate into multiple proteins through differential splicing. Figure 1 As shown, late RNA typically encodes three capsid proteins, while early genes encode small and large T antigens, and usually have one or more other alternatively spliced ​​coding regions (Helle, F. et. al., Viruses, 2017).

[0006] WO2015 / 042466 describes a method based on antisense oligonucleotides to inhibit the replication and proliferation of JC virus. The antisense oligonucleotides disclosed therein can be oligodeoxyribonucleotides (ODN) or chimeric oligonucleotides (having an ODN interior and flanked by one or more nucleotides with a nuclease-resistant backbone. The latter makes the RNA:oligonucleotide hybrid sensitive to the action of RNaseH. The deoxyribonucleotide has at least 4 deoxyribonucleotides inside and is flanked by nuclease-resistant regions of nucleotides with 2'-sugar modifications. The antisense oligonucleotide targets a specific sequence present in the JC virus mRNA.

[0007] In some embodiments, the present invention provides antisense oligonucleotides capable of regulating polyomavirus T antigen precursor mRNA splicing. Antisense oligonucleotides may have sequences complementary to splice donor sites and / or splice acceptor sites in the precursor mRNA. Antisense oligonucleotides may have sequences complementary to one or more exon adjacent intron nucleobases (see Figure 2). In some embodiments, the antisense oligonucleotides make the duplex of the antisense oligonucleotide and its polyomavirus T antigen precursor mRNA target resistant to the action of RNaseH. Summary of the invention

[0008] The present invention provides an antisense oligonucleotide having a length of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases, which comprises a sequence that is a reverse complementary sequence of a continuous stretch of at least 12 nucleobases of polyomavirus large T antigen precursor mRNA, and the antisense oligonucleotide can regulate the splicing of the large T antigen precursor mRNA in cells (see Figure 1 ).

[0009] The splicing regulating antisense oligonucleotides of the present invention generally require a continuous stretch of at least 17, preferably at least 18, more preferably at least 19, and more preferably at least 20 nucleobases complementary to the polyomavirus large T antigen pre-mRNA.

[0010] The present invention also provides an antisense oligonucleotide of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, comprising a sequence that is the reverse complementary sequence of a continuous stretch of at least 12 nucleobases of a polyomavirus large T antigen precursor mRNA, the stretch comprising a splice donor, a splice acceptor sequence or a combination thereof in the precursor mRNA. The splice donor or acceptor sequence is preferably a polyomavirus large T antigen splice acceptor or a polyomavirus large T antigen splice donor sequence.

[0011] Also provided are antisense oligonucleotides of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, which have at least 80% complementarity to nucleotides 4537-4596 or 4881-4940 obtained from NC_001538 and at least comprise complementarity to a splice donor or splice acceptor sequence in the corresponding region.

[0012] Also provided are antisense oligonucleotides of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, which preferably have at least 80% complementarity with nucleotides in region 4397-4456 or region 4741-4800 obtained from NC_001699, and at least comprise complementarity to a splice donor or splice acceptor sequence in the corresponding region.

[0013] Also provided are antisense oligonucleotides of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, which preferably have at least 80% complementarity with nucleotides in region 4299-4358 or region 4686-4745 obtained from NC_009238, and at least comprise complementarity to a splice donor or splice acceptor sequence in the corresponding region.

[0014] Also provided are antisense oligonucleotides of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, which preferably have at least 80% complementarity with nucleotides in region 4477-4536 or region 4876-4935 obtained from NC_009539, and at least comprise complementarity to a splice donor or splice acceptor sequence in the corresponding region.

[0015] Also provided are antisense oligonucleotides of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, which preferably have at least 80% complementarity with nucleotides in region 4693-4752 or region 5124-5183 obtained from NC_010277, and at least comprise complementarity to a splice donor or splice acceptor sequence in the corresponding region.

[0016] Also provided are antisense oligonucleotides of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, which preferably have at least 80% complementarity with nucleotides in region 4264-4323 or region 4654-4713 obtained from NC_014406, and at least comprise complementarity to a splice donor or splice acceptor sequence in the corresponding region.

[0017] Also provided are antisense oligonucleotides of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, which preferably have at least 80% complementarity with nucleotides in region 4272-4331 or region 4677-4736 obtained from NC_014407, and at least comprise complementarity to a splice donor or splice acceptor sequence in the corresponding region.

[0018] Also provided are antisense oligonucleotides of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, which preferably have at least 80% complementarity with nucleotides in region 4352-4411 or region 4765-4824 obtained from NC_014361, and at least comprise complementarity to a splice donor or splice acceptor sequence in the corresponding region.

[0019] Also provided are antisense oligonucleotides of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, which preferably have at least 80% complementarity with nucleotides in region 4408-4467 or region 4760-4819 obtained from NC_015150, and at least comprise complementarity to a splice donor or splice acceptor sequence in the corresponding region.

[0020] Also provided are antisense oligonucleotides of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, which preferably have at least 80% complementarity with nucleotides in region 4303-4362 or region 4658-4717 obtained from NC_018102, and at least comprise complementarity to a splice donor or splice acceptor sequence in the corresponding region.

[0021] Also provided are antisense oligonucleotides of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, which preferably have at least 80% complementarity with nucleotides in region 4159-4218 or region 4504-4563 obtained from NC_020106, and at least comprise complementarity to a splice donor or splice acceptor sequence in the corresponding region.

[0022] Also provided are antisense oligonucleotides of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, which preferably have at least 80% complementarity with nucleotides in region 4392-4451 or region 4791-4850 obtained from NC_020890 and at least comprise complementarity to a splice donor or splice acceptor sequence in the corresponding region.

[0023] Also provided are antisense oligonucleotides of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, which preferably have at least 80% complementarity with nucleotides in region 4471-4530 or region 4859-4918 obtained from NC_024118, and at least comprise complementarity to a splice donor or splice acceptor sequence in the corresponding region.

[0024] The antisense oligonucleotide as described herein preferably comprises at least 12 consecutive nucleobases of the following sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27, wherein the at least 12 nucleotides preferably comprise the reverse complementary sequence of a splice donor site, a splice acceptor site or a combination thereof of the target pre-mRNA (i.e., a splice donor / acceptor of the large T antigen pre-mRNA of the corresponding polyomavirus).In a preferred embodiment, the antisense oligonucleotide as described herein comprises at least 17, preferably at least 18, preferably at least 19, more preferably at least 20 consecutive nucleobases of the following sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27, preferably SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24 or SEQ ID NO: 25, preferably SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24 or SEQ ID NO: 25, wherein the nucleotide preferably comprises the reverse complementary sequence of the splicing donor site, the splicing acceptor site or a combination thereof of the target pre-mRNA (i.e., the splicing donor / acceptor of the large T antigen pre-mRNA of the corresponding polyomavirus). The antisense oligonucleotide may have one mismatch with the sequence shown which is not at the start or end of the contiguous stretch, e.g. an AON having a contiguous stretch of 17 nucleotides, for example having a mismatch at position 1 or 17, would actually have a contiguous stretch of 16 nucleotides.

[0025] Also provided is a method for inhibiting polyomavirus replication in a cell, the method comprising providing an antisense oligonucleotide of the present invention specific for polyomavirus to a cell infected with the polyomavirus.

[0026] The present invention also provides a method for preparing a graft for transplantation, the method being characterized in that donor cells, preferably donor kidney cells, have the antisense oligonucleotide of the present invention specific for polyomavirus.

[0027] Also provided is a method of treating a polyomavirus infection in a subject, the method comprising administering to an individual in need thereof an antisense oligonucleotide of the invention that is specific for a polyomavirus.

[0028] Also provided is a method of administering an antisense oligonucleotide to an individual for hybridization with a complementary RNA sequence in a cell of the individual, the method being characterized in that the antisense oligonucleotide is a chimeric antisense oligonucleotide comprising a first region and a second region, and wherein the first region comprises one or more deoxyribonucleotides and the second region comprises at least one 2'-O-(2-methoxy-ethyl) nucleotide (see Figure 7 ).

[0029] Also provided is a method for inhibiting polyomavirus replication in a cell, the method comprising providing an antisense oligonucleotide having a length of 12 to 30 nucleotides to the cell, the antisense oligonucleotide comprising a reverse complementary sequence of at least 12 nucleobases of a continuous extension of a polyomavirus large T antigen precursor mRNA, and the antisense oligonucleotide can regulate the splicing of the large T antigen precursor mRNA. The antisense oligonucleotide is preferably an antisense oligonucleotide as described herein, preferably an antisense oligonucleotide of SEQ ID NO: 1-25 as described herein or modified.

[0030] DETAILED DESCRIPTION OF THE INVENTION The term "antisense oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), or mimetics, chimeras, analogs and homologs thereof. The term includes antisense oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internal nucleoside (backbone) linkages, as well as antisense oligonucleotides having non-naturally occurring portions that function similarly. Such modified or substituted antisense oligonucleotides are generally preferred over the natural forms because they possess desirable properties, such as enhanced cellular uptake, enhanced affinity for the target nucleic acid, and increased stability in the presence of nucleases (see Figure 7 ).

[0031] The antisense oligonucleotides described herein are preferably single-stranded antisense oligonucleotides.

[0032] Antisense oligonucleotides of the present invention also include modified antisense oligonucleotides, wherein different bases are present in one or more nucleotide positions of the antisense oligonucleotides. For example, if the first nucleotide is adenosine, then modified antisense oligonucleotides containing thymidine, guanosine or cytidine at this position can be produced. This can be carried out at any position of the antisense oligonucleotides. These antisense oligonucleotides are then tested using the methods described herein to determine their ability to suppress T antigen RNA.

[0033] The antisense oligonucleotide of the present invention can hybridize with the polyomavirus RNA produced when susceptible cells are infected. Therefore, the sequence included in the antisense oligonucleotide is the reverse complementary sequence of (a part of) the target RNA sequence. The antisense oligonucleotide can be introduced in the form of single-stranded, double-stranded, partially single-stranded or cyclic oligomeric compounds. In a preferred embodiment, the antisense oligonucleotide is a single-stranded antisense oligonucleotide.

[0034] The antisense oligonucleotide can be connected to one or more other chemical structures. The other structures can be peptides or proteins, sugars, lipids or other chemical structures. The other structures can also be one or more other nucleotides. The one or more other nucleotides can perform functions different from the antisense portion. For example, hybridize with another nucleic acid target sequence. The other structures can perform any one of one or more different functions. Non-limiting examples of such functions are the stability of the antisense oligonucleotide, the increase in bioavailability, the increase in cell penetration, the increase in nuclear delivery, the targeting of specific cells, etc.

[0035] Once introduced into the system, the antisense oligonucleotide of the present invention can trigger the action of one or more enzymes or structural proteins to achieve the modification of the target nucleic acid. It is known in the art that "DNA-like" single-stranded antisense oligonucleotides trigger RNase H, which is an intracellular nuclease that cleaves the RNA chain of the RNA:DNA duplex. Therefore, the activation of RNase H leads to the cutting of the RNA target. This is a method to improve the efficiency of antisense oligonucleotide-mediated gene expression inhibition. In an embodiment, the antisense oligonucleotide of the present invention does not introduce the action of RNase H into the target RNA / antisense oligonucleotide hybrid, nor is it designed to be so. For other ribonucleases, such as RNase III and ribonuclease L family enzymes, similar effects are also assumed. The antisense oligonucleotides described herein preferably have modifications that confer nuclease resistance to antisense oligonucleotides and target RNA / antisense oligonucleotide hybrids. Particularly excluded in the definition of "antisense oligonucleotides" herein are ribozymes containing internal or external "protrusions" that do not hybridize with the target sequence.

[0036] The antisense oligonucleotides according to the present invention comprise 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases (i.e., about 12 to 30 and including 30 connected nucleosides). It will be appreciated by those of ordinary skill in the art that the present invention encompasses antisense oligonucleotides of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleobases in length. It will be appreciated by those of ordinary skill in the art that this encompasses antisense oligonucleotides of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleobases in length. Those of ordinary skill in the art will appreciate that this encompasses antisense oligonucleotides of 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleobases in length. Antisense oligonucleotides are typically 18, 19, 20, 21, or 22 nucleobases in length. Antisense oligonucleotides described herein are preferably 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0037] In one embodiment, the antisense oligonucleotide comprises at least 12 consecutive nucleobases of an oligonucleotide sequence specifically disclosed herein. Antisense oligonucleotides having a length of 12-30 nucleobases comprising an extension of at least twelve (12) consecutive nucleobases selected from the exemplary antisense oligonucleotides are also considered suitable antisense oligonucleotides.

[0038] Antisense oligonucleotides include such a core base sequence, which is the reverse complementary sequence of the target RNA sequence. Antisense oligonucleotides as described herein include an extension of at least 12 core bases, and the extended sequence is the reverse complementary sequence of at least 12 continuous core base sequences of the target RNA. The extension is also referred to as a complementary region or hybridization region. It will be appreciated by those of ordinary skill in the art that the present invention includes antisense oligonucleotides with complementary regions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 core bases in length. It will be appreciated by those of ordinary skill in the art that the present invention includes antisense oligonucleotides with complementary regions of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 core bases in length. Those of ordinary skill in the art will appreciate that the present invention encompasses antisense oligonucleotides having complementary regions that are 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleobases long. Antisense oligonucleotides typically have complementary regions that are 18, 19, 20, 21, or 22 nucleobases in length. Antisense oligonucleotides described herein preferably have complementary regions that are 17, 18, 19, 20, 21, or 22 nucleobases in length.

[0039] The length of the antisense oligonucleotide is preferably commensurate with the length of the complementary region.

[0040] The target sequence of the antisense oligonucleotide described herein is a part of polyomavirus T antigen precursor mRNA. Precursor mRNA is an immature single-stranded messenger ribonucleic acid (mRNA). Polyomavirus T antigen precursor mRNA is synthesized by transcription in the nucleus by polyomavirus DNA template. The precursor mRNA contains one or more introns, which are sheared out during the process of precursor mRNA maturation into mRNA. The splicing process removes introns from the transcript and connects exons together. Both sides of the intron usually have a donor site (5' end of the intron) and an acceptor site (3' end of the intron). The splicing site is necessary for splicing, usually containing an almost constant GU sequence at the 5' end of the intron, and a splicing acceptor site with an almost constant AG sequence at the 3' end of the intron. The GU and AG sequences and intervening sequences are sheared out from the precursor mRNA. A characteristic of the polyomavirus T antigen precursor mRNA is that it can be alternatively spliced ​​or unspliced, resulting in the production of at least two, and often three, four, or five alternatively spliced ​​mRNAs (see Figure 1 ). Viral reproduction depends on the availability of the viral genome, the presence of viral proteins, cellular mechanisms, and especially the subtle interactions between different stages and components. The splicing process of viral RNA is an important method for regulating the viral reproduction process, which affects the level of certain products formed in the cell and may also affect the timing of their formation. In the present invention, it was surprisingly found that directing the oligonucleotides of the present invention to the splicing donor or splicing acceptor site to splice the large T antigen mRNA not only has a profound effect on the production of T antigen mRNA, but also has a profound effect on the level of capsid protein produced by the infected cell and the production of the virus.

[0041] The target sequence of the antisense oligonucleotide described herein comprises a splicing donor site of polyomavirus T antigen precursor mRNA, a splicing acceptor site of polyomavirus T antigen precursor mRNA, or a combination thereof. The target sequence generally comprises an extension of 12 continuous nucleobases, which comprises a splicing donor site of polyomavirus T antigen precursor mRNA or a splicing acceptor site of polyomavirus T antigen precursor mRNA. In addition to the splicing donor or splicing acceptor sequence, the continuous sequence preferably comprises an intron sequence. In a preferred embodiment, the continuous sequence comprises one or two intron nucleobases adjacent to the splicing donor or splicing acceptor sequence. In a preferred embodiment, the continuous sequence comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 intron nucleobases adjacent to the splicing donor or splicing acceptor sequence. In a preferred embodiment, the contiguous sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 exonic nucleobases adjacent to a splice donor or splice acceptor sequence. The antisense oligonucleotide preferably comprises a sequence that is the reverse complement of a contiguous nucleobase sequence of a target pre-mRNA. The total number of introns, splice sites and exonic nucleobases does not exceed the total number of nucleobases in the antisense oligonucleotide.

[0042] The target sequence preferably comprises a splice donor sequence or a splice acceptor sequence which defines an intron which is otherwise spliced ​​out to produce an mRNA encoding a specific polyomavirus large T antigen (see Figure 8 ).

[0043] The sequence of the antisense oligonucleotides described herein comprises the complement of a splice donor sequence or a splice acceptor sequence that defines an intron that is otherwise spliced ​​out to produce an mRNA encoding a specific polyomavirus large T antigen (see Figure 8 ).

[0044] In a preferred embodiment, the target sequence of the first oligonucleotide is a sequence in the 3' splice site target region indicated below for the corresponding virus. In a preferred embodiment, the target sequence of another oligonucleotide is a sequence in the 5' splice site target region indicated below for the corresponding virus. The oligonucleotides for the target sequence in the following region contain the complementary sequence of the splice donor or splice acceptor in the sequence shown. If more than one AON is used in the method described herein, it is preferred that the AON is directed to the target sequence of the same virus.

[0045]

[0046] The first column contains the abbreviation of the virus name. The prototype sequence of the virus is represented by the accession number of the sequence in the sequence database. The third and fourth columns specify the region of the virus prototype sequence that contains the splice donor (the fourth column) or the splice acceptor (the third column), wherein the AON described herein may contain a complementary region.

[0047] The antisense oligonucleotides according to the present invention can modulate the splicing of T antigen pre-mRNA in infected cells. Without being limited by theory, it is believed that the antisense oligonucleotides described herein inhibit the use of the splicing site they target. The resulting reduction in the production of large T antigen affects the expression of capsid protein, thereby affecting the production of virus (see Figure 4-6 Without being bound by theory, it is believed that the imbalance of T-antigen-specific splicing products induced by the antisense oligonucleotides of the present invention has a more significant effect on viral propagation than the reduction of T-antigen mRNA-specific mRNA by RNAi-like methods.

[0048] In the context of the present invention, "hybridization" refers to the pairing of complementary nucleic acid chains. In the present invention, the preferred pairing mechanism involves hydrogen bonding, which can be Watson-Crick, Hoogsteen or reverse Hoogsteen hydrogen bonding between complementary nucleosides or nucleotide bases (nucleobases). For example, adenine and thymine are complementary nucleobases that pair by the formation of hydrogen bonds. Hybridization can occur under different environments. The hybridization of complementary chains usually increases with the length of the sequence. The specific hybridization of the two chains is completed by the continuous extension of 12 or more complementary nucleobases. The sequence of the antisense oligonucleotide can be, but not necessarily, 100% complementary to its target sequence to be specifically hybridized. In addition, the antisense oligonucleotide can hybridize on one or more fragments so that the intervening fragments or adjacent fragments do not participate in the hybridization event. In one embodiment of the present invention, the antisense oligonucleotide of the present invention comprises at least 70%, or at least 75%, or at least 80%, or at least 85% sequence complementarity with the target region in the target precursor mRNA. In other embodiments, the antisense oligonucleotides of the present invention comprise at least 90% sequence complementarity to a target region within a target pre-mRNA, and even comprise at least 95% or at least 96% sequence complementarity. For example, 18 of the 20 nucleobases of the antisense compound are complementary to the target region and can therefore specifically hybridize, which represents a complementarity of 90%. When an 18-nucleotide antisense oligonucleotide has a reverse complementary sequence of at least 12 nucleobases of a continuous stretch of polyomavirus large T antigen pre-mRNA, the remaining 6 complementary nucleobases may be clustered with these 12 nucleobases or may not be adjacent to these 12 nucleobases. The complementary percentage of the antisense oligonucleotide to the region of the target pre-mRNA can be determined by conventionally using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Since the number of nucleotides is always an integer, the actual percentage may not be exactly 90% or not exactly 96%. The continuous sequence preferably has no or only one nucleotide mismatch with the target nucleic acid sequence.

[0049] An antisense oligonucleotide of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, preferably having at least 80% complementarity with nucleotides in region 4537-4596 or region 4881-4940 obtained from NC_001538, and at least comprising complementarity with a splice donor or splice acceptor sequence in the corresponding region, preferably having at least 90% complementarity with nucleotides 4537-4596 or 4881-4940 obtained from NC_001538. The 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases are preferably complementary to a stretch of at least 12, 13, 14, 15, 16, 17, 18, 19, 30, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of the target pre-mRNA. In a preferred embodiment, the oligonucleotide has a length of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases and preferably comprises a sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27; preferably comprises a sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27. 24 or SEQ ID NO: 25; preferably comprises a sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24 or SEQ ID NO: 25.

[0050] An antisense oligonucleotide of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, preferably having at least 80% complementarity with nucleotides in region 4397-4456 or region 4741-4800 obtained from NC_001699, and at least comprising complementarity with a splice donor or splice acceptor sequence in the corresponding region, preferably having at least 90% complementarity with nucleotides 4397-4456 or 4741-4800 obtained from NC_001699. The 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases are preferably complementary to a stretch of at least 12, 13, 14, 15, 16, 17, 18, 19, 30, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of the target pre-mRNA.

[0051] An antisense oligonucleotide of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, preferably having at least 80% complementarity with nucleotides in region 4299-4358 or region 4686-4745 obtained from NC_009238, and at least comprising complementarity with a splice donor or splice acceptor sequence in the corresponding region, preferably having at least 90% complementarity with nucleotides 4299-4358 or region 4686-4745 obtained from NC_009238. The 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases are preferably complementary to a stretch of at least 12, 13, 14, 15, 16, 17, 18, 19, 30, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of the target pre-mRNA.

[0052] An antisense oligonucleotide of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, preferably having at least 80% complementarity with nucleotides in region 4477-4536 or region 4876-4935 obtained from NC_009539, and at least comprising complementarity with a splice donor or splice acceptor sequence in the corresponding region, preferably having at least 90% complementarity with nucleotides 4477-4536 or region 4876-4935 obtained from NC_009539. The 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases are preferably complementary to a stretch of at least 12, 13, 14, 15, 16, 17, 18, 19, 30, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of the target pre-mRNA.

[0053] An antisense oligonucleotide of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, preferably having at least 80% complementarity with nucleotides in region 4693-4752 or region 5124-5183 obtained from NC_010277, and at least comprising complementarity with a splice donor or splice acceptor sequence in the corresponding region, preferably having at least 90% complementarity with nucleotides 4693-4752 or region 5124-5183 obtained from NC_010277. The 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases are preferably complementary to a stretch of at least 12, 13, 14, 15, 16, 17, 18, 19, 30, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of the target pre-mRNA.

[0054] An antisense oligonucleotide of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, preferably having at least 80% complementarity with nucleotides in region 4264-4323 or region 4654-4713 obtained from NC_014406, and at least comprising complementarity with a splice donor or splice acceptor sequence in the corresponding region, preferably having at least 90% complementarity with nucleotides 4264-4323 or region 4654-4713 obtained from NC_014406. The 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases are preferably complementary to a stretch of at least 12, 13, 14, 15, 16, 17, 18, 19, 30, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of the target pre-mRNA.

[0055] An antisense oligonucleotide of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, preferably having at least 80% complementarity with nucleotides in region 4272-4331 or region 4677-4736 obtained from NC_014407, and at least comprising complementarity with a splice donor or splice acceptor sequence in the corresponding region, preferably having at least 90% complementarity with nucleotides 4272-4331 or region 4677-4736 obtained from NC_014407. The 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases are preferably complementary to a stretch of at least 12, 13, 14, 15, 16, 17, 18, 19, 30, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of the target pre-mRNA.

[0056] An antisense oligonucleotide of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, preferably having at least 80% complementarity with nucleotides in region 4352-4411 or region 4765-4824 obtained from NC_014361, and at least comprising complementarity with a splice donor or splice acceptor sequence in the corresponding region, preferably having at least 90% complementarity with nucleotides 4352-4411 or region 4765-4824 obtained from NC_014361. The 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases are preferably complementary to a stretch of at least 12, 13, 14, 15, 16, 17, 18, 19, 30, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of the target pre-mRNA.

[0057] An antisense oligonucleotide of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, preferably having at least 80% complementarity with nucleotides in region 4408-4467 or region 4760-4819 obtained from NC_015150, and at least comprising complementarity with a splice donor or splice acceptor sequence in the corresponding region, preferably having at least 90% complementarity with nucleotides 4408-4467 or region 4760-4819 obtained from NC_015150. The 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases are preferably complementary to a stretch of at least 12, 13, 14, 15, 16, 17, 18, 19, 30, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of the target pre-mRNA.

[0058] An antisense oligonucleotide of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, preferably having at least 80% complementarity with nucleotides in region 4303-4362 or region 4658-4717 obtained from NC_018102, and at least comprising complementarity with a splice donor or splice acceptor sequence in the corresponding region, preferably having at least 90% complementarity with nucleotides 4303-4362 or region 4658-4717 obtained from NC_018102. The 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases are preferably complementary to a stretch of at least 12, 13, 14, 15, 16, 17, 18, 19, 30, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of the target pre-mRNA.

[0059] An antisense oligonucleotide of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, preferably having at least 80% complementarity with nucleotides in region 4159-4218 or region 4504-4563 obtained from NC_020106, and at least comprising complementarity with a splice donor or splice acceptor sequence in the corresponding region, preferably having at least 90% complementarity with nucleotides 4159-4218 or region 4504-4563 obtained from NC_020106. The 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases are preferably complementary to a stretch of at least 12, 13, 14, 15, 16, 17, 18, 19, 30, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of the target pre-mRNA.

[0060] An antisense oligonucleotide of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, preferably having at least 80% complementarity with nucleotides in region 4392-4451 or region 4791-4850 obtained from NC_020890, and at least comprising complementarity with a splice donor or splice acceptor sequence in the corresponding region, preferably having at least 90% complementarity with nucleotides 4392-4451 or region 4791-4850 obtained from NC_020890. The 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases are preferably complementary to a stretch of at least 12, 13, 14, 15, 16, 17, 18, 19, 30, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of the target pre-mRNA.

[0061] An antisense oligonucleotide of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases in length, preferably having at least 80% complementarity with nucleotides in region 4471-4530 or region 4859-4918 obtained from NC_024118, and at least comprising complementarity with a splice donor or splice acceptor sequence in the corresponding region, preferably having at least 90% complementarity with nucleotides 4471-4530 or region 4859-4918 obtained from NC_024118. The 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases are preferably complementary to a stretch of at least 12, 13, 14, 15, 16, 17, 18, 19, 30, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of the target pre-mRNA.

[0062] The antisense oligonucleotide as described herein preferably comprises at least 12 consecutive nucleobases of the following sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27, preferably SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24 or SEQ ID NO: 25, preferably SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24 or SEQ ID NO: 25, wherein the at least 12 nucleotides preferably comprise the reverse complement sequence of the splice donor site, splice acceptor site or a combination thereof of the target precursor mRNA (i.e., the splice donor / acceptor of the large T-antigen precursor mRNA of the corresponding polyomavirus). The reverse complement sequence is present in the corresponding SEQ ID.

[0063] The present invention further relates to an antisense oligonucleotide comprising at least 12 consecutive nucleobases of a nucleotide sequence as described below (see Figure 3 and Figure 10):

[0064] 5′ ACCUCUGAGCUACUCCAGGU 3′ SEQ ID NO: 1;

[0065] 5′ ACAAACCUCUGAGCUACUCC 3′ SEQ ID NO: 2;

[0066] 5′ CAGCACAAACCUCUGAGCUA 3′ SEQ ID NO: 3;

[0067] 5′ UCCAUAGGUUGGCACCUAGA 3′ SEQ ID NO: 4;

[0068] 5′ UGUUCCAUAGGUUGGCACCU 3′ SEQ ID NO: 5;

[0069] 5’ AAACCUCUGAGCUACUCCAG 3'SEQ ID NO: 20;

[0070] 5’ GCACAAACCUCUGAGCUACU 3'SEQ ID NO: 21;

[0071] 5’ AUCAGCACAAACCUCUGAGC 3'SEQ ID NO: 22;

[0072] 5’ AAAUCAGCACAAACCUCUGA 3'SEQ ID NO: 23;

[0073] 5’ GAAAAUCAGCACAAACCUCU 3'SEQ ID NO: 24;

[0074] 5’ AGGAAAAUCAGCACAAACCU 3'SEQ ID NO: 25;

[0075] 5’ CAUAGGUUGGCACCUAUAAA 3'SEQ ID NO: 26 or

[0076] 5’ UUCCAUAGGUUGGCACCUAU 3'SEQ ID NO: 27.

[0077] The antisense oligonucleotide as described herein preferably comprises at least 13, 14, 15, 16, 17, 18, 19 or 20 consecutive nucleobases of the following sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27, preferably SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24 or SEQ ID NO: 25, preferably SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24 or SEQ ID NO: 25, wherein the at least 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides preferably each comprise the reverse complement sequence of a splice donor site, a splice acceptor site or a combination thereof of the target pre-mRNA. The nucleobases indicated herein may be substituted with different nucleobases having the same base pairing activity (same in kind but not necessarily the same in amount). An example of such a substitute is a thymine base as a substitute for uracil. Other nucleobases may be replaced with substitutes having the same base pairing activity.

[0078] Another alternative is a base that pairs with any base. An example of the base is inosine. This base does not usually increase the specificity of the oligonucleotide compared to a base that pairs with the appropriate base in the target RNA. As known to those skilled in the art, oligonucleotides can adapt to this to a certain extent. If the same specificity is needed, additional selective bases can be added to the oligonucleotide, such as, but not limited to, an additional selective base or other non-selective bases of each inosine.

[0079] The antisense oligonucleotide preferably comprises at least 12 consecutive nucleobases of the nucleotide sequence described below (see Fig. 9 ):

[0080]

[0081] In one embodiment, the antisense oligonucleotides described herein comprise at least one backbone modification. In one embodiment, the antisense oligonucleotide comprises a phosphorothioate modification. The phosphorothioate (PS) modification replaces the non-bridging oxygen in the oligonucleotide phosphate backbone with a sulfur atom. This modification renders the internucleotide linkage resistant to nuclease degradation. Phosphorothioate bonds can be introduced between the last 3 to 5 nucleotides at the 5' or 3' end of the oligonucleotide to inhibit exonuclease degradation (see Figure 7 Inclusion of phosphorothioate bonds throughout the oligonucleotide also helps to reduce endonuclease attack (see Figure 3 ).

[0082] In another embodiment, the antisense oligonucleotide comprises a morpholino (phosphodiamidate morpholino) modification. Morpholines have standard nucleic acid bases that are bound to a morpholine ring that is linked to each other by a phosphodiamidate group rather than a phosphate. Morpholines do not cause degradation of their target RNA molecules.

[0083] In one embodiment, the antisense oligonucleotide comprises at least one sugar modification on the 2' carbon of the ribose moiety of the nucleoside. In one embodiment, the antisense oligonucleotide comprises at least one 2' sugar modification. Prakash (2011; Chem. Biodivers. Sept 8(9): 1616-1641. Doi 10.1002 / cbdv.201100081) gives a review of sugar modifications used for antisense purposes. Figure 7 As shown, the preferred 2' sugar modification is a 2'-alkoxy or 2'-alkoxyalkoxy modification, more preferably a 2'-methoxyethoxy modification. Preferred modifications are 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'-MOE), 2'-S-constrained ethyl (2'-cEt) and locked nucleic acid (LNA).

[0084] Other modifications include peptide nucleic acids (PNA).

[0085] In some embodiments, all positions in a given antisense oligonucleotide are uniformly modified. In other embodiments, certain positions in a given antisense oligonucleotide are not uniformly modified. In fact, more than one above-mentioned modification can be incorporated into a single antisense oligonucleotide, or even incorporated into a single nucleoside in an antisense oligonucleotide. The present invention also includes such antisense oligonucleotides, and the antisense oligonucleotides are chimeric antisense oligonucleotides. Chimeric antisense oligonucleotides are antisense oligonucleotides comprising two or more chemically different regions, and each region is made up of at least one nucleotide. These antisense oligonucleotides comprise at least one region, and wherein the antisense oligonucleotides are modified to give the antisense oligonucleotides with increased nuclease degradation resistance, increased cellular uptake and / or increased binding affinity to the target nucleic acid.

[0086] Antisense oligonucleotides can be used as substrates for enzymes that can cut RNA: DNA or RNA: RNA hybrids. Usually this possibility is mediated by including a region inside the antisense oligonucleotide. This antisense oligonucleotide is also referred to as a "gapmer". The gapmer is a chimeric antisense oligonucleotide that contains a typical deoxyribonucleotide monomer center block, and its length is enough to induce RNaseH cutting. Effective RNase cutting requires an extension of 4 or more deoxyribonucleotides. Usually such an extension has 9 or more deoxyribonucleotides. In the present invention, it is preferred that the antisense oligonucleotide does not include a region that can serve as an enzyme substrate, and the enzyme can cut RNA: DNA or RNA: RNA hybrids.

[0087] The antisense oligonucleotides preferably comprise modified nucleotides, such as phosphorothioate-modified nucleobases and / or 2' sugar modifications, thereby providing resistance to unintentional degradation by nucleases. Figure 7As shown, the preferred 2' sugar modification is a 2'-alkoxy or 2'-alkoxyalkoxy modification, more preferably a 2'-methoxyethoxy modification. Preferred 2' sugar modifications include 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'-MOE), 2'-S-constrained ethyl (2'-cEt) and locked nucleic acid (LNA). The backbone may contain phosphorothioate throughout. The present invention also includes other configurations of antisense oligonucleotides. The antisense oligonucleotide preferably comprises modified nucleotides to provide resistance of the target RNA to unintentional degradation by nucleases, such as phosphorothioate-modified nucleobases and / or 2' sugar modifications. Such antisense oligonucleotides are within the scope of the present invention. Therefore, the oligonucleotides disclosed herein preferably have a region that provides nuclease resistance to the target RNA. The duplex formed by the antisense oligonucleotide and the target RNA is insensitive to the action of RNase H.

[0088] In a preferred embodiment, the antisense oligonucleotide comprises one or more nucleobases with a modified polymer backbone. The modified polymer backbone is preferably a modified backbone shown elsewhere herein. In a preferred embodiment, the modified polymer backbone comprises 2′-O-methyl (2′-O-Me), 2′-O-methoxyethyl (2′-MOE), 2′-S-constrained ethyl (2′-cEt), locked nucleic acid (LNA), peptide nucleic acid (PNA) or morpholino (PMO) nucleotides. In a preferred embodiment, all nucleotides in the modified polymer backbone comprise a modified sugar moiety, preferably on the 2′ carbon. In a preferred embodiment, the phosphate group connecting two nucleotides is modified to a thiophosphate group. Preferably, in the modified polymer backbone, all phosphodiester bonds are thiophosphate bonds.

[0089] Human polyomaviruses can be divided into several genera, called α, β and δ genera (Helle, F. et. al., Viruses, 2017). In a preferred embodiment, the polyomavirus is an alpha or beta virus, preferably a beta virus. The following table lists several human polyomaviruses. In a preferred embodiment, the polyomavirus is BK polyomavirus (or BK virus, also referred to as BKPyV or BKV in this application), JC polyomavirus (or JC virus, also referred to as JCV in this application) or Merkel cell polyomavirus (MC polyomavirus, MC virus, or also referred to as MCV in this application). In a preferred embodiment, the polyomavirus is BK virus or JC virus, preferably BK virus.

[0090]

[0091] The present invention also provides a method for inhibiting polyomavirus replication in a cell, the method comprising providing the antisense oligonucleotide described herein to a cell infected with the polyomavirus. The antisense oligonucleotide is preferably an oligonucleotide targeting the infected polyomavirus (see Figure 3 ). The cell is preferably a cell that is susceptible to polyomavirus replication. When the cell is an animal (such as a human) cell, it is preferred that the animal is a permissive host, i.e. a host that allows the virus to bypass its defenses and replicate the virus. For polyomaviruses (such as BK virus and JC virus), replication is usually first detected by detecting the virus in the urine of the animal (uremia). Then, when the infection persists, the virus can also be detected in the serum of the animal (viremia). Most people encounter BK and JC viruses in childhood, causing mild illness. However, when reactivated or acquired in an immunocompromised host, BK and JC viruses are considered to be associated with a number of human clinical disease states. BK is most commonly associated with renal involvement, such as ureteral stenosis, hemorrhagic cystitis, and nephropathy (Leploeg, MD et. al., Clinical InfectiousDiseases, 2001; Helle, F. et. al., Viruses, 2017). Host susceptibility or permissiveness can be induced by compromising the host's immune system. Many conditions can result in a temporary or permanent reduction in the host's immune capacity. Immunodeficiency is a condition in which the immune system's ability to fight infectious diseases and cancer is impaired or completely absent. Most cases of immunodeficiency are acquired ("secondary") due to external factors that affect the patient's immune system. Examples of these external factors include HIV infection, extremes of age, and environmental factors (such as nutrition). Immunosuppression can also be induced by some drugs, such as glucocorticoids, cytostatics, antibodies, and compounds that act on immunophilins (such as calcineurin inhibitors, belatacept (an immunoglobulin-like molecule with a CTLA-4 extracellular domain), and similar molecules). This can be a desired effect, for example in organ transplant surgery as an anti-rejection measure, and in patients with an overactive immune system, such as in autoimmune diseases. However, sometimes this desired effect has the additional effect of reducing the individual's ability to fight viral infections (such as polyomavirus infections). People with any type of immunodeficiency are called immunocompromised people. In addition to common infections that can affect everyone, immunocompromised people may be particularly vulnerable to opportunistic infections.

[0092] In one embodiment, the present invention provides a method for preparing a transplant for transplantation, characterized in that the antisense oligonucleotide described herein is provided to a donor cell (preferably a donor kidney cell). The antisense oligonucleotide is preferably an oligonucleotide targeting a polyomavirus that replicates in a transplant cell. In the case of a renal transplant or a renal cell transplant, the polyomavirus is preferably a BK virus, JC virus or MC virus specific oligonucleotide. The transplant cells treated in this way are less sensitive to the replication of polyomaviruses specific to the antisense oligonucleotide. This increases the success rate of transplantation. It is convenient for managing transplant recipients. One of the methods for controlling opportunistic polyomavirus replication in transplant recipients and other drug-induced immunosuppression in patients is to reduce the administration of immunosuppressive drugs, thereby restoring the immune system to a degree that reduces viral infection and / or replication. When a transplant is prepared as described herein, the incidence of polyomavirus infection / replication in the patient is lower than that in patients receiving untreated transplants, and when detected, it is usually less severe. Preferably, the transplant recipient receives one or more additional antisense oligonucleotide administrations as needed. The present invention also provides a method of treating polyomavirus infection in a subject, the method comprising administering the antisense oligonucleotide described herein to an individual in need thereof. The individual is preferably an immunocompromised individual.

[0093] The transplant is preferably an allogeneic transplant or a xenotransplant. The recipient of this transplant is usually treated with immunosuppressive drugs to increase the survival rate of the transplant, or to reduce the incidence and / or severity of host-versus-graft effects. Many tissues can be transplanted at present. When cells or organs are transplanted from another non-genetically identical person or non-human animal, the host-versus-graft effect is usually at high risk. Transplants include lungs, hearts, heart valves, kidneys, livers, pancreas, intestines, thymuses, and bone marrow. In patients who receive immunosuppression after organ transplantation, polyomaviruses have been detected in up to 3% of the patient's plasma (De Vlaminck, I. et. al., Cell, 2013). The transplant preferably comprises kidneys or renal cells. The individual is preferably a recipient of a kidney or renal cell transplant.

[0094] The antisense oligonucleotide is preferably one that confers RNase H resistance to the oligonucleotide and target RNA duplex. The antisense oligonucleotide preferably comprises a sequence that is the reverse complement of a continuous stretch of at least 12, preferably at least 17 nucleobases of an RNA that can be present in human kidney cells, preferably an RNA of a human virus that can replicate in human kidney cells, preferably a polyoma virus.

[0095] In one embodiment, the present invention provides an antisense oligonucleotide having a length of 12 to 30, preferably 17, 18, 19 or 20 to 30 nucleobases, which comprises a reverse complementary sequence of at least 12 nucleobases of a continuous stretch of polyomavirus T-antigen precursor mRNA, and the antisense oligonucleotide can modulate the splicing of the T-antigen precursor mRNA in a cell, wherein the antisense oligonucleotide comprises at least 12 consecutive nucleobases of the following sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20. SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27.

[0096] Also provided is an antisense oligonucleotide comprising at least 12 consecutive nucleobases of the following sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27, wherein the at least 12 nucleotides comprise the reverse complementary sequence of the splice donor sequence or the splice acceptor sequence of the large T antigen pre-mRNA of the corresponding polyomavirus.

[0097] The antisense oligonucleotides described herein preferably comprise modifications that render the mRNA-oligonucleotide duplex resistant to the action of RNase H. Preferably, at least one nucleobase having a modified polymer backbone is included, preferably 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'-MOE), 2'-S-constrained ethyl (2'-cEt), locked nucleic acid (LNA), peptide nucleic acid (PNA) or morpholino (PMO) nucleotides. Preferably, all nucleobases comprise a modified polymer backbone, preferably 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'-MOE), 2'-S-constrained ethyl (2'-cEt), locked nucleic acid (LNA), peptide nucleic acid (PNA) or morpholino (PMO) nucleotides.

[0098] In a preferred embodiment, the antisense oligonucleotide comprises at least 17, preferably at least 18, 19, preferably at least 20 consecutive nucleobases of the following sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: : 27, or comprises at least 17, preferably at least 18, 19 and preferably at least 20 consecutive nucleobases of the following sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27, which has one mismatch, and wherein the mismatch is not the first or last nucleotide of the continuous stretch.

[0099] Also provided is a method for inhibiting polyomavirus replication in cells, the method comprising providing the antisense oligonucleotide to cells infected by the polyomavirus. Also provided is a method for preparing a graft for transplantation, the method being characterized in that donor cells (preferably donor kidney cells) are provided with the antisense oligonucleotide.

[0100] Also provided is a method of treating polyomavirus infection in a subject, the method comprising administering an antisense oligonucleotide as described herein to an individual in need thereof. The individual is an immunocompromised individual. The individual is preferably a recipient of a kidney or renal cell transplant.

[0101] Also provided is a method of administering an antisense oligonucleotide to an individual for hybridization with a complementary RNA sequence in a kidney cell of the individual, the method being characterized in that the antisense oligonucleotide is an oligonucleotide as described herein.

[0102] Also provided is an antisense oligonucleotide comprising a modification that renders the duplex of the antisense oligonucleotide and the target mRNA resistant to the action of RNase, wherein the antisense oligonucleotide comprises the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27, which has no mismatches, one or two mismatches.

[0103] It has been observed that when administered to animals, the oligonucleotides described herein are effectively delivered to and absorbed by the relevant kidney cells. The preferred method of administration is IV administration. For polyomaviruses that can cross the blood-brain barrier and enter the central nervous system (CNS), such as JC-virus, antisense oligonucleotides can be administered to the CNS. A variety of methods are known in the prior art. For the treatment of JC virus infection of the CNS mediated by antisense oligonucleotides, intrathecal delivery is preferred. JC virus infection can also be antagonized by IV delivery, because the initial infection is generally considered to be through the tonsils or gastrointestinal tract, and then it spreads to other organs, such as but not limited to tubular epithelial cells in the kidney, where it can remain latent or continue to breed, releasing viral particles in urine and brain.

[0104] The antisense oligonucleotide preferably does not have a sequence consisting of:

[0105] 5′-CACAAACCTCTGAGCTA;

[0106] 5′-AACCUCUGAACUAUUCCAUGU;

[0107] 5′-ACCUCUGAACUAUUCCAUGUA;

[0108] 5'-TTCATCTGTTCCATAGGTTGGCACCTA; or

[0109] 5'-TTCCATAGGTTGGCACCTAAAAAAAAA, or alternatives thereof, wherein one or more thymines are uracils, or vice versa.

[0110] For purposes of clarity and concise description, features are described herein as being part of the same or separate embodiments, however, it is to be understood that the scope of the invention may include embodiments having a combination of all or some of the described features. BRIEF DESCRIPTION OF THE DRAWINGS

[0111] Figure 1 : Schematic diagram of the BK virus genome and sequence similarities of various BK virus genome subtypes. Left: The BK virus genome encodes five major proteins, namely, small T and large T antigens (early genes), as well as agnoprotein and major capsid proteins VP1, VP2 and VP3 (late genes). The viral genome also contains a non-coding region (NCCR), which contains both the replication origin and the promoter region of transcription factors that drive the expression of early and late genes and the replication of the viral genome. It is worth noting that alternative splicing of early pre-mRNA and late pre-mRNA leads to many protein subtypes, including small t antigen, truncated T antigen (2 introns) and large T antigen (1 intron), as well as alternative splicing that determines the ratio of VP1, VP2 or VP3 production. However, it is important to note that the major splicing variant produced in the late region is the mature mRNA that mainly encodes VP1. Continued: The genomic sequence of the early region encodes T antigen proteins, namely small t (tAg), truncated T (truncTAg) and large T antigen (TAg). tAg plays a key role in driving infected cells into the S phase, which allows TAg-mediated viral genome replication. In addition, TAg binds to the NCCR to drive the expression of late region pre-mRNA. This leads to the production of VP1, VP2, and VP3, which are essential for the encapsulation of viral DNA.

[0112] Figure 2: Alignment of the full gene sequences (including intronic sequences) of TAgs from 245 unique BK-polyomavirus isolates (downloaded from the publicly available NCBI database) using CLustaLow (“msa” package, R language). From these records, only isolates reporting complete genomes were used for conservation analysis of splice sites in TAgs. The Dunlop strain was used as a reference genome. Phylogenetic trees were constructed using the UPGMA method (“phangorn” and “ggtree” packages, R language). Sequence logos were constructed for acceptor and donor splice sites to show nucleotide-specific conservation between subtypes (“msa” package, R language).

[0113] Figure 3 : Composition of antisense oligonucleotides that modulate BKPyV TAg splicing. Sequences of antisense oligonucleotides (AONs) directed against the exon 1-intron junction (AON #1, #2, and #3) and intron-exon 2 junction (AON #4 and #5) of BKPyV TAg.

[0114] Figure 4 : TAg splicing-regulated AONs reduce the expression levels of TAg and VP1 mRNA in BKPyV-infected human epithelial cells. Left: Reduction of TAg RNA levels in HK2 cells treated with disordered AONs and those treated with splicing-regulated AONs #1, #2, #3, #4, and #5 on day 7 after infection with BKPyV virus at a multiplicity of infection of about 100 (n=5; p<0.05). Right: Reduction of VP1 RNA levels in HK2 cells treated with disordered AONs and those treated with splicing-regulated AONs #1, #2, #3, #4, and #5 after infection with BKPyV virus at a multiplicity of infection of about 100 (n=5; p<0.05).

[0115] Figure 5 Figure : TAg splicing-regulated AONs reduce the expression level of VP1 protein in BKPyV-infected human epithelial cells. Western blot analysis of HK2 cell lysates harvested 7 days after infection with BK polyomavirus at a multiplicity of infection of approximately 100. AONs #2, #3, and #4 significantly reduced the expression level of VP1 protein compared to HK2 cells treated with random AONs (n=4).

[0116] Figure 6 :TAg splicing-regulated AONs reduce BK virus replication. Viral DNA concentrations in culture supernatants were determined by polymerase chain reaction analysis of VP1 in the BKPyV genome. HK2 cells treated with AONs #2, #3, and #4 consistently showed reduced levels of the BKPyV genome in the culture supernatant compared to cells treated with scrambled AONs.

[0117] Figure 7 : Chemical modification of AONs. Some chemical modifications that have been applied to current TAg splicing regulatory AONs (2'-OMe on the phosphorothioate backbone and ribose moiety) are described. Other embodiments of these AONs may employ 2'-MOE or 2'-cEt modifications at this position. These modifications are primarily intended to improve the stability of the AONs.

[0118] Figure 8 : Sequence similarity of 13 polyomaviruses known to have human hosts. Notably, these strains span the alpha, beta, and delta genera, most of which have been recently characterized. As shown in the phylogenetic tree information on the left side of the figure, BKPyV and JCPyV share considerable sequence similarity, suggesting that their co-localization in renal proximal tubule epithelial cells makes them targets for the splicing-regulating AONs described herein.

[0119] Fig. 9 : Design of AONs that can be used to target other polyomaviruses. In addition to the BK and JC virus TAg splicing regulatory AONs described above, AONs were designed based on the possibility that AONs could also target human polyomavirus 3 (Karolinska Institute or KI), human polyomavirus 4 (Washington University or WU), and human polyomavirus 5 (Merkel cell virus or MCV). For human polyomaviruses 3-5, 2 AONs were designed for exon 1-intron junctions, 2 AONs were designed for intron-exon 2 junctions, and 3 AONs were designed at exon 1-intron sites.

[0120] Figure 10: Schematic diagram of the BK virus genome and BKV targeting AON. Part I: The BK virus genome encodes 6 major proteins, namely, small T and large T antigens (early genes), as well as agnoprotein and major capsid proteins VP1, VP2 and VP3 (late genes). The viral genome also contains a non-coding region (NCCR), whose sequence contains both a replication origin and a promoter region responsible for recruiting transcription factors, which drive early and late gene expression and also coordinate the replication of the viral genome. Figure 1As shown, alternative splicing of early pre-mRNA and late pre-mRNA leads to many protein isoforms, including small t antigen, truncated T antigen (2 introns) and large T antigen (1 intron), as well as alternative splicing that determines the ratio of VP1, VP2 or VP3 produced. The major splice variant produced in the late region mainly leads to the expression of VP1. Part II: AON sequence used to target the exon-intron junction of BKV large T antigen (TAg), as shown in the figure above. Part III: Schematic diagram describing the AON binding site at the exon-intron junction of BKV Tag.

[0121] Figure 11: Bioinformatic analysis of TAg splice site conservation for design of universal BKV targeting AONs. Part I: Phylogenetic tree containing full-genome TAg sequences of unique BKV isolates / strains showing clear distinction between BKV subgroups. Part II: Sequence logo of TAg splice sites with flanking regions (20 nucleotides) showing high sequence conservation between subgroups. Sequences of antisense oligonucleotides (AONs) targeting exon 1-intron junctions (HYB_01, HYB_02, HYB_03, HYB_06, HYB_07, HYB_08, HYB_09, HYB_10, and HYB_11) and intron-exon 2 junctions (HYB_04, HYB_05, HYB_12, and HYB_13) of BKV TAg are provided.

[0122] Fig.12 : TAg splicing-regulating AONs reduce TAg mRNA expression levels in BKV-infected human renal epithelial cells. Reduction of TAg RNA levels in HK2 cells treated with scrambled AONs and HK2 cells treated with BKV-targeted AONs before cells were infected with BKV at an MOI of approximately 100 (n=3 biological replicates). Note: HYB_14 binds only to the exonic region of TAg exon 1 and does not target exon-intron boundaries.

[0123] Fig.13 : TAg splicing-regulated AONs reduce VP1 mRNA expression levels in BKV-infected human renal epithelial cells. Reduction of VP1 RNA levels in HK2 cells treated with scrambled AONs and HK2 cells treated with BKV-targeted AONs before cells were infected with BKV at an MOI of approximately 100 (n=3 biological replicates). Note: HYB_14 binds only to the exonic region of TAg exon 1 and does not target exon-intron boundaries.

[0124] Fig.14: TAg splicing-regulated AONs reduce the expression level of VP1 protein in BKV-infected human kidney epithelial cells. Representative Western blot analysis of cell lysates harvested from HK2 cells treated with BKV-targeted AONs. The blot analysis depicts the VP1 protein levels of lysates harvested 7 days after infection with BK polyomavirus at an MOI of approximately 100 (n=3 biological replicates).

[0125] Fig.15 : Quantification of VP1 protein expression levels in human kidney epithelial cells after treatment with BKV-targeted AONs and infection with BKV. Quantification of western blot analysis of HK2 cell lysates harvested 7 days after infection with BK polyomavirus at a multiplicity of infection of approximately 100. HK2 cells treated with scrambled AONs were used as controls, all values ​​are expressed in log2 scale (n=3 biological replicates). Note: HYB_14 binds only to the exonic region of TAg exon 1 and does not target exon-intron boundaries.

[0126] Fig.16 Figure : TAg splicing-regulated AONs reduce BKV DNA replication. Virus particle concentrations in culture supernatants 7 days after infection were determined by PCR analysis of VP1 in the BKV genome. HK2 cells treated with BKV-targeted AONs consistently showed reduced levels of BKV particles in culture supernatants compared to cells treated with scrambled AONs. Data represent biological replicates n=3.

[0127] Fig.17 :TAg splicing regulatory AON reduces HK2 reinfection levels. Culture supernatant was removed from HK2 cells that had been pretreated with BKV targeting AON and infected with BKV on day 7. The supernatant was used to infect untreated HK2 cells (2h), after which the cells were cultured for 7 days and stained for TAg and hoechst (nucleus) using immunohistochemistry. Subsequently, the percentage of positive cells was determined and described relative to cells treated with disordered AON. Data represent biological replicates n=3.

[0128] Fig.18 : Heatmap depicts the cumulative effects of treatment with BKV-targeted AONs on various aspects of BKV infection of HK2 cells. Effects on TAg and VP1 mRNA, VP1 protein, viral particle production, and reinfection are summarized. Block representation: black represents little to no effect, while white represents a large effect (2 log-fold change compared to scrambled, n=3).

[0129] Fig.19: TAg splicing-regulated leader AONs reduce TAg mRNA expression levels in BKV-infected human renal epithelial cells. Reduction of TAg RNA levels in HK2 cells treated with random AONs and HK2 cells treated with BKV-targeted leader AONs (HYB_01, HYB_03, or HYB_11) followed by infection with BKV at a multiplicity of infection of approximately 100 (n=3 biological replicates). Note: SAN_73 and SAN_74 are previously described AONs (16 nucleotides long). These data represent biological replicates n=3.

[0130] Fig. 20 : TAg splicing-regulated leader AONs reduce VP1 mRNA expression levels in BKV-infected human renal epithelial cells. Reduction of VP1 mRNA levels in HK2 cells treated with scrambled AONs and HK2 cells treated with BKV-targeted leader AONs (HYB_01, HYB_03, or HYB_11) followed by infection with BKV at an MOI of approximately 100. Note: SAN_73 and SAN_74 are previously described AONs (16 nucleotides in length). These data represent biological replicates n=3.

[0131] Fig.21 : TAg splicing-regulating lead AONs reduce VP1 protein expression levels in BKV-infected human kidney epithelial cells. Representative Western blot visualization of VP1 protein levels in cell lysates obtained from HK2 cells treated with BKV-targeting lead compound AONs and infected with BK polyomavirus at an MOI of approximately 100 for 7 days (n=3 biological replicates).

[0132] Fig. 22 : TAg splicing-regulated leader AONs reduce VP1 protein expression levels in BKV-infected human renal epithelial cells. Reduction of VP1 protein levels in HK2 cells treated with random AONs and HK2 cells treated with BKV-targeted leader AONs (HYB_01, HYB_03, or HYB_11) followed by infection with BKV at an MOI of approximately 100. Note: SAN_73 and SAN_74 are previously described AONs (16 nucleotides long). These data represent biological replicates n=3.

[0133] Fig.23: TAg splicing-regulated leader AONs reduce viral particle production in BKV-infected human kidney epithelial cells. Reduction in viral particle levels in HK2 cells treated with scrambled AONs and HK2 cells treated with BKV-targeted leader AONs (HYB_01, HYB_03, or HYB_11) after which cells were infected with BKV at an MOI of approximately 100. Note: SAN_73 and SAN_74 are previously described AONs (16 nucleotides long). These data represent biological replicates n=3.

[0134] Fig.24 : TAg splicing regulatory leader AON reduces HK2 reinfection level. Culture supernatant was removed from HK2 cells that had been pretreated with BKV-targeted leader AON (HYB_01, HYB_03 or HYB_11) and infected with BKV on day 7. The supernatant was used to infect untreated HK2 cells (2h), after which the cells were cultured for 7 days and stained for TAg and Hoechst (nucleus) using immunohistochemistry. Subsequently, the percentage of positive cells was determined and described relative to cells treated with disordered AON. Data represent biological replicates n=3.

[0135] Fig.25 : Heatmap depicts the cumulative effects of BKV-targeted lead AON treatment on various aspects of BKV infection of HK2 cells. The effects observed on TAg and VP1 mRNA, VP1 protein, viral particle production, and reinfection are summarized for HK2 cells pre-treated with our lead AONs (HYB_01, HYB_03, or HYB_11). Block representation: black represents little to no effect, while white represents a large effect (2 log-fold change compared to scrambled, n=3).

[0136] Fig.26 : Efficacy of TAg splicing-regulating AONs in reducing TAg mRNA expression in HK2 pre-infected with BKV. In contrast to AON pre-treatment, we first infected HK2 cells with BKV virus and subsequently assessed the efficacy of AONs in reducing TAg mRNA expression levels. Left panel: A single dose of AONs post-infection significantly reduced TAg mRNA expression levels, although the addition of AONs at later time points seemed less effective. Right panel: Multiple doses of BKV-targeted AONs more effectively reduced TAg mRNA expression levels. Of note, RNA expression levels for all treatment time points were determined at t=7 days post-infection, so the exposure time was shorter at later time points compared to earlier treatments. Data represent biological replicates n=1.

[0137] Fig. 27: Efficacy of TAg splicing-regulated AONs in reducing VP1 mRNA expression in HK2 pre-infected with BKV. In contrast to AON pre-treatment, we first infected HK2 cells with BKV virus and subsequently assessed the efficacy of AONs in reducing VP1 mRNA expression levels. Left panel: A single dose of AONs post-infection significantly reduced VP1 mRNA expression levels, although the addition of AONs at later time points seemed less effective. Right panel: Multiple doses of BKV-targeted AONs more effectively reduced VP1 mRNA expression levels. Of note, RNA expression levels for all treatment time points were determined at t=7 days post-infection, so the exposure time was shorter at later time points compared to earlier treatments. Data represent biological replicates n=1.

[0138] Fig.28 : TAg splicing-regulated leader AONs reduce TAg mRNA expression levels in BKV-infected human primary proximal tubule epithelial cells. Reduction in TAg RNA levels in hPTEC treated with scrambled AONs and hPTEC treated with BKV-targeted leader AONs (HYB_01, HYB_03, or HYB_11) or HYB_14 (followed by cells infected with BKV at a multiplicity of infection of approximately 100) (n=3 biological replicates). These data represent biological replicates n=3.

[0139] Fig.29 :TAg splicing-regulated leader AONs reduce VP1 mRNA expression levels in BKV-infected hPTEC. Reduction in VP1 RNA levels in hPTEC treated with scrambled AONs and hPTEC treated with BKV-targeted leader AONs (HYB_01, HYB_03, or HYB_11) or HYB_14, after which cells were infected with BKV at an MOI of approximately 100 (n=3 biological replicates). These data represent biological replicates of n=3.

[0140] Fig.30 : TAg splicing regulatory lead AON reduces the expression levels of VP1 and VP3 proteins in BKV-infected hPTEC. Representative Western blot visualization of VP1 and VP3 protein levels in cell lysates obtained from hPTEC treated with BKV-targeted lead compound AON and infected with BK polyomavirus at an MOI of approximately 100 for 7 days (VP1 and GAPDH: n=3 biological replicates, VP3: n=1).

[0141] Fig.31:TAg splicing-regulated leader AONs reduce the expression level of VP1 protein in BKV-infected hPTEC. Reduction of VP1 protein levels in hPTEC treated with disordered AONs and hPTEC treated with BKV-targeted leader AONs (HYB_01, HYB_03, or HYB_11) or HYB_14 (after which cells were infected with BKV at an MOI of approximately 100) (n=3 biological replicates). These data represent biological replicates of n=3.

[0142] Fig.32 : TAg splicing-regulated leader AONs reduce VP3 protein expression levels in BKV-infected hPTEC. Reduction in VP3 protein levels in hPTEC treated with random AONs and hPTEC treated with BKV-targeted leader AONs (HYB_01, HYB_03, or HYB_11) or HYB_14 (after which cells were infected with BKV at an MOI of approximately 100) (n=3 biological replicates). These data represent biological replicates of n=1.

[0143] Fig.33 :TAg splicing-regulated leader AONs reduce viral particle production in BKV-infected hPTEC. Reduction in viral particle levels in hPTEC treated with disordered AONs and hPTEC treated with BKV-targeted leader AONs (HYB_01, HYB_03, or HYB_11) or HYB_14, after which cells were infected with BKV at an MOI of approximately 100. These data represent biological replicates n=3.

[0144] Fig.34 : Heatmap depicts the cumulative effects of treatment with BKV-targeted lead AONs on various aspects of BKV infection of hPTEC. The effects observed on TAg and VP1 mRNA, VP1 protein, and viral particle production are summarized for hPTEC pre-treated with our lead AONs (HYB_01, HYB_03, or HYB_11) or HYB_14. Block representation: black represents little to no effect, while white represents a large effect (2 log-fold change compared to scrambled, n=3).

[0145] Fig.35 : RNA sequencing analysis of splicing regulation induced by the lead BKV-targeted AON. The major transcripts and splicing events are shown in the upper part of the figure, while in the lower part of the figure, the observed splicing patterns and z-scores are shown, indicating that our BKV-targeted AONs indeed regulate splicing. Events were observed at the exon 1-intron site as well as in the 3'-region of exon 2. Overall, the presence of a single AON appears to affect both proximal and distal effects of splicing, suggesting a complex splicing event.

[0146] Fig.36 : Long read sequence analysis of splicing regulation induced by BKV-targeted lead compound AONs. Long read sequence analysis of RNA transcripts from HK2 cells pre-treated with disordered AONs or our lead compound AONs (HYB_01, HYB_03, or HYB_11). Left: Bar graphs depict the percentage of transcripts that utilize large T or small T donor sites in conjunction with fixed acceptor sites (intron-exon 2) or unspliced ​​transcripts, indicating splicing regulation by BKV-targeted AONs. Right: Bar graphs depict the percentage of transcripts that utilize truncated T or truncated T* acceptor sites in conjunction with fixed donor sites, indicating splicing regulation by BKV-targeted AONs.

[0147] Figure 37: Schematic diagram of the JC virus genome and JCV targeting AON. Part I: Similar to BK virus, the JC virus genome encodes small T and large T antigens (early genes), as well as agnoprotein and major capsid proteins VP1, VP2 and VP3 (late genes). The viral genome also contains a non-coding region (NCCR) having a replication origin and a promoter region for transcription factor binding, which drives the expression of early and late genes and viral genome replication. Compared with the extensive knowledge about BKV splicing of early and late region precursor mRNAs, less is known about JCV splicing. Part II: AON sequence for targeting the exon-intron junction of JCV large T antigen (TAg), as shown in the figure above. Part III: Schematic diagram describing the AON binding site at the JCV TAg exon-intron junction.

[0148] Fig.38 : TAg splicing-regulating AONs reduce TAg mRNA expression levels in JCV-infected astrocytes derived from human induced pluripotent stem cells. Reduction of TAg mRNA levels in hiPSC-derived astrocytes treated with random AONs and hiPSC-derived astrocytes treated with JCV-targeting AONs followed by JCV infection (n=1).

[0149] Fig.39 : TAg splicing-regulated AONs reduce VP1 mRNA expression levels in JCV-infected astrocytes derived from human induced pluripotent stem cells. Reduction of VP1 mRNA levels in hiPSC-derived astrocytes treated with random AONs and hiPSC-derived astrocytes treated with JCV-targeted AONs followed by JCV infection (n=1).

[0150] Fig.40: TAg splicing-regulating AONs reduce TAg mRNA expression levels in JCV-infected primary human astrocytes. Reduction of TAg mRNA levels in primary astrocytes treated with scrambled AONs and treated with JCV-targeting AONs followed by infection of cells with JCV (n=2 biological replicates).

[0151] Fig.41 : TAg splicing-regulated AONs reduce VP1 mRNA expression levels in JCV-infected primary human astrocytes. Reduction of VP1 mRNA levels in primary astrocytes treated with scrambled AONs compared with those treated with JCV-targeted AONs, followed by cell infection with JCV (n=2 biological replicates).

[0152] Fig.42 : Coverage of the BKV genome by amplified RNA in RNA sequencing. Paired-end reads were aligned to the BKV genome from scrambled control, HYB_01, HYB_03, HYB_11, HYB_14, or SAN_73 and SAN_74 treated cells, allowing semi-quantitative assessment of BKV RNA expression levels. Data represent biological replicates n=3 and are divided into early and late gene expression profiles.

[0153] Fig.43 : Electrophoretic analysis of TAg(pre)-mRNA produced by long-read high-fidelity Phusion polymerase. Phusion polymerase was used to prepare long-read high-fidelity mRNA from RNA harvested from HK2 cells treated with either a scrambled control AON (lane 1) or a BKV-targeted AON (i.e., HYB_01, HYB_03, or HYB_11; lanes 2-4, respectively) and assessed by capillary electrophoresis. Data represent biological replicates n=3.

[0154] Fig.44 : Fluorescence microscopy of AON uptake in mouse kidney 24 hours after intravenous administration. Color separated high magnification images of mouse kidney sections 24 hours after intravenous administration of 40 mg / kg HYB_01 (2'MOE without 5'6-FAM labeling) in C57BL / 6J mice. Nuclei were stained with Hoechst and proximal tubule epithelial cell uptake was visualized based on colocalization with Lotus japonicum lectin (LTL) positive cells of the kidney (proximal tubule). The left image represents 100x magnification (10x objective, scale bar = 100 µm), while the right image represents 400x magnification (40x objective, scale bar = 20 µm).

[0155] Fig.45: Immunohistochemical staining of mouse tissues for BKV-targeted AON uptake. Organs were excised 24 h after intravenous administration of 40 mg / kg HYB_01 (2'MOE, without 5'6-FAM labeling) in C57BL / 6J mice, and AON uptake was assessed by immunohistochemistry. AON backbones were specifically detected by staining with hematoxylin and eosin (H&E) followed by anti-phosphorothioate antibodies and diaminobenzidine (DAB) as a peroxidase substrate to reveal HRP-labeled secondary antibodies. Positive signals from AON staining were visualized in ImageJ by color deconvolution and thresholding, indicating high levels of AON uptake in positive tubules, while the signal in the liver was significantly reduced and absent in cardiac tissue. DETAILED DESCRIPTION

[0156] Example 1

[0157] Materials and methods

[0158] Materials used for phylogenetic analysis

[0159] The complete genome sequences of BK polyomavirus isolates were downloaded from the public NCBI database. From these records, only isolates with reported complete genomes were used for conservation analysis of splice sites in TAg. The Dunlop strain was used as a reference genome. Isolates “MM” and “FNL-9” were removed due to large deletions in introns or duplications overlapping with receptor splice sites, respectively. The accession numbers of the 245 unique genome sequences are as follows:

[0160] <h2 style=";text-align:left;direction:ltr">AB211369.1; AB211370.1; AB211371.1; AB211372.1; AB211373.1; AB211374.1; AB211375.1; AB211376.1; AB211377.1; AB211378.1; AB211379.1; AB211381.1; AB211382.1; AB211383.1; AB211384.1; AB211385.1; AB211386.1; AB211387.1; AB211388.1; AB211389.1; AB211390.1; AB211391.1; AB213487.1; AB217917.1; AB217918.1; AB217919.1; AB217920.1; AB217921.1; AB260028.1; AB260029.1; AB260030.1; AB260031.1; AB260032.1; AB260033.1; AB263912.1; AB263913.1; AB263914.1; AB263915.1; AB263916.1; AB263917.1; AB263918.1; AB263919.1; AB263920.1; AB263921.1; AB263922.1; AB263923.1; AB263924.1; AB263925.1; AB263926.1; AB263927.1; AB263928.1; AB263929.1; AB263930.1; AB263931.1; AB263932.1; AB263934.1; AB263935.1; AB263936.1; AB263938.1; AB269825.1; AB269826.1; AB269827.1; AB269828.1; AB269829.1; AB269830.1; AB269831.1; AB269832.1; AB269834.1; AB269836.1; AB269837.1; AB269838.1;AB269840.1; AB269841.1; AB269842.1; AB269843.1; AB269844.1; AB269845.1;AB269846.1; AB269847.1; AB269848.1; AB269849.1; AB269850.1; AB269851.1;AB269852.<h2 style=";text-align:left;direction:ltr">1; AB269853.1; AB269854.1; AB269855.1; AB269856.1; AB269857.1;AB269858.1; AB269859.1; AB269860.1; AB269861.1; AB269862.1; AB269863.1;AB269864.1; AB269865.1; AB269866.1; AB269867.1; AB269868.1; AB269869.1;AB298941.1; AB298942.1; AB298945.1; AB298946.1; AB298947.1; AB301086.1;AB301087.1; AB301089.1; AB301090.1; AB301091.1; AB301092.1; AB301093.1;AB301094.1; AB301095.1; AB301096.1; AB301097.1; AB301099.1; AB301100.1;AB301101.1; AB365130.1; AB365132.1; AB365133.1; AB365134.1; AB365136.1;AB365137.1; AB365138.1; AB365139.1; AB365140.1; AB365141.1; AB365142.1; AB365144.1; AB365145.1; AB365146.1; AB365148.1; AB365149.1; AB365150.1; AB365151.1; AB365153.1; AB365154.1; AB365156.1; AB365157.1; AB365158.1; AB365159.1; AB365160.1; AB365162.1; AB365164.1; AB365165.1; AB365166.1;AB365167.1; AB365168.1; AB365170.1; AB365173.1; AB365174.1; AB365175.1; AB365176.1; AB365178.1; AB369087.1; AB369088.1; AB369089.1; AB369090.1; AB369092.1; AB369093.1; AB369094.1; AB369095.1; AB369096.1; AB369097.1; AB369098.1; AB369099.1; AB369101.1; AB464953.1; AB464954.1; AB464956.1; AB485695.1; AB485696.1; AB485697.1; AB485698.1; AB485699.1; AB485700.1; AB485710.1; AB485711.1;AB485712.1; AY628224.1; AY628225.1; AY628226.1; AY628227.1; AY628228.1;AY628229.1; AY628230.1; AY628231.1; AY628232.1; AY628233.1; AY628234.1;AY628235.1; AY628236.1; AY628237.1; AY628238.1; FR720309.1; FR720310.1; FR720311.1; FR720312.1; FR720313.1;FR720315.1; FR720317.1; FR720318.1; FR720320.1; FR720321.1; JF894228.1;JN192431.1; JN192432.1; JN192433.1; JN192435.1; JN192437.1; JN192438.1;JN192439.1; KF055893.1;KP412983.1; KP984526.1; KY114802.1; KY114803.1; KY132094.1; KY487998.1; LC029413.1; LC309239.1; LC309240.1; LT960370.1; M23122.1; V01108.1. .

[0161] Similarly, the complete genome sequences of 13 different prototype human polyomaviruses were downloaded. The accession numbers are as follows:

[0162] NC_001538; NC_001699; NC_009238; NC_009539; NC_010277; NC_014406; NC_014407;

[0163] Conservation of the splice site of the large T antigen

[0164] The whole genome nucleotide sequences from all reference human polyomaviruses were downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / nuccore) on February 20, 2018 and aligned with WebPrank (available online: https: / / www.ebi.ac.uk / goldman-srv / webprank / ) using default settings. A phylogenetic UPGMA tree was constructed and sequence logos were created for each splice site to show conservation among different human polyomaviruses. The accession numbers of all downloaded reference sequences are shown below.

[0165] Reference sequences: NC_001538, NC_001699, NC_009238, NC_009539, NC_010277, NC_014406, NC_014407, NC_014361, NC_015150, NC_018102, NC_020106, NC_020890, NC_024118

[0166] The whole genome nucleotide sequences of all human polyomavirus isolates were downloaded from the NCBI website on February 20, 2018. The whole gene sequences of the large T antigen were retrieved only from the unique genome sequences and aligned with WebPrank using default settings, creating sequence logos for each splice site in the large T antigen to show conservation within and between different human polyomaviruses.

[0167] The accession numbers for all downloads are listed below.

[0168] <h2 style=";text-align:left;direction:ltr">BKPyV: AB211369.1, AB211370.1, AB211371.1, AB211372.1, AB211373.1, AB211374.1, AB211375.1, AB211376.1, AB211377.1, AB211378.1, AB211379.1, AB211380.1, AB211381.1, AB211382.1, AB211383.1, AB211384.1, AB211385.1, AB211386.1, AB211387.1, AB211388.1, AB211389.1, AB211390.1, AB211391.1, AB213487.1, AB217917.1, AB217918.1, AB217919.1, AB217920.1, AB217921.1, AB260028.1, AB260029.1, AB260030.1, AB260031.1, AB260032.1, AB260033.1, AB260034.1, AB263912.1, AB263913.1, AB263914.1, AB263915.1, AB263916.1, AB263917.1, AB263918.1, AB263919.1, AB263920.1, AB263921.1, AB263922.1, AB263923.1, AB263924.1, AB263925.1, AB263926.1, AB263927.1, AB263928.1, AB263929.1, AB263930.1, AB263931.1, AB263932.1, AB263933.1, AB263934.1, AB263935.1, AB263936.1, AB263937.1, AB263938.1, AB269822.1, AB269823.1, AB269824.1, AB269825.1, AB269826.1, AB269827.1, AB269828.1, AB269829.1, AB269830.1, AB269831.1, AB269832.1, AB269833.1, AB269834.1, AB269835.1, AB269836.1, AB269837.1, AB269838.1, AB269839.1, AB269840.1, AB269841.1, AB269842.<h2 style=";text-align:left;direction:ltr">1, AB269843.1, AB269844.1, AB269845.1, AB269846.1, AB269847.1, AB269848.1, AB269849.1, AB269850.1, AB269851.1, AB269852.1, AB269853.1, AB269854.1, AB269855.1, AB269856.1, AB269857.1, AB269858.1, AB269859.1, AB269860.1, AB269861.1, AB269862.1, AB269863.1, AB269864.1, AB269865.1, AB269866.1, AB269867.1, AB269868.1, AB269869.1, AB298940.1, AB298941.1, AB298942.1, AB298943.1, AB298944.1, AB298945.1, AB298946.1, AB298947.1, AB301086.1, AB301087.1, AB301088.1, AB301089.1, AB301090.1, AB301091.1, AB301092.1, AB301093.1, AB301094.1, AB301095.1, AB301096.1, AB301097.1, AB301098.1, AB301099.1, AB301100.1, AB301101.1, AB301102.1, AB301103.1, AB365130.1, AB365131.1, AB365132.1, AB365133.1, AB365134.1, AB365135.1, AB365136.1, AB365137.1, AB365138.1, AB365139.1, AB365140.1, AB365141.1, AB365142.1, AB365143.1, AB365144.1, AB365145.1, AB365146.1, AB365147.1, AB365148.1, AB365149.1, AB365150.1, AB365151.1, AB365152.1, AB365153.1, AB365154.1, AB365155.1, AB365156.1, AB365157.1, AB365158.1, AB365159.1, AB365160.<h2 style=";text-align:left;direction:ltr">1, AB365161.1, AB365162.1, AB365163.1, AB365164.1, AB365165.1, AB365166.1, AB365167.1, AB365168.1, AB365169.1, AB365170.1, AB365171.1, AB365172.1, AB365173.1, AB365174.1, AB365175.1, AB365176.1, AB365177.1, AB365178.1, AB369087.1, AB369088.1, AB369089.1, AB369090.1, AB369091.1, AB369092.1, AB369093.1, AB369094.1, AB369095.1, AB369096.1, AB369097.1, AB369098.1, AB369099.1, AB369100.1, AB369101.1, AB464953.1, AB464954.1, AB464955.1, AB464956.1, AB464957.1, AB464958.1, AB464959.1, AB464960.1, AB464961.1, AB464962.1, AB464963.1, AB485694.1, AB485695.1, AB485696.1,AB485697.1, AB485698, AB485705.1, AB485706.1, AB485707.1, AB485708.1,AB485709.1, AB485710.1, AB485711.1, AB485712.1, AY628224.1, AY628225.1,AY628226.1, AY628227.1, AY628228.1, AY628229.1, AY628230.1, AY628231.1, AY628232.1, AY628233.1, AY628234.1, AY628235.1, AY628236.1, AY628237.1, AY628238.1, DQ305492.1, EF376992.1, FR720308.1, FR720309.1, FR720310.1, FR720311.<h2 style=";text-align:left;direction:ltr">1, FR720312.1, FR720313.1, FR720314.1, FR720315.1, FR720316.1, FR720317.1, FR720318.1, FR720319.1, FR720320.1, FR720321.1, FR720322.1, FR720323.1, JF894228.1, JN192431.1, JN192432.1, JN192433.1, JN192434.1, JN192435.1, JN192436.1, JN192437.1, JN192438.1, JN192439.1, JN192440.1, JN192441.1, JQ713822.1, KF055891.1, KF055892.1, KF055893.1, KP412983.1, KP984526.1, KY114802.1, KY114803.1, KY132094.1, KY487998.1, LC029411.1, LC029412.1, LC029413.1, LC029414.1, LC309239.1, LC309240.1, LT934539.1, LT960370.1, M23122.1, MF627830.1, MF627831.1, V01108.1, V01109.1.<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0169] <h2 style=";text-align:left;direction:ltr">JCPyV: AB038249.1, AB038250.1, AB038251.1, AB038252.1, AB038253.1,AB038254.1, AB038255.1, AB048545.1, AB048546.1, AB048547.1, AB048548.1,AB048549.1, AB048550.1, AB048551.1, AB048552.1, AB048553.1, AB048554.1,AB048555.1, AB048556.1, AB048557.1, AB048558.1, AB048559.1, AB048560.1,AB048561.1, AB048562.1, AB048563.1, AB048564.1, AB048565.1, AB048566.1,AB048567.1, AB048568.1, AB048569.1, AB048570.1, AB048571.1, AB048572.1,AB048573.1, AB048574.1, AB048575.1, AB048576.1, AB048577.1, AB048578.1,AB048579.1, AB048580.1, AB048581.1, AB048582.1, AB074575.1, AB074576.1, AB074577.1, AB074578.1, AB074579.1, AB074580.1, AB074581.1, AB074582.1, AB074583.1, AB074584.1, AB074585.1, AB074586.1, AB074587.1, AB074588.1, AB074589.1, AB074590.1, AB074591.1, AB077855.1, AB077856.1, AB077857.1, AB077858.1, AB077859.1, AB077860.1, AB077861.1, AB077862.1, AB077863.1, AB077864.1, AB077865.1, AB077866.1, AB077867.1, AB077868.1, AB077869.1, AB077870.1, AB077871.1, AB077872.1, AB077873.1, AB077874.1, AB077875.1, AB077876.1, AB077877.1, AB077878.1, AB077879.1, AB081005.1, AB081006.1,AB081007.1, AB081008.1, AB081009.1, AB081010.1, AB081011.1, AB081012.1,AB081013.1, AB081014.1, AB081015.1, AB081016.1, AB081017.1, AB081018.1,AB081019.1, AB081020.1, AB081021.1, AB081022.1, AB081023.1, AB081024.1,AB081025.1, AB081026.1, AB081027.1, AB081028.1, AB081029.1, AB081030.1,AB081600.1, AB081601.1, AB081602.1, AB081603.1, AB081604.1, AB081605.1,AB081606.1, AB081607.1, AB081608.1, AB081609.1, AB081610.1, AB081611.1,AB081612.1, AB081613.1, AB081614.1, AB081615.1, AB081616.1, AB081617.1,AB081618.1, AB081654.1, AB092578.1, AB092579.1, AB092580.1, AB092581.1,AB092582.1, AB092583.1, AB092584.1, AB092585.1, AB092586.1, AB092587.1,AB103387.1, AB103402.1, AB103403.1, AB103404.1, AB103405.1, AB103406.1,AB103407.1, AB103408.1, AB103409.1, AB103410.1, AB103411.1, AB103412.1,AB103413.1, AB103414.1, AB103415.1, AB103416.1, AB103417.1, AB103418.1,AB103419.1, AB103420.1, AB103421.1, AB103422.1, AB103423.1, AB104487.1,AB113118.1, AB113119.1, AB113120.1, AB113121.1, AB113122.1, AB113123.1,AB113124.1, AB113125.1, AB113126.1, AB113127.1, AB113128.1, AB113129.1,AB113130.1, AB113131.1, AB113132.1, AB113133.1, AB113134.1, AB113135.1,AB113136.1, AB113137.1, AB113138.1, AB113139.1, AB113140.1, AB113141.1,AB113142.1, AB113143.1, AB113144.1, AB113145.1, AB113216.1, AB113217.1,AB118231.1, AB118232.1, AB118233.1, AB118234.1, AB118235.1, AB118651.1,AB118652.1, AB118653.1, AB118654.1, AB118655.1, AB118656.1, AB118657.1,AB118658.1, AB118659.1, AB126981.1, AB126982.1, AB126983.1, AB126984.1,AB126985.1, AB126986.1, AB126987.1, AB126988.1, AB126989.1, AB126990.1,AB126991.1, AB126992.1, AB126993.1, AB126994.1, AB126995.1, AB126996.1,AB126997.1, AB126998.1, AB126999.1, AB127000.1, AB127001.1, AB127002.1,AB127003.1, AB127004.1, AB127005.1, AB127006.1, AB127007.1, AB127008.1,AB127009.1, AB127010.1, AB127011.1, AB127012.1, AB127013.1, AB127014.1,AB127015.1, AB127016.1, AB127017.1, AB127018.1, AB127019.1, AB127020.1,AB127021.<h2 style=";text-align:left;direction:ltr">1, AB127022.1, AB127023.1, AB127024.1, AB127025.1, AB127026.1, AB127027.1, AB127342.1, AB127343.2, AB127344.1, AB127345.2, AB127346.1, AB127347.1, AB127348.1, AB127349.1, AB127350.2, AB127351.2, AB127352.1, AB127353.1, AB183152.1, AB195639.1, AB195640.1, AB198940.1, AB198941.1, AB198942.1, AB198943.1, AB198944.1, AB198945.1, AB198946.1, AB198947.1, AB198948.1, AB198949.1, AB198950.1, AB198951.1, AB198952.1, AB198953.1, AB198954.1, AB220939.1, AB220940.1, AB220941.1, AB220942.1, AB220943.1, AB262396.1, AB262397.1, AB262398.1, AB262399.1, AB262400.1, AB262401.1, AB262402.1, AB262403.1, AB262404.1, AB262405.1, AB262406.1, AB262407.1, AB262408.1, AB262409.1, AB262410.1, AB262411.1, AB262412.1, AB262413.1, AB362351.1, AB362352.1, AB362353.1, AB362354.1, AB362355.1, AB362356.1, AB362357.1, AB362358.1, AB362359.1, AB362360.1, AB362361.1, AB362362.1, AB362363.1, AB362364.1, AB362365.1, AB362366.1, AB372036.1, AB372037.1, AB372038.1, AF030085.1, AF295731.1, AF295732.1, AF300945.1, AF300946.1, AF300947.<h2 style=";text-align:left;direction:ltr">1, AF300948.1, AF300949.1, AF300950.1, AF300951.1, AF300952.1, AF300953.1, AF300954.1, AF300955.1, AF300956.1, AF300957.1, AF300958.1, AF300959.1, AF300960.1, AF300961.1, AF300962.1, AF300963.1, AF300964.1, AF300965.1, AF300966.1, AF300967.1, AF363830.1, AF363831.1, AF363832.1, AF363833.1, AF363834.1, AY121907.1, AY121908.1, AY121909.1, AY121910.1, AY121911.1, AY121912.1, AY121913.1, AY121914.1, AY121915.1, AY328376.1, AY342299.1, AY349147.1, AY356539.1, AY364314.1, AY366359.1, AY373463.1, AY376828.1, AY376829.1, AY376830.1, AY376831.1, AY378084.1, AY378085.1, AY378086.1, AY378087.1, AY382184.1, AY382185.1, AY382186.1, AY382187.1, AY382188.1, AY386373.1, AY386374.1, AY386375.1, AY386376.1, AY386377.1, AY386378.1, AY536239.1, AY536240.1, AY536241.1, AY536242.1, AY536243.1, DQ875211.1, DQ875212.1, EU835194.1, JF424834.1, JF424835.1, JF424836.1, JF424837.1, JF424838.1, JF424839.1, JF424840.1, JF424841.1, JF424842.1, JF424843.1, JF424844.1, JF424845.1, JF424846.1, JF424847.1, JF424848.1, JF424849.<h2 style=";text-align:left;direction:ltr">1, JF424850.1, JF424851.1, JF424852.1, JF424853.1, JF424854.1,JF424855.1, JF424856.1, JF424857.1, JF424858.1, JF424859.1, JF424860.1,JF424861.1, JF424862.1, JF424863.1, JF424864.1, JF424865.1, JF424866.1,JF424867.1, JF424868.1, JF424869.1, JF424870.1, JF424871.1, JF424872.1, JF424873.1, JF424874.1, JF424875.1, JF424876.1, JF424877.1, JF424878.1, JF424879.1, JF424880.1, JF424881.1, JF424882.1, JF424883.1, JF424884.1, JF424885.1, JF424886.1, JF424887.1, JF424888.1, JF424889.1, JF424890.1, JF424891.1, JF424892.1, JF424893.1, JF424894.1, JF424895.1, JF424896.1, JF424897.1, JF424898.1, JF424899.1, JF424900.1, JF424901.1, JF424902.1, JF424903.1, JF424904.1, JF424905.1, JF424906.1, JF424907.1, JF424908.1, JF424909.1, JF424910.1, JF424911.1, JF424912.1, JF424913.1, JF424914.1, JF424915.1, JF424916.1, JF424917.1, JF424918.1, JF424919.1, JF424920.1, JF424921.1, JF424922.1, JF424923.1, JF424924.1, JF424925.1, JF424926.1, JF424927.1, JF424928.1, JF424929.1, JF424930.1, JF424931.1, JF424932.1, JF424933.<h2 style=";text-align:left;direction:ltr">1, JF424934.1, JF424935.1, JF424936.1, JF424937.1, JF424938.1, JF424939.1, JF424940.1, JF424941.1, JF424942.1, JF424943.1, JF424944.1, JF424945.1, JF424946.1, JF424947.1, JF424948.1, JF424949.1, JF424950.1, JF424951.1, JF424952.1, JF424953.1, JF424954.1, JF424955.1, JF424956.1, JF424957.1, JF424958.1, JF424959.1, JF424960.1, JF424961.1, JF424962.1, JF425488.1, JF425489.1, JF425490.1, JF425491.1, JF425492.1, JF425493.1, JF425494.1, JF425495.1, JF425496.1, JF425497.1, JF425498.1, JF425499.1, JF425500.1, JF425501.1, JF425502.1, JF425503.1, JF425504.1, JF425551.1, JF425552.1, JF425553.1, JF425554.1, JF425555.1, JF425556.1, JQ237146.1, JQ823124.1, JX273163.1, KJ659286.1, KJ659287.1, KJ659288.1, KJ659289.1, KM225765.1, LC164349.1, LC164350.1, LC164351.1, LC164352.1, LC164353.1,LC164354.1, MF662180.1, MF662181.1, MF662182.1, MF662183.1, MF662184.1,MF662185.1, MF662186.1, MF662187.1, MF662188.1, MF662189.1, MF662190.1,MF662191.1, MF662192.1, MF662193.1, MF662194.1, MF662195.1, MF662196.1,MF662197.1, MF662198.1, MF662199.1, MF662200.1, MF662201.1, MF662202.1,MF662203.1, MF662204.1.

[0170] KIPyV: EF520287.1, EF520288.1, EF520289.1, EU358766.1, EU358767.1,KC571691.1, KM085447.1, KU746835.1

[0171] <h2 style=";text-align:left;direction:ltr">WUPyV: EF444549.1, EF444550.1, EF444551.1, EF444552.1, EF444553.1, EF444554.1, EU296475.1, EU358768.1, EU358769.1, EU711054.1, EU711055.1, EU711056.1, EU711057.1, EU711058.1, FJ794068.1, FJ890981.1, FJ890982.1, GQ926975.1, GQ926976.1, GQ926977.1, GQ926978.1, GQ926979.1, GQ926980.1, GU296361.1, GU296362.1, GU296363.1, GU296364.1, GU296365.1, GU296366.1, GU296367.1, GU296368.1, GU296369.1, GU296370.1, GU296371.1, GU296372.1, GU296373.1, GU296374.1, GU296375.1, GU296376.1, GU296377.1, GU296378.1, GU296379.1, GU296380.1, GU296381.1, GU296382.1, GU296383.1, GU296384.1, GU296385.1, GU296386.1, GU296387.1, GU296388.1, GU296389.1, GU296390.1, GU296391.1, GU296392.1, GU296393.1, GU296394.1, GU296395.1, GU296396.1, GU296397.1, GU296398.1, GU296399.1, GU296400.1, GU296401.1, GU296402.1, GU296403.1, GU296404.1, GU296405.1, GU296406.1, GU296407.1, GU296408.1, HQ218321.1, KC571693.1, KC571694.1, KC571695.1, KC571696.1, KC571697.1, KC571698.1, KC571699.1, KJ643309.1, KJ725028.1, KM265136.1, KU049032.1, KU672381.1, KX650181.1, KX650182.1, KX650184.1, KX650185.1, KX650186.1,KX650187.1, KX650188.1, KX650189.1, KX650190.1, KX650191.1, KX650192.1,KX650193.1.

[0172] MCPyV: EU375803.1, EU375804.1, FJ173815.1, FJ464337.1, HM011538.1,HM011539.1, HM011540.1, HM011541.1, HM011542.1, HM011543.1, HM011544.1,HM011545.1, HM011546.1, HM011547.1, HM011548.1, HM011549.1, HM011550.1,HM011551.1, HM011552.1, HM011553.1, HM011554.1, HM011555.1, HM011556.1,HM011557.1, HM355825.1, JF812999.1, JF813000.1, JF813001.1, JF813002.1,JF813003.1, JN383838.1, JN383839.1, JN383840.1, JN383841.1, JQ479315.1,JQ479316.1, JQ479317.1, JQ479318.1, JQ479319.1, JQ479320.1, JX045708.1,JX045709.1, KC202810.1, KC571692.1, KF266963.1, KF266964.1, KF266965.1,KX781279.1, KX827417.1, NC_010277.2

[0173] HPyV6: HM011558.1, HM011559.1, HM011560.1, HM011561.1, HM011562.1,HM011563.1, KM387421.1, KM655817.1, KR090570.1, KU596573.1, KX379630.1,KX379631.1, KX771234.1

[0174] HPyV7: HM011564.1, HM011565.1, HM011566.1, HM011567.1, HM011568.1, HM011569.1, KJ733012.1, KJ733013.1, KX771235.1

[0175] TSPyV: AB873001.1, JQ723730.1, KF444091.1, KF444092.1, KF444093.1, KF444094.1, KF444095.1, KF444096.1, KF444097.1, KF444098.1, KF444099.1,KF444100.1, KF444101.1, KM007161.1, KM655816.1, KU221329.1, KX249740.1,KX249741.1, KX249742.1, KX249743.1

[0176] HPyV9: HQ696595.1, KC831440.1

[0177] MWPyV: JQ898291.1, JQ898292.1, KC549586.1, KC549587.1, KC549588.1,KC549589.1, KC549590.1, KC549591.1, KC549592.1, KC549593.1, KC549594.1,KC571700.1, KC571701.1, KC571702.1, KC571703.1, KC571704.1, KC571705.1,KC690147.1, KR338953.1

[0178] STLPyV: JX463183.1, JX463184.1, KF525270.1, KF530304.1, KF651951.1, KM893862.1, KR090571.1, NC_020106.1

[0179] HPyV12: JX308829.1, NC_020890.1

[0180] NJPyV: KF954417.1, NC_024118.1

[0181] Splice site conservation and phylogenetic trees

[0182] The full gene sequences (including intronic sequences) of TAg of 13 different polyomavirus reference sequences and all unique BK polyomavirus isolates were aligned using clustalW (“msa” package, R language). Phylogenetic trees were constructed using the UPGMA method (“phangorn” and “ggtree” packages, R language). Sequence logos were constructed for acceptor and donor splice sites to show nucleotide-specific conservation between subtypes (“msa” package, R language).

[0183] AON Design

[0184] Antisense oligonucleotides (AONs) were designed to target splice sites in TAg. The RNA in AONs contains a 2′-OMe modification. AONs are 20 nucleotides in length and have a complete phosphorothioate backbone (*). In in vitro studies, AONs contain a 5′-FAM label. The secondary structure and binding energy of AONs were predicted using RNA structures. All AON sequences are described below:

[0185]

[0186] * indicates a phosphorothioate bond.

[0187] Cell culture

[0188] Immortalized proximal tubule renal epithelial cells HK2 (ATCC ® CRL-2190™) was obtained from ATCC and maintained at 37°C, 5% CO2 in Dulbecco's modified Eagle's medium-F12 (a 1:1 mixture containing 15 mM Hepes, 2.5 mM L-glutamine (Lonza), and supplemented with triiodothyronine, epidermal growth factor (EGF), insulin-transferrin-seleno-ethanolamine (ITS-X), hydrocortisone, and 100 U / mL penicillin-streptomycin). BK polyomavirus (ATCC® VR-837™) was obtained from ATCC and diluted in complete HK2 medium to reduce infectious load. For treatment experiments, cells were cultured at 32,000 cells / cm 2Cells were plated at a density of 50 nM in 6-well or 12-well plates (Corning) and grown overnight. AON treatment was performed by incubating cells with Lipofectamine 3000 (Thermo Fisher) at an AON concentration of 50 nM for 5 hours, after which the Lipofectamine was washed off. 24 hours after washing the cells, BK polyomavirus infection was performed by incubating the cells with medium containing BK polyomavirus for 2 hours, after which the virus was washed off. After washing and collecting supernatants at 3, 5 and 7 days after infection, the production of viral particles was determined by PCR. Viral load samples were collected before infection to determine the infectious load. RNA and protein were harvested on day 7 to determine the expression of TAg and VP1.

[0189] Viral load determination

[0190] To determine the viral load in the culture supernatant, 200 µL was collected from each well at each time point. Pierce Universal Nuclease was added to each sample to degrade unpackaged DNA for 15 minutes at room temperature and then inactivated with 5 mM EDTA. Viral DNA was isolated from the supernatant using a DNA mini kit (Qiagen) and viral load was determined using Taqman PCR as described below (Wunderink, HF, et. al., J. Clin. Virol., 2017).

[0191] To monitor the quality of DNA extraction and potential PCR inhibition, we added a low concentration of P. siliflora virus to the lysis buffer. DNA was eluted in a final volume of 100 μL of elution buffer, of which 10 μL was used as input for real-time quantitative PCR (qPCR). A 90 bp fragment within the BKPyV VP1 gene was amplified using primers 440BKVs 5′-GAAAAGGAGAGT-GTCCAGGG-3′ and 441BKVas 5′-GAACTTCTACTCCTCCTTTTATTAGT-3′ and Taqman probe 576BKV-TQ-FAM FAM 5′-CCAAAAAGCCAAAGGAACCC-3′-BHQ1. BKPyV qPCR and P. siliflora virus PCR were performed in duplicate for DNA quality and potential PCR inhibition monitoring. In addition, BKPyV qPCR was validated to detect BKPyV genotypes I–IV.

[0192] Quantitative PCR reactions were performed in a total volume of 50 μL, containing 25 μL HotStarTaq MasterMix (QIAGEN, Hilden, Germany), 0.5 μmol / L of each primer, 0.35 μmol / L BKPyV probe, and 3.5 mmol / L MgCl2. Reactions were performed using a CFX96 Real-Time Detection System (Bio-Rad, Hercules, CA, USA) with the following cycling conditions: 95°C for 15 min, followed by 45 amplification cycles (95°C for 30 s; 55°C for 30 s; and 72°C for 30 s). Quantification was performed using standard quantitative BKPyV-positive urine samples. The analytical sensitivity of BKPyV qPCR was ∼10 copies / mL. On each plate, three negative controls were included; these controls were negative in all PCR assays. PCR results with a cycle threshold of ≥40 were considered negative.

[0193] Antibodies and western blotting

[0194] Protein concentration was determined by the BCA method. Samples were electrophoresed on 4-15% TGX gels and transferred to nitrocellulose or PVDF membranes. Antibodies used were: rabbit polyclonal anti-actin-HRP (loading control), rabbit polyclonal anti-SV40 VP1 (ab53977, Abcam), mouse monoclonal anti-SV40 T-antigen [PAb416] (ab16879, Abcam), and mouse monoclonal anti-SV40 T-antigen (PAb108, Thermo Fisher). Primary antibodies for TAg and VP1 were incubated overnight at 4°C, and primary antibodies for actin were incubated at room temperature for 30 minutes. Secondary antibodies for TAg and VP1 were goat polyclonal anti-mouse-HRP (P044701-2, Agilent) and goat polyclonal anti-rabbit-HRP (P044801-2, Agilent), respectively. The membrane was incubated with SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Fisher), and protein bands were visualized using the ChemiDoc MP Imaging System (Bio Rad).

[0195] Real-time qPCR

[0196] BK-infected HK2 cells were lysed with Trizol and RNA was isolated using the RNeasy kit (Qiagen). Excess DNA was removed by DNAse I (Qiagen) during the isolation process, and cDNA was synthesized using Promega reverse transcriptase, DTT, dNTPs, and random primers. Real-time PCR was performed on a CFX384 Touch™ Real-Time PCR Detection System (Bio Rad) using SYBR™ Select Master Mix (Thermo Fisher) and the following primers:

[0197]

[0198] result

[0199] Design of BK-targeting antisense oligonucleotides

[0200] Highly effective antisense oligonucleotides (AONs) targeting the BKPyV large T antigen (TAg) must be specific for BKPyV, as they are not specific for host RNA species, while also preferably being as general as possible for other different BKPyV isolates and different polyomaviruses. Compared to dsRNA / ssRNA viruses, dsDNA viruses (in this case polyomaviruses) are characterized by less genetic drift. Nevertheless, there is a large number of BKPyV genotypes and subgenotypes that give rise to a large number of BKPyV serotypes (see phylogenetic tree in Figure 2). Since TAg contains two exons, we first identified genomic sequences at the exon-intron junctions in an attempt to identify AON candidates (see Figure 2). To achieve this, we extracted available unique BKPyV TAg genomic sequences from the NCBI database (n = 245, accession numbers are provided in the Materials and Methods section) and aligned these sequences using ClustalW. Regions describing high sequence similarity (or conservation) were targeted. These studies revealed a high degree of conservation of exon 1 and flanking intronic sequences (see Figure 2). Exon 2 also showed a high degree of sequence conservation. The flanking intronic sequences were rich in T nucleotides and were less conserved within 4 nucleotides from the exon boundary. AONs targeted exon 1 of the BKPyV Tag and the bridge portion of the intronic sequence at exon 1. For exon 2, AONs targeted 4-6 nucleotides of the intronic region of exon 2 and the exon 2 flanking sequence.

[0201] like Figure 3As shown in Figure 2, we selected and designed five AONs targeting BKPyV TAg, of which three targeted the exon 1–intron portion (designated AON #1, #2, and #3), and two AONs targeted the exon 2–intron portion (designated AON #4 and #5). For AONs targeting exon 1 (AON 1-3), the AONs gradually shifted from the main exon to include important intron binding sequences. For the specific sequences and modifications of the backbone and sugar moieties, see Materials and Methods and Figure 3 .

[0202] This design enabled us to specifically target the TAg of BKPyV while being universal to different BKPyV genotypes in renal transplant patients.

[0203] AON-mediated reduction of BKPyV TAg RNA

[0204] We employed Lipofectamine-based AON delivery, which significantly increased AON uptake within 5 hours after transfection. In addition, we titrated the AON dose based on the FAM-labeled cell intensity, reaching a maximum at approximately 50 nM. 24 hours (24h) after AON administration, HK2 cells were infected with BKV virus for 2 hours, after which the cells were washed and cultured for 3, 5, and 7 days. At these time points, RNA was harvested from the cells and qRT-PCR was performed to determine which AONs could affect TAg expression levels. HK2 cells that were not transfected with AONs (untreated) showed similar TAg expression levels to cells treated with disordered AONs (Scr) (data not shown).

[0205] Clearly, a significant proportion of AONs designed to modulate the expression level or splicing of a given target RNA are effective. Our studies using AON #2, #3, or #4 have repeatedly shown significant reductions in TAg RNA levels, typically showing a 5- to 10-fold attenuation of RNA levels for this viral DNA driver (see Figure 4 , left picture).

[0206] BKPyV-infected cultures treated with AONs #2, #3, #4, or #5 repeatedly showed reduced TAg RNA expression levels. This makes the sites targeted by these AONs good targets for reducing BK virus production by reducing TAg production. Notably, this reduction was observed at high MOI settings (i.e., in the range of 100).

[0207] AON-mediated reduction of VP1 RNA and protein

[0208] In cells latently infected with polyomaviruses (e.g., BKV-infected renal proximal tubule cells), low levels of TAg RNA and protein expression are maintained. Viral replication and induction of TAg expression can be observed in individuals with compromised immune systems (either naturally or induced by immunosuppressive regimens) (Hasegawa, M. et. al., Transplantation Proceedings, 2014; Nickeleit, V. et. al., JASN, 2018). Increased TAg levels, as well as interaction with auxiliary transcription factors in the noncoding / promoter regions of the BKV genome, drive BK genome replication and expression of the major capsid protein (late region). Overall, TAg-mediated activation of viral DNA replication and encapsidation by capsid proteins leads to the production of infectious viral particles that can be detected in urine (viruria) and serum (viremia) (Helle, F. et. al., Viruses, 2017).

[0209] To test whether AONs are effective in reducing BKV production, we determined the expression profile of TAg-activated proteins, including VP1. VP1 is the major structural component of the icosahedral viral capsid. This capsid has 72 pentamers, which are linked by VP2 or VP3 in a 5:1 stoichiometry. Therefore, we performed qRT-PCR for VP1 and the results showed that VP1 was expressed at much higher levels per copy of GAPDH than TAg (data not shown). This is consistent with the fact that TAg, together with other transcription factors, induces VP1 mRNA expression. Furthermore, in all studies, our AONs #2, #3, #4, and #5 reduced VP1 RNA expression levels, while significantly reducing VP1 protein (see Figure 5 , right).

[0210] We also tested whether the combination therapy of AON #2 and #4 could more effectively reduce TAg and VP1 RNA levels. The choice of this combination was also based on the fact that the above-mentioned Western blot of VP1 in AON-treated cells ( Figure 5 ) showed that these two AONs caused the strongest loss of VP1 protein. Based on TAg and VP1 mRNA expression levels, this combined treatment did not produce evidence that they were more effective together ( Figure 4 ).

[0211] The observed reduction in VP1 suggests that the TAg splicing-targeted AON is effective. By reducing TAg RNA (and potentially protein expression), the expression levels of BKPyV late region genes and corresponding proteins are reduced. Furthermore, in addition to its role in encapsidating viral DNA, VP1 plays a key mediating role in the infectivity of newly formed viral particles by binding to sialic acids on glycans on the cell surface of neighboring and / or distant cells (Helle, F. et. al., Viruses, 2017). Therefore, the infectivity of BKPyV may be impaired by the reduction (or absence) of VP1 protein.

[0212] TAg splicing-targeted AON reduces BK virus titer

[0213] In parallel with our screening of TAg and VP1 RNA and protein levels (day 7) in HK2 cells pretreated with TAg splicing-targeting AONs, we also assessed viral loads in culture supernatants at days 3, 5, and 7 after BKPyV infection. We determined whether the reduction of VP1 affected the production of encapsulated viral DNA, as reduced TAg expression could affect viral genome replication and VP1 protein production. We measured viral particles in culture supernatants by quantifying encapsulated DNA. To distinguish between encapsulated and non-encapsulated DNA, we applied (endo)nuclease treatment to digest non-encapsulated DNA. Figure 6 As shown, these studies revealed that AON #1 reduced viral DNA levels at day 3, but by day 7, levels had normalized and were similar to those in cells treated with scrambled AONs ( Figure 6 AONs #2, #3, and #4 were characterized by a decrease in viral titer at both time intervals, especially AONs #2, #3, and #4 reduced encapsulated viral DNA by up to 6-fold ( Figure 6 The above combination of AON #2 and #4 only slightly reduced viral load on days 3 and 7 ( Figure 6 ).

[0214] Thus, AON-mediated attenuation of TAg and VP1 RNA and protein results in reduced viral yields.

[0215] Alkyl modification of the 2' position of ribose

[0216] Changing the 2′-position of the ribose sugar on AONs affects their ability to reduce TAg and VP1 RNA and protein levels, as well as BKV DNA production ( Figure 7). The above data are based on 2′-O-methyl (2′-OMe) modification of the ribose sugar on each nucleotide in the antisense oligonucleotide. RNA and protein have been harvested from HK2 cells pretreated with 2′-OMe or 2′-methoxy (2′-MOE) nucleotides (see Figure 7 ).

[0217] TAg splicing-targeting AONs against other polyomaviruses

[0218] In addition to BKV, we have also developed AONs that similarly target JC virus (JCV) TAg. JCV shares 75% sequence similarity with BKV, a level of conservation also observed at the exon 1-intron junction, while the sequence similarity at the intron-exon 2 junction is almost 100% ( Figure 8 ). Therefore, AONs targeting BKV exon 2 can also reduce JCV load. JCV can also infect renal cells (such as proximal tubule cells), which are considered to be a secondary site of infection following initial infection through the tonsils and / or digestive tract. Therefore, the TAg splicing-targeted AONs (especially those targeting the intron-exon 2 splice site) can eliminate the production of both BKV and JCV. In addition, we are generating new AONs targeting the unique JCV exon 1-intron sequence.

[0219] Given that the genomic sequences of the TAg exon 1-intron and intron-exon 2 junctions for all known polyomaviruses have been determined, it is possible to design AONs that affect splicing of all these polyomavirus TAgs ( Fig. 9 ).

[0220] Examples of AONs applicable to other polyomaviruses include Fig. 9 shown.

[0221] Example 2

[0222] Materials and methods

[0223] Phylogenetic conservation of BKV subtypes

[0224] Complete genome sequences of BK polyomavirus isolates were downloaded from the public NCBI database (before September 7, 2018). From these records, only isolates with reported complete genomes were used for analysis. Isolates “MM” and “FNL-9” were removed due to large deletions in introns or duplications overlapping the receptor splice site, respectively. Identical sequences were removed, resulting in 248 unique genome sequences with the following accession numbers:

[0225] <h2 style=";text-align:left;direction:ltr">AB211369, AB211370, AB211371, AB211372, AB211373, AB211374, AB211375, AB211376, AB211377, AB211378, AB211379, AB211381, AB211382, AB211383, AB211384, AB211385, AB211386, AB211387, AB211388, AB211389, AB211390, AB211391, AB213487, AB217917, AB217918, AB217919, AB217920, AB217921, AB260028, AB260029, AB260030, AB260031, AB260032, AB260033, AB263912, AB263913, AB263914, AB263915, AB263916, AB263917, AB263918, AB263919, AB263920, AB263921, AB263922, AB263923, AB263924, AB263925, AB263926, AB263927, AB263928, AB263929, AB263930, AB263931, AB263932, AB263934, AB263935, AB263936, AB263938, AB269825, AB269826, AB269827, AB269828, AB269829, AB269830, AB269831, AB269832, AB269834, AB269836, AB269837, AB269838, AB269840, AB269841, AB269842, AB269843, AB269844, AB269845, AB269846, AB269847, AB269848, AB269849, AB269850, AB269851, AB269852, AB269853, AB269854, AB269855, AB269856, AB269857, AB269858, AB269859, AB269860, AB269861, AB269862, AB269863, AB269864, AB269865, AB269866, AB269867, AB269868, AB269869,<h2 style=";text-align:left;direction:ltr">AB298941, AB298942, AB298945, AB298946, AB298947, AB301086, AB301087, AB301089, AB301090, AB301091, AB301092, AB301093, AB301094, AB301095, AB301096, AB301097, AB301099, AB301100, AB301101, AB365130, AB365132, AB365133, AB365134, AB365136, AB365137, AB365138, AB365139, AB365140, AB365141, AB365142, AB365144, AB365145, AB365146, AB365148, AB365149, AB365150, AB365151, AB365153, AB365154, AB365156, AB365157, AB365158, AB365159, AB365160, AB365162, AB365164, AB365165, AB365166, AB365167, AB365168, AB365170, AB365173, AB365174, AB365175, AB365176, AB365178, AB369087, AB369088, AB369089, AB369090, AB369092, AB369093, AB369094, AB369095, AB369096, AB369097, AB369098, AB369099, AB369101, AB464953, AB464954, AB464956, AB464957, AB464958, AB464960, AB464961, AB464962, AB485695, AB485696, AB485697, AB485698, AB485699, AB485700, AB485701, AB485703, AB485704, AB485707, AB485709, AB485710, AB485711, AB485712, AY628224, AY628225, AY628226, AY628227, AY628228, AY628229, AY628230, AY628231, AY628232, AY628233,AY628234,AY628235, AY628236, AY628237, AY628238, DQ305492, EF376992, FR720308,FR720309, FR720310, FR720311, FR720312, FR720313, FR720315, FR720317,FR720318, FR720320, FR720321, JF894228, JN192431, JN192432, JN192433,JN192435, JN192437, JN192438, JN192439, JN192440, JQ713822, KF055891,KF055892, KF055893, KP412983, KP984526, KY114802, KY114803, KY132094,KY487998, LC029413, LC309239, LC309240, LT960370, M23122, MF358970, MF627830, MF627831, V01108. ,

[0226] Splice site conservation and phylogenetic trees

[0227] The full gene sequence of TAg, including intron sequences, was aligned using Prank (v.140603). Manual adjustments were made to the aligned sequences to adjust for deficiencies when alignments were missing. A phylogenetic tree was constructed using the Neighbor-Joining method (MEGA version 10.0.5) and bootstrapping method (1000 replicates) and the Kimura 2-parameter model. The phylogenetic tree was further visualized in R ("ggtree"), and sequence logos ("ggseqlogo") were constructed for the acceptor splice site and the donor splice site to show nucleotide-specific conservation between subtypes. The subtype of the sequence was determined using the reference sequence described by Zhong et al. (Zhong, J Gen Virol, 2009).

[0228] Oligonucleotide design

[0229] Antisense oligonucleotides were designed as described in Example 1. For in vivo studies, 2'-MOE AON (HYB_01) without a 5' 6-FAM tag was used.

[0230] animal

[0231] Male C57BL6 / J mice aged 6 to 10 weeks were injected intravenously with 40 mg / kg 2′-MOE AON (without 5'6-FAM tag) or saline (weight-corrected, volume +-100uL). Twenty-four hours after AON or saline administration, animals were sacrificed by venipuncture under isoflurane anesthesia. Organs were removed, fixed in formalin and paraffin.

[0232] Cell culture

[0233] Human renal proximal tubular epithelial cells (HK2, ATCC®) were maintained in Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (Gibco) supplemented with 3,3′,5-triiodo-L-thyronine sodium salt (Sigma-Aldrich), insulin-transferrin-seleno-ethanolamine (ITS-X; Sigma-Aldrich), human epidermal growth factor (EGF; Sigma-Aldrich), hydrocortisone (Sigma-Aldrich), and 100 U / mL penicillin-streptomycin (Gibco). Human renal proximal tubular epithelial cells (PTEC, Sciencell Research Laboratories) were maintained in complete REGM™ renal epithelial cell growth medium (Lonza). Primary human astrocytes (Sciencell Research Laboratories) were maintained in complete astrocyte medium (Sciencell Research Laboratories). IPSc-derived astrocytes and oligodendrocytes were maintained in complete BrainPhys™ Neuronal Medium (Stemcell Technologies). All cells were cultured at 37°C, 5% CO2.

[0234] AON treatment and viral infection of cells

[0235] Cells were inoculated and cultured overnight at the desired cell density. Cellular uptake of AON was achieved by culturing cells for 4 h (human astrocytes and iPSc astrocytes / oligodendrocytes, Invitrogen) or 5 h (HK2 and PTEC, Invitrogen) with Lipofectamine 2000 in the presence of 50 nM AON, after which the cells were washed in normal culture medium. As described in Example 1, BKV infection of HK2 epithelial cells or human kidney epithelial cells was performed. JCV infection of astrocytes / oligodendrocytes was achieved by culturing cells overnight in the presence of JC polyomavirus (MAD-4 strain, ATCC® VR-1583™). After infection, cells were thoroughly washed to remove excess viral particles. The culture medium was partially renewed, and supernatant samples were collected at specific time points after infection to study the production of viral particles. Re-infection of cells was performed by taking the supernatant of the wells containing infected cells after treatment. The supernatant was then diluted 2-fold and transferred to new wells containing uninfected, untreated cells for 2 hours, after which the cells were washed extensively. The infected cells were washed with 4% PFA after 7 days.

[0236] Viral load determination

[0237] Viral load determination in culture supernatants was performed as described in Example 1 with the following exceptions. 1) 100 µL of sample was collected from each well at each time point. 2) Unpackaged DNA was degraded using the TURBO DNA-free kit (Invitrogen) prior to isolation.

[0238] Real-time qPCR

[0239] As described in Example 1, RNA isolation, cDNA synthesis and real-time qPCR were performed. However, after RNA isolation, residual DNA was degraded using the TURBO DNA-free kit (Invitrogen). To amplify the T-antigen splice variant, the Phusion® High-Fidelity PCR kit was used with HF buffer and the following primers: forward ATGGAGCTCATGGACCTTTTAGG, reverse TGCAACTCTTGACTATGGGGG. QPCR detection of JC viral RNA was performed using the following primers:

[0240]

[0241] Antibody

[0242] The following primary antibodies were used: rabbit anti-SV40 VP1 (ab53977), mouse anti-SV40 T-antigen (PAb416), mouse anti-SV40 T-antigen (PAb108), rabbit anti-GAPDH (D16H11), biotinylated Lotus japonicus lectin (LTL, B-1325). The rabbit anti-phosphorothioate antibody was kindly provided by Jonathan Watts (UMASS Medical School, MA, USA). The following secondary antibodies were used: goat anti-rabbit Alexa 488 (A11008), goat anti-rabbit Alexa 568 (A11011), goat anti-rabbit HRP (P044801-2) and streptavidin Alexa 532 (S11224).

[0243] Protein quantification Protein lysates were generated by lysing cells in a lysis buffer (pH 7.5) containing 50 mM Tris-HCl, 150 mM NaCl, 1% SDS, 0.5% deoxycholate, 0.5% triton X-100, and protease inhibitors. Sample protein concentrations were determined using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific). Protein expression was quantified using the WesSimple Western automated immunoassay system with a 12-230 kDa separation matrix and an anti-rabbit detection module (ProteinSimple).

[0244] Immunohistochemistry For reinfection experiments, cells were fixed with 4% PFA and permeabilized in PBS containing 0.3% Triton-X / 3% BSA (Merck, Zwijndrecht, the Netherlands) / 1% NGS (Dako, Amstelveen, Netherlands) / 1% FCS for 1 h at room temperature. Primary antibodies were incubated overnight at 4°C in PBS containing 3% BSA / 1% NGS / 1% FCS, after which cells were extensively washed and incubated with secondary antibodies for 1 h at room temperature. Image acquisition and quantification of reinfected cells were performed using the ImageXpress Micro High-Content Imaging System and MetaXpress Software, with a custom module used to identify and count (TAg+) nuclei. Further processing of in vivo images (color deconvolution and thresholding) was performed using ImageJ.

[0245] Mouse organs were embedded in paraffin, sectioned, deparaffinized, rehydrated, and endogenous peroxidase was quenched in 3% H2O2 in methanol for 10 min at room temperature. Antigen retrieval was performed using proteinase K (Agilent, Amstelveen, The Netherlands) for 10 min at room temperature, followed by a blocking step using Background buster (Innovex, Gujarat, India). Slides were washed in TBS / Tween between steps. Primary antibody incubation (anti-phosphorothioate or LTL) was performed in TBS / Tween containing 2% BSA / 5% NGS at 4°C. Secondary antibody incubation was performed for 90 min at room temperature. Nuclei were stained using Hoechst 33258 (Molecular Probes, Leiden, The Netherlands), and slides were mounted using Prolong Gold (Invitrogen). Images were acquired using a Pannoramic MIDI II (3DHISTECH, Budapest, Hungary).

[0246] Next-generation sequencing

[0247] RNA samples from infected, AON-treated HK2 cells were subjected to RNA sequencing using Illumina sequencing technology. Briefly, sample quality was determined using a Fragment Analyzer and samples were processed using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. Sample preparation was performed according to the protocol “NEBNext Ultra II Directional RNA Library Prep Kit for Illumina” (NEB #E7760S / L). Briefly, rRNA was depleted from total RNA using an rRNA depletion kit (NEB #E6310). After fragmentation of the rRNA-reduced RNA, cDNA synthesis was performed. This was used for ligation to sequencing adapters and PCR amplification of the resulting products. The quality and yield after sample preparation were measured with a Fragment Analyzer. The size of the resulting products was consistent with the expected size distribution (broad peaks between 300-500 bp). Cluster analysis and DNA sequencing were performed using NovaSeq6000 according to the manufacturer's protocol. DNA was used at a concentration of 1.1 nM. NovaSeq control software NCS v1.5 was used. Image analysis, base calling, and quality checking were performed using the Illumina data analysis pipeline RTA3.3.5 and Bcl2fastq v2.20.

[0248] The human reference sequence Homo_sapiens.GRCh38.dna.primary_assembly was combined with the viral reference sequence LC029411.1. The combined genome was used for read alignment of each sample. Reads were mapped to the reference sequence using a short read aligner with the Burrows-Wheeler Transform (Tophat v2.0.14) with default settings. The mapping frequency of reads on transcripts was determined using HTSeq v0.6.1p1 based on the mapping positions in the alignment file.

[0249] Using Eventpointer to identify splicing events

[0250] To identify alternative splicing events in NGS data, “Eventpointer” was applied to reads mapped to the viral reference genome. The resulting splicing events were quantified using Kallisto to generate a percent spliced ​​in (PSI) value for each event. For statistical testing, disordered AONs were used as a control condition.

[0251] Pacific Biosciences Long Read Sequencing

[0252] RNA integrity was first assessed on a bioanalyzer. cDNA synthesis was performed using the SMARTer cDNA Synthesis Kit (Takara), and specific large T products were amplified using Kapa HiFi HotStart Ready Mix (Roche). cDNA products were size-selected, and then amplicons from each sample were barcoded using the SMRTbell Barcoded Adapter Complete Prep Kit (PacBio), then pooled in equimolar amounts and sequenced on a PacBio Sequel 1M v3 LR SMRTcell.

[0253] Transcript identification, modification, and annotation were performed using the Pacific Biosciences publicly available Iso-Seq3 bioinformatics pipeline ( ). Reads are first divided into full-length and non-full-length based on the presence of sample-specific barcodes. To find transcript clusters, the isoform-level clustering algorithm (ICE) performs pairwise alignment of full-length reads and duplicate matching to cluster based on likelihood. After ICE, partial reads are added to isoform clusters to increase coverage for the final consensus using the Arrow algorithm. The output from the bioinformatics pipeline is a set of full-length transcript sequences, which can be mapped to a reference sequence to construct an annotation file in GFF format.

[0254] Based on the accuracy of the Arrow algorithm's predicted consistency, transcript sequences with a predicted accuracy of >99% (QVs of the first 100 bp and last 30 bp were excluded due to occasional insufficient coverage for accurate estimates of accuracy) were considered HQ transcripts and used for further analysis. The HQ transcript sequences were mapped back to the reference sequence and filtered for alignment coverage of >99% and alignment identity of >85%. Excess transcripts were collapsed to create the final dataset for this study.

[0255] result

[0256] Development of novel BKV-targeted AONs

[0257] As shown in Figures 10 and 11, in addition to our previous AONs, we also chose to design 9 new AONs targeting BKV TAg, of which 6 targeted the exon 1–intron portion (named HYB_06, _07, _08, _09, _10, and _11), and 2 new AONs targeted the exon 2–intron portion (named HYB_12 and _13). In addition to these 9 new AONs targeting the TAg exon-intron junction, we also tested 2 AONs previously described by Santaris Pharma (WO2012 / 143427A1) that had different compositions relative to our AONs but were complementary to a portion of the exon 1–intron junction (SAN_74) or only a portion of exon 2 (SAN_73). In addition, we also designed and tested an AON that only binds to the coding region of exon 1, namely HYB_14. AONs gradually shifted from major exons to exon 1-targeting AONs (now collectively referred to as (HYB_01, _02, _03, _06, _07, _08, _09, _10, _11)) and exon 2-targeting AONs (HYB _04, _05, _12, and _13) that include significant intron-binding sequences.

[0258] AON-mediated reduction of BKV TAg RNA

[0259] The BKV-targeted AONs showed varying degrees of effectiveness in reducing TAg mRNA levels. Fig.12 and 19 As shown, among the 14 AONs designed to target the exon-intron junctions of TAg, HYB_01, HYB_03, and HYB_11 induced the greatest reduction in TAg mRNA expression, with RNA levels of this viral DNA driver typically attenuated by 8-fold or greater at 7 days post-infection.

[0260] In addition, our data also showed that AONs targeting exon 1-intron junctions were more effective in reducing TAg mRNA levels than AONs targeting exon 2-intron junctions (HYB_04, HYB_05, HYB_12, and HYB_13). Fig.18 and Fig.25 , only HYB_05 clustered with AONs targeting the exon 1-intron junction. Similarly, SAN_73 and SAN_74 proved to be largely ineffective in reducing TAg mRNA expression levels. Notably, these reductions in TAg mRNA were observed at high MOIs (i.e., in the range of 100).

[0261] In addition to HK2 cells, we also tested our BKV-targeted AONs in primary proximal tubule epithelial cells. Based on the significant and consistent reductions in TAg mRNA expression levels observed in HK2 cells using HYB_01, HYB_03, and HYB_11, we chose to proceed with these three at this stage, and refer to these three as our “lead compounds.” Fig.28 As shown, HYB_01, HYB_03, and HYB_11 all significantly reduced the expression of TAg mRNA in hPTEC (n = 3 biological replicates), whereas HYB_14 proved to be ineffective in reducing TAg mRNA levels in hPTEC.

[0262] Interestingly, most of our studies involved AON pretreatment prior to BKV infection. Our preliminary studies, in which we first infected HK2 cells with BKV and then treated the cells with AONs (i.e., HYB_01), showed that our BKV-targeted AONs could effectively inhibit BKV TAg expression in BKV-containing cells 7 days after infection ( Fig.26 , left), and multiple doses after infection may further suppress the expression level of TAg mRNA ( Fig.26 , right).

[0263] AON-mediated reduction of VP1 RNA and protein

[0264] Interestingly, the expression level of VP1 mRNA was decreased by most BKV-targeted AONs, except for HYB_04, HYB_12, HYB_13, and HYB_14 ( Fig.13 and 20 Similar to our results for TAg mRNA, HYB 01, HYB 03, and HYB 11 specifically resulted in a significant decrease in VP1 RNA expression in HK2 cells ( Fig.13 ). In addition, HYB_01 effectively reduced the level of VP1 mRNA regardless of whether AON was administered before or after BK virus infection of HK2 cells ( Fig.26 Importantly, the observed reduction in VP1 mRNA resulted in a significant decrease in VP1 protein levels in HK2 cells ( Figure 14-15 and 21-22). Consistent with our observations on TAg mRNA levels, SAN_73 and SAN_74 had no significant effect on the expression levels of VP1 mRNA and protein.

[0265] like Figure 29-31 As shown, HYB_01, HYB_03, and HYB_11 all significantly reduced VP1 mRNA and protein expression in hPTEC (n = 3 biological replicates). In addition, HYB 14 did not affect VP1 mRNA and protein levels. In addition, we obtained preliminary evidence that our AONs can also effectively reduce VP3 protein levels ( Fig.30 and 32 ).

[0266] Infection and reinfection of human proximal tubule epithelial cells

[0267] We next assessed whether our diverse BKV-targeting AONs would affect the extent of BKV infection and reinfection in HK2 cells. To achieve this, we first treated HK2 cells with BKV-targeting AONs and infected the cells with BKV virus. After 7 days, we collected the supernatant containing viral particles and used it to infect a new batch of untreated HK2 cells. After 7 days, we performed immunofluorescence staining of TAg-infected cells and scored them as a percentage of positivity (nuclei were counterstained with Hoechst). Fig.17 and 24 As shown, these studies showed that cells pre-treated with our BKV-targeted AONs displayed significantly lower levels of reinfection. In contrast, pre-treatment of HK2 cells with SAN_73 and SAN_74 did not reduce reinfection levels to the extent observed with HYB_01, HYB_03, and HYB_11.

[0268] BKV-targeted AONs affect viral particle production

[0269] The observed reduction in VP1 protein, which is required for packaging of BK virus DNA, should have a significant impact on the formation of new virus particles and their release into the supernatant. Fig.16 , 23 As shown in Figures 33 and 44, the vast majority of our BKV-targeted AONs reduced viral particle production 7 days after infection, with HYB_01, HYB_03, and HYB_11 showing the greatest reductions. In contrast, SAN_73 and SAN_74 were found to only slightly reduce viral particle production. This mechanism may be responsible for the reduction in local and distal cell infection (reinfection) in vitro and strongly suggests that uptake of our BKV-targeted AONs by renal proximal tubule epithelial cells after renal transplantation would be an effective therapeutic modality to prevent BKV activation and / or spread.

[0270] BKV-targeted AON regulates TAg splicing

[0271] To gain mechanistic insights into how our BKV-targeted AONs lead to the reduction in TAg and VP1 mRNA described herein, we performed RNA-seq on RNA harvested from HK2 cells treated with scrambled AONs, HYB_01, HYB_03, HYB_11, HYB_14, SAN_73, or SAN_74 followed by infection of the cells with BKV for 2 h. After washing, the cells were cultured for 7 days after which RNA was harvested and assessed for signs of degradation on a bioanalyzer. Subsequently, equal amounts of RNA were deribosylated, library prepared, and then subjected to RNA-seq. Consistent with the reduction in TAg and VP1 mRNA in HK2 cells described above, coverage of the BKV genome from cells treated with scrambled controls, HYB_14, or SAN_73 and SAN_74 was significantly higher than that from those treated with BKV-targeted AONs ( Fig.42 ). To analyze changes in BKV splicing, both the human genome and the BKV genome were provided for sequence alignment, and paired-end reads were aligned using Bowtie.

[0272] To quantify alternative splicing in the samples, EventPointer was applied. Specific GTF files with different viral transcripts were used. The algorithm attempts to identify possible alternative splicing events and associate each transcript with a possible alternative pathway. To assess the splicing of highly complex pre-mRNAs such as TAg, the pre-mRNA was segmented into unique splicing events, resulting in the initial division of the TAg pre-mRNA into seven fragments. At each junction (defined by the frequency of detected splicing events), the percentage splicing (PSI) was determined. This resulted in four unique alternative splicing events that occurred at high frequencies determined by EventPointer in all conditions. The frequencies of these events were scored using Kallisto software to produce a quantitative value for each transcript (in parts per million transcripts). After statistical significance testing, significant splicing changes were observed at the exon 1-intron junction of TAg, which is exactly the site where our AON binds and is predicted to affect splicing ( Fig.35 ). Here, the upper figure provides a schematic diagram of the relevant splicing events in the TAg pre-mRNA, which can then be cleaved into unique splicing events, as shown in the lower figure. For splicing event 1, HYB 01 produced a highly significant modulation in the splicing pattern of the truncated T antigen (P=0.0108), as the alternative splicing acceptor site was preferentially used relative to HK2 cells treated with a scrambled control AON (Z value=2.5484). Similarly, for splicing event 2, a highly significant splicing change was detected (p=0.0149), in which HYB 01 resulted in the preferential production of small t antigen (tAg) rather than TAg (Z value-2.4342). In contrast, no obvious splicing changes were detected in cells treated with HYB_14, SAN_73 or SAN_74. The lack of splicing regulation by SAN_74 is particularly surprising, considering that this AON also bridges the exon 1-intron junction. This strongly suggests that the size of our AONs (20 nt instead of 16 nt in length) plays a role in determining their ability to affect TAg splicing, possibly due to steric hindrance.

[0273] also, Fig.35 The data described in also suggest that regulation of splicing at the exon 1-intron junction (splicing event 2) influences the splicing decision occurring within exon 2 (splicing event 1). Thus, our BKV-targeted AONs appear to trigger a mutually exclusive or complex splicing event downstream of TAg pre-mRNA. These studies are based on biological replicates n=3.

[0274] Evidence supporting that our BKV-targeted AONs mediate changes in TAg splicing was obtained by long-range PCR using the high-fidelity Phusion polymerase. Fig.43 As shown, significant changes in truncated T antigen receptor site usage were observed with HYB_01 and HYB_11 treatment compared to cells treated with scrambled controls ( Fig.35 These data demonstrate that AONs targeting the exon 1-intron junction profoundly affect splicing decisions within exon 2.

[0275] To further understand the splicing-mediated effects of our AONs on BKV TAg, we also employed PacBio sequencing to generate long sequence reads of TAg, where primers binding to the 5´- and 3´-ends of TAg were used to amplify the full-length TAg pre-mRNA. These studies will yield a precise understanding of the accurate usage of individual splice sites within TAg and potential mutually exclusive or complex events shown in our RNA-seq data. RNA degradation was assessed on a bioanalyzer and PCR products were size selected after target enrichment by PCR. cDNA libraries were prepared, ends repaired, adapters ligated, DNA purified and SMRTbellDNA sequenced. Subsequently, subreads were converted to circular consensus reads (insert sequence reads). As Fig.36 As shown, consistent with our RNA-seq data, these studies indicate that AONs targeting the TAg exon 1–intron acceptor affect the usage or proximity of this splice site. Our BKV-targeted AONs (specifically HYB_01) reduced the levels of TAg produced (left panel; left bars), resulting in a shift toward increased levels of small T antigen and unspliced ​​large T antigen (left panel; middle and right bars, respectively). Furthermore, these data provide further support for AON-mediated regulation of truncated T antigen splicing (right panel).

[0276] Of note, the demonstrated efficacy of our BKV-targeted AONs in modulating TAg splicing at the exon 1-intron junction may result in the use of (alternative) cryptic splice donor sites. Potential use of upstream (coding sequence portion of exon 1) or downstream cryptic splice sites (intronic portion before exon 2) may result in mRNAs with shifted reading frames, which often lead to the introduction of premature stop codons. These aberrant transcripts are known to be rapidly degraded in cells via nonsense-mediated decay (Hug, N., et al., Nucleic Acids Research, 2016). Importantly, this rapid processing may prevent us from detecting the majority of these aberrant transcripts.

[0277] However, our quantitative and qualitative analysis of the remaining TAg transcripts clearly demonstrated that our BKV-targeted AONs caused a significant reduction in TAg mRNA levels and simultaneously affected the balance of mRNAs formed by pre-mRNA splicing. These data suggest that dual regulation of TAg expression and splicing is an effective means of attenuating BKV particle production and infectivity.

[0278] In vivo uptake of BKV-targeted AONs

[0279] Our in vitro data are for 2′-O-methyl (2′-OMe)-modified BKV-targeting AONs that have been chemically modified to contain a ribose sugar on each nucleotide of the antisense oligonucleotide. Importantly, a significant improvement in the uptake of the AON in vivo was found if the 2′ hydroxyl group was replaced with a 2′-methoxy (2′-MOE) group. Therefore, we modified HYB_01, our lead compound, to possess both an intact phosphorothioate backbone and a 2′-MOE group and injected this AON into C57BL / 6J mice via the tail vein. 24 hours after injection, the mice were sacrificed and the kidneys, liver, spleen, brain, and muscle were harvested and sectioned. Fig.44 and Fig.45 As shown by immunohistochemical staining in , HYB_01 showed excellent uptake in the renal cortex, especially in the proximal tubule epithelial cells of the kidney (as evidenced by uptake in the LTL-positive cells of the kidney). In addition, HYB_01 was also detectable in Kupffer cells of the liver, but not in the brain (see Fig.45 In addition, AONs were detected in the white pulp of the spleen, minimal AONs were detected in the heart, and no AONs were detected in the muscle (data not shown).

[0280] TAg splicing-targeting AONs against other polyomaviruses

[0281] Although JC virus (JCV) has been shown to infect proximal tubule epithelial cells of the human kidney, we have attempted this multiple times without success. Therefore, we chose to infect other human cells known to be susceptible to JC virus and to play a role in the development of JCV-associated pathophysiology, namely astrocytes. In these studies, we pretreated human induced pluripotent stem cell-derived astrocytes or human primary astrocyte cell lines with one of our five JCV-targeting AONs (Figure 37), HYB_15-19 (at a concentration of 50 nM per AON for 4 hours), and subsequently infected the cells with JCV overnight at a titer of 10 4.5 TCID 50 / 0.2 mL (Information provided by the supplier based on infection of Cos-7 cells 7 days after infection). Fig.38 and39 As shown, consistent with our observation that targeting the exon 1-intron junction of BKV TAg reduced the expression levels of TAg and VP1 mRNA, HYB_15, HYB_16, and HYB_17 led to a significant decrease in the expression levels of JCV TAg and VP1 mRNA in iPS cell-derived astrocytes (n=1). In addition, in primary human astrocytes, we also observed that the expression levels of JCV TAg and VP1 mRNA were significantly reduced under the administration of different titers of JCV ( Fig.40 and 41 ; n=2).

[0282] surface

[0283]

[0284] *From Wikipedia

Claims

1. An antisense oligonucleotide having a length of 12 to 30 nucleobases, comprising a reverse complementary sequence of a continuous stretch of at least 12 nucleobases of a polyomavirus T-antigen precursor mRNA, and the antisense oligonucleotide can modulate the splicing of the T-antigen precursor mRNA in a cell, wherein the antisense oligonucleotide comprises at least 12 consecutive nucleobases of the following sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO:

22. SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO:

27.

2. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide is 17, 18, 19 or 20 to 30 nucleobases in length.

3. An antisense oligonucleotide comprising at least 12 consecutive nucleobases of the following sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27, wherein the at least 12 nucleotides comprise the reverse complementary sequence of the splice donor sequence or the splice acceptor sequence of the large T antigen pre-mRNA of the corresponding polyomavirus.

4. The antisense oligonucleotide according to any one of claims 1 to 3, comprising a modification that renders the mRNA-oligonucleotide duplex resistant to the action of RNase H.

5. The antisense oligonucleotide according to any one of claims 1 to 4, comprising at least one nucleobase having a modified polymer backbone.

6. The antisense oligonucleotide of claim 5, wherein the modified polymer backbone comprises 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'-MOE), 2'-S-constrained ethyl (2'-cEt), locked nucleic acid (LNA), peptide nucleic acid (PNA) or morpholino (PMO) nucleotides.

7. The antisense oligonucleotide according to any one of claims 1 to 6, comprising at least 17 consecutive nucleobases of the following sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27, or comprising at least 17 consecutive nucleobases of the following sequence: SEQ ID NO: : the first or last nucleotide of the continuous stretch.

8. The antisense oligonucleotide of any one of claims 1 to 7, comprising at least 18, 19 or 20 consecutive nucleobases of the following sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: : 27, or at least 18, 19 or 20 consecutive nucleobases of the following sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27, which has one mismatch, and wherein the mismatch is not the first or last nucleotide of the continuous stretch.

9. An antisense oligonucleotide comprising a modification that renders the duplex of the antisense oligonucleotide and a target mRNA resistant to the action of RNase H, wherein the antisense oligonucleotide comprises the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27, which has no mismatches, one or two mismatches.

10. A method for inhibiting the replication of polyomavirus in cells, the method comprising providing the antisense oligonucleotide of any one of claims 1 to 9 to cells infected with the polyomavirus.

11. A method for preparing a graft for transplantation, characterized in that a donor cell has the antisense oligonucleotide according to any one of claims 1 to 9.

12. The method of claim 11, wherein the donor cells are donor kidney cells.

13. Use of an antisense oligonucleotide according to any one of claims 1 to 9 in the preparation of a medicament for treating polyomavirus infection in a subject, wherein the subject is in need of the antisense oligonucleotide.

14. The use according to claim 13, wherein the subject is an immunocompromised subject.

15. The use according to claim 13 or claim 14, wherein the subject is a recipient of a kidney or renal cell transplant.

16. Use of the antisense oligonucleotide according to any one of claims 1 to 9 in the preparation of a medicament for administration to a subject, the medicament being used to hybridize the antisense oligonucleotide with a complementary RNA sequence in a kidney cell of the subject.

17. A method for inhibiting the replication of polyomavirus in cells, the method comprising providing the cells with an antisense oligonucleotide having a length of 12 to 30 nucleotides, the antisense oligonucleotide comprising a reverse complementary sequence of at least 12 nucleobases of a continuous extension of polyomavirus large T antigen precursor mRNA, and the antisense oligonucleotide can regulate the splicing of the large T antigen precursor mRNA.

18. The method according to claim 17, wherein the antisense oligonucleotide is the antisense oligonucleotide of any one of claims 1 to 9.

Images