Compositions and methods for treating non-age-related hearing impairment in human subject

Abstract

Provided herein are compositions comprising a) a first recombinant adeno-associated virus (rAAV) vector genome (vg) comprising a first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising a 5'part of an orthodontic protein gene wherein the expression cassette is flanked by an inverted terminal repeat (ITR); and b) a second rAAV vector genome comprising a second expression cassette comprising a nucleic acid sequence comprising a 3'portion of an orthodontic protein gene wherein the expression cassette is flanked by an ITR wherein the compositions comprise about 4.1 E10-4.1 E12 total vg or about 8.1 E10-8.1 E12 total vg, and the use of these compositions to treat hearing loss in a subject.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 343,991, filed May 19, 2022, which is hereby incorporated by reference in its entirety.

[0003] Sequence Listing

[0004] The contents of the sequence listing submitted electronically in XML format with the application (name: 4833.017PC02_Seqlisting_ST26.xml; size: 816,150 bytes; and creation date: May 17, 2023) are incorporated herein by reference in their entirety. Technical Field

[0005] The present disclosure generally relates to the use of nucleic acids to treat hearing loss in human subjects. Background Art

[0006] The ear is a complex organ, traditionally described as comprising the outer ear, middle ear, inner ear, auditory (hearing) nerve, and auditory system (which processes sound as it travels from the ear to the brain). In addition to detecting sound, the ear also helps maintain balance. Thus, inner ear disorders can lead to hearing loss, tinnitus, vertigo, and loss of balance.

[0007] Hearing loss is one of the most common human sensory deficits and can occur for many reasons. Some people may be born with hearing loss, while others may slowly lose their hearing over time. Presbycusis (also spelled presbyacusis) is age-related hearing loss. About 36 million American adults report some degree of hearing loss, and one-third of people over 60 and half of people over 85 experience hearing loss.

[0008] Hearing loss can be the result of environmental factors or a combination of genetic and environmental factors. About half of all people with tinnitus - the appearance of phantom noises (ringing, humming, chirping, buzzing or hitting sounds) in the auditory system - are also oversensitive / reduced tolerance to certain sound frequencies and volume ranges, known as hyperacusis (also spelled hyperacousis). Environmental causes of hearing loss include certain medications, specific infections before or after birth, and prolonged exposure to loud noises. Hearing loss can be caused by noise affecting specific parts of the ear, ototoxic agents, presbycusis, disease, infection, or cancer.

[0009] Approximately 1.5 out of every 1,000 children are born with profound hearing loss, and another two to three out of every 1,000 children are born with partial hearing loss (Smith et al., 2005, Lancet 365:879-890). More than half of these cases are attributed to a genetic basis (Di Domenico et al., 2011, J. Cell. Physiol. 226:2494-2499).

[0010] Nonsyndromic deafness refers to hearing loss that is not associated with other signs and symptoms. In contrast, syndromic deafness involves hearing loss that occurs along with an abnormality elsewhere in the body. Most cases of hereditary deafness (70% to 80%) are nonsyndromic; the remainder are caused by specific hereditary syndromes.

[0011] Hearing loss can be conductive (originating in the ear canal or middle ear), sensorineural (originating in the inner ear or auditory nerve), or mixed. Most forms of nonsyndromic deafness are associated with permanent hearing loss caused by damage to the structures of the inner ear (sensorineural deafness). In some people, sensorineural hearing loss is caused by abnormalities in the hair cells of the organ of Corti in the cochlea. There are also sensorineural hearing injuries involving the eighth cranial nerve (vestibulocochlear nerve) or the auditory parts of the brain. Most sensorineural hearing losses are attributed to poor hair cell function. Hair cells may be abnormal at birth or they may be damaged during an individual's lifetime. The damage can have both external causes, such as noise trauma and infection, and intrinsic abnormalities, such as congenital mutations in genes that play an important role in cochlear anatomy or physiology.

[0012] Hearing loss caused by changes in the middle ear is called conductive hearing loss. Some forms of nonsyndromic deafness involve changes in both the inner and middle ears, called mixed hearing loss. Hearing loss that is present before a child learns to speak is classified as pre-lingual or congenital. Hearing loss that occurs after speech development is classified as post-lingual. Most autosomal recessive loci cause pre-lingual severe to profound hearing loss.

[0013] Nonsyndromic deafness can have different inheritance patterns and can occur at any age. Types of nonsyndromic deafness are named according to their inheritance pattern. The autosomal dominant form is designated as DFNA, the autosomal recessive form is DFNB, and the X-linked form is DFN. Each type is also numbered in the order in which it is described. For example, DFNA1 is the first described autosomal dominant type of nonsyndromic deafness.

[0014] Auditory neuropathy spectrum disorder (ANSD) is a hearing disorder characterized by normal outer hair cell function and abnormal or absent auditory brainstem responses. It is one of the most common diseases causing hearing and speech communication disorders in infants and young children. Approximately 10% of children with permanent hearing loss may have ANSD. The OTOF gene was the first gene to be identified as an autosomal recessive non-syndromic ANSD gene, and mutations in OTOF have been found to account for approximately 5% of all autosomal recessive non-syndromic hearing loss cases in certain populations (Rodriguez-Ballesteros et al. 2008 Human Mut 29(6):823-831).

[0015] The causes of nonsyndromic deafness are complex. Researchers have identified more than 30 genes that are associated with nonsyndromic deafness when altered; however, some of these genes have not been fully characterized. Different mutations in the same gene may be associated with different types of hearing loss, and some genes are associated with both syndromic and nonsyndromic deafness.

[0016] For example, genes associated with non-syndromic deafness include, but are not limited to, ATP2B2, ACTG1, CDH23, CLDN14, COCH, COL11A2, DFNA5, DFNB31, DFNB59, ESPN, EYA4, GJB3, KCNQ4, LHFPL5, MYO1A, MYO15A, MYO6, MYO7A, OTOF, PCDH15, SLC26A4, STRC, TECTA, TMC1, TMIE, TMPRSS3, TRIOBP, USH1C, and WFS1.

[0017] OTOF-related deafness (DFNB9 nonsyndromic hearing loss) is characterized by two phenotypes: prelingual nonsyndromic hearing loss and, less commonly, temperature-sensitive nonsyndromic auditory neuropathy (TS-NSAN). Another form of progressive hearing loss is associated with otoferlin gene mutations (e.g., I1573T mutation or P1987R mutation, and / or E1700Q mutation) or is not temperature-sensitive.

[0018] Currently, treatment for hearing loss consists of hearing amplification for mild to severe losses and cochlear implants for severe to profound losses (Kral and O'Donoghue, 2010, N. Engl. J. Med. 363: 1438-1450). To date, most research in this area has focused on cochlear hair cell regeneration, which is applicable to the most common forms of hearing loss, including presbycusis, noise damage, infection, and ototoxicity.

[0019] There remains a long felt need for agents and methods for preventing or reversing deafness. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Schematic diagram of the AAVAnc80-hOTOF construct containing two recombinant vectors (AAVAnc80-5′hOTOF and AAVAnc80-3′hOTOF). The upstream DNA genome (AAVAnc80-5′hOTOF) contains a eukaryotic expression cassette encoding the following promoter and regulatory sequences: a cytomegalovirus (CMV) early enhancer element; a chicken beta actin (CBA) gene sequence located between the 5′ flanking region and the proximal region of the second exon; and a 3′ splice sequence derived from the rabbit beta globin (RBG) gene; a human OTOF (hOTOF) coding sequence, exons 1 to 21 (inclusive); a synthetic splice donor (SD); and a 77 base pair (bp) AK recombination sequence. The downstream DNA genome (AAVAnc80-3′hOTOF) contains a eukaryotic expression cassette encoding the following: the same 77-bp AK recombination sequence; a synthetic splice acceptor (SA); a human OTOF (hOTOF) coding sequence, exons 22 to 45 (inclusive) and exon 47, excluding non-coding exon 46; and a bovine growth hormone (bGH) polyadenylation (pA) signal. Each expression cassette is flanked by AAV2 inverted terminal repeats (ITRs). Abbreviations: AK=recombinogenic sequence; bGH=bovine growth hormone; CAG=cytomegalovirus (CMV) early enhancer element, the promoter and first exon of the chicken β-actin (CBA) gene, and a chimeric intron consisting of a splice donor (SD) and the first intron of CBA with a splice acceptor (SA) sequence derived from the rabbit β-globin gene (together they are often referred to as the CAG promoter); ITR=inverted terminal repeat; OTOF=otoferlin gene; pA=polyadenylation signal; SA=splice acceptor; SD=splice donor.

[0021] Figure 2 A perspective view of a device for delivering fluid to the inner ear is shown in accordance with aspects of the present disclosure.

[0022] Figure 3 A side view of a curved needle subassembly is shown according to aspects of the present disclosure.

[0023] Figure 4 A perspective view of a device for delivering fluid to the inner ear is shown in accordance with aspects of the present disclosure.

[0024] Figure 5 A perspective view of a curved needle subassembly coupled to a distal end of a device is shown in accordance with aspects of the present disclosure.

[0025] Figure 6A-6C Wild-type mice ( Fig. 6A ) or administration of vehicle ( Figure 6B ) or AAVAnc80.AKhOTOF5 and AAVAnc80.AKhOTOF3 ( Figure 6C Otof - / - Immunohistochemistry of outer hair cells (OHC) and inner hair cells (IHC) in mice. Myo7a (green) is a marker for inner hair cells. Phalloidin (blue) is a marker for inner and outer hair cells. Otoferlin expression is shown in green. Colocalization of otoferlin and Myo7a in inner hair cells is shown in orange / yellow.

[0026] Figure 7A-7B is the administration vehicle ( Fig. 7A ) or AAVAnc80.AKhOTOF5 and AAVAnc80.AKhOTOF3-Flag( Figure 7B Immunohistochemistry of outer hair cells (OHC) and inner hair cells (IHC) in wild-type non-human primates. Flag is shown in yellow. Wild-type otoferlin expression is shown in pink. Phalloidin (blue) is a marker for inner and outer hair cells.

[0027] Figure 8A-B Figure 2 shows the expression of the expression of the AAVAnc80.AKhOTOF5 and AAVAnc80.AKhOTOF3 at 15, 30, 45 and 60 days after administration of vehicle or AAVAnc80.AKhOTOF5 and AAVAnc80.AKhOTOF3. Fig. 8A ) or 1, 2, 3, 4.5 or 6 months ( Figure 8B Otof - / - Diagram of auditory brainstem responses (ABRs) in mice.

[0028] Figures 9A-9E is a graph showing the biodistribution of otoferrin-Flag in non-human primates administered vehicle, AAVAnc80.AKhOTOF5 and AAVAnc80.AKhOTOF3-Flag or spike-in control. Fig.9A ),liver( Fig. 9B ) and spleen ( Fig. 9C ) in the liver. Fig.9D ) and spleen ( Fig.9E ) in the otoferlin-Flag protein level.

[0029] Figures 10A-10F Figure 2 shows non-human primates administered vehicle or AAVAnc80.AKhOTOF5 and AAVAnc80.AKhOTOF3 ( Figure 10A-10B ) or Otof- / - mice ( Figure 10D-10E) is a graph showing the percentage of inner and outer hair cells that survive. The cochlear regions evaluated were Fig. 10C and Fig.10F shown.

[0030] Figure 11A-11B Figure 2 shows auditory brainstem responses (ABR) of nonhuman primates before and 6 months after intracochlear administration of vehicle or AAVAnc80.AKhOTOF5 and AAVAnc80.AKhOTOF3-Flag ( Fig.11A ) or distortion product otoacoustic emissions (DPOAE) ( Fig. 11B )’s picture. Summary of the invention

[0031] Certain aspects of the present disclosure relate to a composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg) comprising a first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of an otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome comprising a second expression cassette comprising a nucleic acid sequence comprising the 3′ portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition comprises about 4.1E10-4.1E12 total vg or about 8.1E10-8.1E12 total vg.

[0032] In some aspects, the composition comprises about 4.1E10-4.1E12 total vg / cochlea. In some aspects, the composition comprises about 4.1E11 total vg / cochlea. In other aspects, the composition comprises about 8.1E10-8.1E12 total vg / cochlea. In some aspects, the composition comprises about 8.1E11 total vg / cochlea.

[0033] In some aspects, the concentration of the composition comprises about 4.5E11-4.5E13 total vg / mL or about 9E11-9E13 total vg / mL. In some aspects, the concentration of the composition comprises about 4.5E11-4.5E13 total vg / mL. In some aspects, the concentration of the composition comprises about 4.5E12 total vg / mL. In other aspects, the concentration of the composition comprises about 9E11-9E13 total vg / mL. In some aspects, the composition comprises about 9E12 total vg / mL. In some aspects, the composition comprises a first rAAV vector genome and a second rAAV vector genome in a ratio of about 1:1.

[0034] In some aspects, the composition comprises about 4.1E11 total vg. In some aspects, the composition comprises about 8.1E11 total vg.

[0035] Certain aspects of the present disclosure relate to a composition comprising: a) a first rAAV vector genome comprising a first expression cassette comprising a promoter, a first coding sequence encoding an N-terminal portion of otoferlin located 3' to the promoter, and a splice donor signal sequence located 3' to the first coding sequence; and b) a second rAAV vector genome comprising a second expression cassette comprising a splice acceptor signal sequence, a second coding sequence encoding a C-terminal portion of otoferlin located 3' to the splice acceptor signal sequence, and a polyadenylation sequence located 3' to the second coding sequence, wherein the composition is formulated for intracochlear administration.

[0036] In some aspects, the composition comprises one or more pharmaceutically acceptable carriers, diluents, or excipients. In some aspects, the composition is formulated to comprise synthetic perilymph.

[0037] In some aspects, compositions comprises one or more buffers and one or more surfactants. In some aspects, buffer is selected from potassium dihydrogen phosphate, sodium hydrogen phosphate, potassium chloride, sodium chloride, TrisHCl, Tris alkali, histidine, boric acid, citric acid, glycine, HEPES and MOPS. In some aspects, surfactant is selected from poloxamer (poloxamer) 188, labrasol (labrasol), tween (tween), ethanol, pluronic (pluronic) F68 and polyethylene glycol. In some aspects, compositions comprises potassium dihydrogen phosphate, sodium hydrogen phosphate, potassium chloride, sodium chloride and poloxamer 188.

[0038] In some aspects, the formulation comprises: a) about 1.35 mM-1.65 mM potassium dihydrogen phosphate; b) about 7.29 mM-8.91 mM sodium dihydrogen phosphate; c) about 2.43 mM-2.97 mM potassium chloride; d) about 154.8 mM-189.2 mM sodium chloride; and e) about 0.0001%-0.01% poloxamer 188. In some aspects, the formulation comprises: a) about 1.5 mM potassium dihydrogen phosphate; b) about 8.1 mM sodium dihydrogen phosphate; c) about 2.7 mM potassium chloride; d) about 172 mM sodium chloride; and e) about 0.001% poloxamer 188.

[0039] In some aspects, the composition comprises about 4.1E10-8.1E12 total vg / cochlea. In some aspects, the composition comprises about 4.1E10-4.1E12 total vg / cochlea or about 8.1E10-8.1E12 total vg / cochlea. In some aspects, the composition comprises about 4.1E11 total vg / cochlea. In other aspects, the composition comprises about 8.1E11 total vg / cochlea.

[0040] In some aspects, the concentration of the composition comprises about 4.5E11-4.5E13 total vg / mL. In some aspects, the concentration of the composition comprises about 4.5E12 total vg / mL. In other aspects, the concentration of the composition comprises about 9E11-9E13 total vg / mL. In some aspects, the concentration of the composition comprises about 9E12 total vg / mL.

[0041] In some aspects, the composition comprises the first rAAV vector genome and the second rAAV vector genome in about a 1:1 ratio.

[0042] In some aspects, the nucleic acid sequence comprising the 5' portion of the otoferlin gene is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 101. In some aspects, the nucleic acid sequence comprising the 3' portion of the otoferlin gene is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 107.

[0043] In some embodiments, the promoter is selected from a constitutive promoter, an inducible promoter or a tissue-specific promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the constitutive promoter is selected from a CAG, CBA or CMV promoter. In some embodiments, the constitutive promoter is a CAG promoter.

[0044] In some aspects, the first rAAV vector comprises a splice donor site and a recombinogenic sequence. In some aspects, the second rAAV vector comprises a splice acceptor site, a recombinogenic sequence, and a polyadenylation sequence.

[0045] In some aspects, the splice donor site has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 102. In some aspects, the splice acceptor site has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 106.

[0046] In some aspects, the recombinant sequence has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:103.

[0047] In some aspects, the polyadenylation sequence is selected from bovine growth hormone, human growth hormone, mouse-β-globin, mouse-α-globin, polyoma virus, SV40, or a synthetic polyadenylation sequence. In some aspects, the polyadenylation is a bovine growth hormone polyadenylation sequence. In some aspects, the polyadenylation sequence has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 108.

[0048] In some aspects, the ITR is selected from any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43, or Anc80 ITRs. In some aspects, the ITR is an AAV2 ITR.

[0049] In some aspects, the first expression cassette has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:96.

[0050] In some aspects, the second expression cassette has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 105.

[0051] In some aspects, the first and second rAAV vectors are each encapsulated by an AAV capsid. In some aspects, the AAV capsid encapsulating the first rAAV vector is a serotype selected from any one of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43 or Anc80. In some aspects, the AAV capsid encapsulating the second rAAV vector is a serotype selected from any one of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43 or Anc80. In some aspects, the first rAAV vector is encapsulated by an Anc80 capsid and the second rAAV vector is encapsulated by an Anc80 capsid. In some aspects, the Anc80 capsid comprises the polypeptide sequence of SEQ ID NO:109.

[0052] In some aspects, the composition is formulated for intracochlear administration. In some aspects, the composition comprises one or more pharmaceutically acceptable carriers, diluents, or excipients. In some aspects, the composition is formulated to comprise synthetic perilymph.

[0053] In some aspects, compositions comprises one or more buffers and one or more surfactants. In some aspects, buffer is selected from potassium dihydrogen phosphate, sodium hydrogen phosphate, potassium chloride, sodium chloride, TrisHCl, Tris alkali, histidine, boric acid, citric acid, glycine, HEPES and MOPS. In some aspects, surfactant is selected from poloxamer 188, Labasso, Tween, ethanol, Pluronic F68 and polyethylene glycol. In some aspects, compositions comprises potassium dihydrogen phosphate, sodium hydrogen phosphate, potassium fluoride, sodium chloride and poloxamer 188.

[0054] In some aspects, the formulation comprises: a) about 1.35 mM-1.65 mM potassium dihydrogen phosphate; b) about 7.29 mM-8.91 mM sodium dihydrogen phosphate; c) about 2.43 mM-2.97 mM potassium chloride; d) about 154.8 mM-189.2 mM sodium chloride; and e) about 0.0001%-0.01% poloxamer 188. In some aspects, the formulation comprises: a) about 1.5 mM potassium dihydrogen phosphate; b) about 8.1 mM sodium dihydrogen phosphate; c) about 2.7 mM potassium chloride; d) about 172 mM sodium chloride; and e) about 0.001% poloxamer 188.

[0055] Certain aspects of the present disclosure relate to a method of treating hearing loss in a subject having a defective otoferlin gene, comprising administering to the cochlea of ​​the subject a composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg), comprising a first expression cassette, the first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeats (ITRs); and b) a second rAAV vector genome, comprising a second expression cassette, the second expression cassette comprising a nucleic acid sequence comprising the 3′ portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition comprises about 4.1E10-4.1E12 total vg or about 8.1E10-8.1E12 total vg, wherein the first and second rAAV vectors are capable of constituting a polypeptide messenger RNA encoding full-length human otoferlin in the subject.

[0056] In some aspects, the method further comprises, prior to the administering step, determining that the subject has a defective otoferlin gene. In some aspects, the defective otoferlin gene comprises a mutation that results in reduced expression and / or activity of the otoferlin protein encoded by the gene.

[0057] In some aspects, the methods are used to reduce or prevent secondary degeneration of one or more cochlear structures.

[0058] Certain aspects of the present disclosure relate to a method for expressing recombinant full-length otoferlin in a mammalian cell, comprising administering to the mammalian cell a composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg), comprising a first expression cassette, the first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome, comprising a second expression cassette, the second expression cassette comprising a nucleic acid sequence comprising the 3′ portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition comprises about 4.1E10-4.1E12 total vg or about 8.1E10-8.1E12 total vg, wherein the first and second rAAV vectors are capable of constituting a polypeptide messenger RNA encoding full-length human otoferlin in the mammalian cell.

[0059] In some aspects, the mammalian cell is a cochlear cell. In some aspects, the mammalian cell is an inner ear hair cell. In some aspects, the subject is a mammal. In some aspects, the subject is a human.

[0060] In some aspects, the composition is administered in a single dose. In some aspects, the composition is administered in multiple doses. In some aspects, the composition is administered in 2, 3, 4, 5, 6, 7, 8, 9, or 10 doses.

[0061] In some aspects, a single dose comprises about 0.01 mL-0.2 mL. In some aspects, a single dose comprises about 0.09 mL.

[0062] In some aspects, the composition is administered as an injection to the round window membrane. In some aspects, the composition is administered as a single injection. In some aspects, the composition is administered as multiple injections. In some aspects, the composition is administered as 2, 3, 4, 5, 6, 7, 8, 9 or 10 injections.

[0063] In some aspects, the composition is administered using a medical device. In some aspects, the device is such as Figure 2-Figure 5 The device shown. In some aspects, the device is a microcatheter.

[0064] In some aspects, the composition is delivered at a controlled flow rate.

[0065] In some aspects, the subject is between 2 and 17 years old.

[0066] In some aspects, administration of the composition improves the subject's auditory brainstem response (ABR) threshold response, age-appropriate behavioral audiometry, tympanometry, and / or word / sentence recognition testing.

[0067] Certain aspects of the present disclosure relate to a kit comprising a composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg), comprising a first expression cassette, the first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5' portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome, comprising a second expression cassette, the second expression cassette comprising a nucleic acid sequence comprising the 3' portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition is formulated for intracochlear administration. Other aspects of the present disclosure relate to a kit comprising a composition comprising: a) a first rAAV vector genome comprising a first expression cassette comprising a promoter, a first coding sequence encoding an N-terminal portion of otoferlin located 3' to the promoter, and a splice donor signal sequence located 3' to the first coding sequence; and b) a second rAAV vector genome comprising a second expression cassette comprising a splice acceptor signal sequence, a second coding sequence encoding a C-terminal portion of otoferlin located 3' to the splice acceptor signal sequence, and a polyadenylation sequence located 3' to the second coding sequence, wherein the composition is formulated for intracochlear administration.

[0068] In some aspects, the kit further comprises a pre-loaded syringe comprising the composition. In other aspects, the kit further comprises a vial comprising the composition.

[0069] Certain aspects of the present disclosure relate to a composition comprising: a) a first recombinant adeno-associated viral (rAAV) vector genome (vg) comprising a first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5' portion of an otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome comprising a second expression cassette comprising a nucleic acid sequence comprising the 3' portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition comprises approximately 4.1E10-8.1E12 total vg.

[0070] In some aspects, the composition comprises about 4.1E10-4.1E12 total vg or about 8.1E10-8.1E12 total vg. In some aspects, the composition comprises about 4.1E10-4.1E12 total vg. In some aspects, the composition comprises about 4.1E11 total vg. In other aspects, the composition comprises about 8.1E10-8.1E12 total vg. In some aspects, the composition comprises about 8.1E11 total vg.

[0071] In some aspects, the composition comprises about 4.1E10-4.1E12 total vg / cochlea or about 8.1E10-8.1E12 total vg / cochlea. In some aspects, the composition comprises about 4.1E10-4.1E12 total vg / cochlea. In some aspects, the composition comprises about 4.1E11 total vg / cochlea. In other aspects, the composition comprises about 8.1E10-8.1E12 total vg / cochlea. In some aspects, the composition comprises about 8.1E11 total vg / cochlea.

[0072] In some aspects, the concentration of the composition comprises about 4.5E11-4.5E13 total vg / mL. In some aspects, the concentration of the composition comprises about 4.5E12 total vg / mL. In other aspects, the concentration of the composition comprises about 9E11-9E13 total vg / mL. In some aspects, the composition comprises about 9E12 total vg / mL.

[0073] In some aspects, the composition comprises the first rAAV vector genome and the second rAAV vector genome in about a 1:1 ratio.

[0074] Certain aspects of the present disclosure relate to a composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg) comprising a first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5' portion of an otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome comprising a second expression cassette comprising a nucleic acid sequence comprising the 3' portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition is formulated for intracochlear administration.

[0075] In some aspects, the composition comprises one or more pharmaceutically acceptable carriers, diluents, or excipients. In some aspects, the composition is formulated to comprise synthetic perilymph.

[0076] In some aspects, compositions comprises one or more buffers and one or more surfactants. In some aspects, buffer is selected from potassium dihydrogen phosphate, sodium hydrogen phosphate, potassium chloride, sodium chloride, TrisHCl, Tris alkali, histidine, boric acid, citric acid, glycine, HEPES and MOPS. In some aspects, surfactant is selected from poloxamer 188, Labasso, Tween, ethanol, Pluronic F68 and polyethylene glycol. In some aspects, compositions comprises potassium dihydrogen phosphate, sodium hydrogen phosphate, potassium chloride, sodium chloride and poloxamer 188.

[0077] In some aspects, the formulation comprises: a) about 1.35 mM-1.65 mM potassium dihydrogen phosphate; b) about 7.29 mM-8.91 mM sodium dihydrogen phosphate; c) about 2.43 mM-2.97 mM potassium chloride; d) about 154.8 mM-189.2 mM sodium chloride; and e) about 0.0001%-0.01% poloxamer 188. In some aspects, the formulation comprises: a) about 1.5 mM potassium dihydrogen phosphate; b) about 8.1 mM sodium dihydrogen phosphate; c) about 2.7 mM potassium chloride; d) about 172 mM sodium chloride; and e) about 0.001% poloxamer 188.

[0078] In some aspects, the composition comprises about 4.1E10-8.1E12 total vg / cochlea. In some aspects, the composition comprises about 4.1E10-4.1E12 total vg / cochlea or about 8.1E10-8.1E12 total vg / cochlea. In some aspects, the composition comprises about 4.1E11 total vg / cochlea. In other aspects, the composition comprises about 8.1E11 total vg / cochlea.

[0079] In some aspects, the concentration of the composition comprises about 4.5E11-4.5E13 total vg / mL. In some aspects, the concentration of the composition comprises about 4.5E12 total vg / mL. In other aspects, the concentration of the composition comprises about 9E11-9E13 total vg / mL. In some aspects, the concentration of the composition comprises about 9E12 total vg / mL.

[0080] In some aspects, the composition comprises the first rAAV vector genome and the second rAAV vector genome in about a 1:1 ratio.

[0081] In some aspects, the nucleic acid sequence comprising the 5' portion of the otoferlin gene is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 101. In some aspects, the nucleic acid sequence comprising the 3' portion of the otoferlin gene is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 107.

[0082] In some embodiments, the promoter is selected from a constitutive promoter, an inducible promoter or a tissue-specific promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the constitutive promoter is selected from a CAG, CBA or CMV promoter. In some embodiments, the constitutive promoter is a CAG promoter.

[0083] In some aspects, the first rAAV vector comprises a splice donor site and a recombinogenic sequence. In some aspects, the second rAAV vector comprises a splice acceptor site, a recombinogenic sequence, and a polyadenylation sequence.

[0084] In some aspects, the splice donor site has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 102. In some aspects, the splice acceptor site has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 106.

[0085] In some aspects, the recombinant sequence has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:103.

[0086] In some aspects, the polyadenylation sequence is selected from bovine growth hormone, human growth hormone, mouse-β-globin, mouse-α-globin, polyoma virus, SV40, or a synthetic polyadenylation sequence. In some aspects, the polyadenylation is a bovine growth hormone polyadenylation sequence. In some aspects, the polyadenylation sequence has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 108.

[0087] In some aspects, the ITR is selected from any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43, or Anc80 ITRs. In some aspects, the ITR is an AAV2 ITR.

[0088] In some aspects, the first expression cassette has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:96.

[0089] In some aspects, the second expression cassette has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 105.

[0090] In some aspects, the first and second rAAV vectors are each encapsulated by an AAV capsid. In some aspects, the AAV capsid encapsulating the first rAAV vector is a serotype selected from any one of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43 or Anc80. In some aspects, the AAV capsid encapsulating the second rAAV vector is a serotype selected from any one of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43 or Anc80. In some aspects, the first rAAV vector is encapsulated by an Anc80 capsid and the second rAAV vector is encapsulated by an Anc80 capsid. In some aspects, the Anc80 capsid comprises the polypeptide sequence of SEQ ID NO:109.

[0091] In some aspects, the composition is formulated for intracochlear administration. In some aspects, the composition comprises one or more pharmaceutically acceptable carriers, diluents, or excipients. In some aspects, the composition is formulated to comprise synthetic perilymph.

[0092] In some aspects, compositions comprises one or more buffers and one or more surfactants. In some aspects, buffer is selected from potassium dihydrogen phosphate, sodium hydrogen phosphate, potassium chloride, sodium chloride, TrisHCl, Tris alkali, histidine, boric acid, citric acid, glycine, HEPES and MOPS. In some aspects, surfactant is selected from poloxamer 188, Labasso, Tween, ethanol, Pluronic F68 and polyethylene glycol. In some aspects, compositions comprises potassium dihydrogen phosphate, sodium hydrogen phosphate, potassium chloride, sodium chloride and poloxamer 188.

[0093] In some aspects, the formulation comprises: a) about 1.35 mM-1.65 mM potassium dihydrogen phosphate; b) about 7.29 mM-8.91 mM sodium dihydrogen phosphate; c) about 2.43 mM-2.97 mM potassium chloride; d) about 154.8 mM-189.2 mM sodium chloride; and e) about 0.0001%-0.01% poloxamer 188. In some aspects, the formulation comprises: a) about 1.5 mM potassium dihydrogen phosphate; b) about 8.1 mM sodium dihydrogen phosphate; c) about 2.7 mM potassium chloride; d) about 172 mM sodium chloride; and e) about 0.001% poloxamer 188.

[0094] In some aspects, the formulation is a sterile suspension. In some aspects, the formulation comprises sterile water.

[0095] In some aspects, the volume of the formulation is about 0.01 mL to 0.2 mL. In some aspects, the volume of the formulation is about 0.09 mL.

[0096] Certain aspects of the present disclosure relate to a method of treating hearing loss in a subject having a defective otoferlin gene, comprising administering to the cochlea of ​​the subject a composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg), comprising a first expression cassette, the first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeats (ITRs); and b) a second rAAV vector genome, comprising a second expression cassette, the second expression cassette comprising a nucleic acid sequence comprising the 3′ portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition comprises approximately 4.1E10-8.1E12 total vg, wherein the first and second rAAV vectors are capable of constituting a polypeptide messenger RNA encoding full-length human otoferlin in the subject. Other aspects of the present disclosure relate to a method of treating hearing loss in a subject having a defective otoferlin gene, comprising administering to the cochlea of ​​the subject a composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg), comprising a first expression cassette, the first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5' portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeats (ITRs); and b) a second rAAV vector genome, comprising a second expression cassette, the second expression cassette comprising a nucleic acid sequence comprising the 3' portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition is formulated for intracochlear administration, wherein the first and second rAAV vectors are capable of constituting a polypeptide messenger RNA encoding full-length human otoferlin in the subject.

[0097] In some aspects, the defective otoferlin gene comprises a mutation that results in reduced expression and / or activity of an otoferlin protein encoded by the gene. In some aspects, the method further comprises, prior to the administering step, determining that the subject has a defective otoferlin gene.

[0098] Certain aspects of the present disclosure relate to a method for treating hearing loss in a subject having a biallelic otoferlin gene mutation, comprising administering to the cochlea of ​​the subject a composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg), comprising a first expression cassette, the first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeats (ITRs); and b) a second rAAV vector genome, comprising a second expression cassette, the second expression cassette comprising a nucleic acid sequence comprising the 3′ portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition comprises approximately 4.1E10-8.1E12 total vg, wherein the first and second rAAV vectors are capable of constituting a polypeptide messenger RNA encoding full-length human otoferlin in the subject. Other aspects of the present disclosure relate to a method for treating hearing loss in a subject having a biallelic otoferlin gene mutation, comprising administering to the cochlea of ​​the subject a composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg), comprising a first expression cassette, the first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome, comprising a second expression cassette, the second expression cassette comprising a nucleic acid sequence comprising the 3′ portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition is formulated for intracochlear administration, wherein the first and second rAAV vectors are capable of constituting a polypeptide messenger RNA encoding full-length human otoferlin in the subject.

[0099] In some aspects, the method further comprises determining, prior to the administering step, that the subject has a biallelic otoferlin gene mutation.

[0100] In some aspects, the subject has clinical manifestations of bilateral profound sensorineural hearing loss. In some aspects, the subject has clinical manifestations of bilateral profound sensorineural hearing loss when afebrile.

[0101] In some aspects, the methods are used to reduce or prevent secondary degeneration of one or more cochlear structures.In some aspects, the subject has retained distortion product otoacoustic emissions (DPOAEs).

[0102] Certain aspects of the present disclosure relate to a method for expressing recombinant full-length otoferlin in mammalian cells, comprising administering to the mammalian cells a composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg), comprising a first expression cassette, the first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome, comprising a second expression cassette, the second expression cassette comprising a nucleic acid sequence comprising the 3′ portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition comprises approximately 4.1E10-8.1E12 total vg, wherein the first and second rAAV vectors are capable of constituting a polypeptide messenger RNA encoding full-length human otoferlin in the mammalian cell. Other aspects of the present disclosure relate to a method for expressing recombinant full-length otoferlin in mammalian cells, comprising administering to the mammalian cells a composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg), comprising a first expression cassette, the first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome, comprising a second expression cassette, the second expression cassette comprising a nucleic acid sequence comprising the 3′ portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition is formulated for intracochlear administration, wherein the first and second rAAV vectors are capable of constituting a polypeptide messenger RNA encoding full-length human otoferlin in the mammalian cell.

[0103] In some aspects, the mammalian cell is a cochlear cell. In some aspects, the mammalian cell is an inner ear hair cell. In some aspects, the subject is a mammal. In some aspects, the subject is a human.

[0104] In some aspects, the composition is administered in a single dose. In some aspects, the composition is administered in multiple doses. In some aspects, the composition is administered in 2, 3, 4, 5, 6, 7, 8, 9, or 10 doses.

[0105] In some aspects, a single dose comprises about 0.01 mL-0.2 mL. In some aspects, a single dose comprises about 0.09 mL.

[0106] In some aspects, the composition is administered to the round window membrane in the form of an injection. In some aspects, the composition is administered as a single injection. In some aspects, the composition is administered as multiple injections. In some aspects, the composition is administered as 2, 3, 4, 5, 6, 7, 8, 9 or 10 injections.

[0107] In some aspects, the composition is administered using a medical device. In some aspects, the composition is preloaded in the device. In some aspects, the device is such as Figure 2-Figure 5 The device shown. In some aspects, the device is a microcatheter. In some aspects, the microcatheter is shaped so that it can enter the middle ear cavity through the external auditory canal and contact the end of the microcatheter with the round window membrane (RWM). In some aspects, the distal end of the microcatheter includes at least one microneedle with a diameter between 10 microns and 1,000 microns. In some aspects, at least one microneedle includes a curved portion and an angled tip.

[0108] In some aspects, the composition is delivered at a controlled flow rate.

[0109] In some aspects, the subject is between 2 and 17 years old.

[0110] In some aspects, administration of the composition improves the subject's auditory brainstem response (ABR) threshold response, age-appropriate behavioral audiometry, tympanometry, and / or word / sentence recognition testing.

[0111] Certain aspects of the present disclosure relate to a kit comprising a composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg) comprising a first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5' portion of an otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome comprising a second expression cassette comprising a nucleic acid sequence comprising the 3' portion of an otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition comprises approximately 4.1E10-8.1E12 total vg. Other aspects of the present disclosure relate to a kit comprising a composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg), comprising a first expression cassette, the first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5' portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome, comprising a second expression cassette, the second expression cassette comprising a nucleic acid sequence comprising the 3' portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition is formulated for intracochlear administration.

[0112] In some aspects, the composition is preloaded in the device. In some aspects, the device is a microcatheter. In some aspects, the microcatheter is shaped so that it can enter the middle ear cavity via the external auditory canal and contact the end of the microcatheter with the round window membrane (RWM). In some aspects, the distal end of the microcatheter is composed of at least one microneedle with a diameter between 10 microns and 1,000 microns.

[0113] In some aspects, the kit further comprises a device. In some aspects, the device is Figure 2-Figure 5 In some aspects, the device comprises a needle comprising a curved portion and an angled tip.

[0114] In some aspects, the kit further comprises a vial comprising the composition. In some aspects, the vial is a single-use vial. In some aspects, the kit further comprises a second vial comprising a diluent. DETAILED DESCRIPTION

[0115] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0116] The terms "a" and "an" refer to one or more than one (ie, to at least one) of the grammatical object of the article. For example, "an element" encompasses one element and more than one element.

[0117] The term "about" as used herein means approximately, roughly, roughly, or within the range of. When the term "about" is used in conjunction with a numerical range, it modifies the range by extending the upper and lower boundaries of the numerical values ​​set forth. In general, unless otherwise specified, the term "about" as used herein is used to modify the numerical values ​​above and below the stated value by a deviation of 10% above or below (higher or lower).

[0118] The term "recombinant polypeptide" or "recombinant protein" refers to a polypeptide or protein produced using recombinant DNA technology, such as, for example, a polypeptide or protein expressed by a viral vector expression system. The term should also be interpreted as meaning a polypeptide or protein produced by synthesizing a DNA molecule encoding the polypeptide or protein, and the DNA molecule expresses the protein or amino acid sequence of the specified polypeptide, wherein the DNA or amino acid sequence has been obtained using recombinant DNA or amino acid sequence technology available and well known in the art.

[0119] The term "mutation in otoferlin gene" refers to a modification in a wild-type otoferlin gene that results in the production of an otoferlin with one or more of the following compared to the wild-type otoferlin: one or more amino acid deletions, one or more amino acid substitutions, and one or more amino acid insertions, and / or results in a reduction in the expression level of the otoferlin encoded in a mammalian cell compared to the expression level of the otoferlin encoded in a mammalian cell without a mutation. In some aspects, a mutation may result in the production of an otoferlin with one or more amino acid (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acids) deletions. In some aspects, a mutation may result in a frameshift in an otoferlin gene. The term "frameshift" is known in the art to encompass any mutation in a coding sequence that results in a shift in the reading frame of the coding sequence. In some aspects, a frameshift may result in a non-functional protein. In some aspects, a point mutation may be a nonsense mutation (i.e., resulting in an early termination codon in the exon of a gene). Nonsense mutations may result in the production of truncated proteins that may or may not be functional (compared to the corresponding wild-type protein). In some aspects, mutations may result in loss of expression (or reduced levels) of otoferlin mRNA or otoferlin or both mRNA and protein. In some aspects, mutations may result in the production of altered otoferlins that have a loss or reduction in one or more biological activities (functions) compared to the wild-type protein.

[0120] In some aspects, the mutation is the insertion of one or more nucleotides into the otoferlin gene. In some aspects, the mutation is located in the regulatory sequence of the otoferlin gene (i.e., a portion of the non-coding sequence of the gene). In some aspects, the mutation in the regulatory sequence may be in a promoter or enhancer region and prevent or reduce the appropriate transcription of the otoferlin gene.

[0121] Modifications can be introduced into the nucleotide sequence by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis.

[0122] The term "conservative sequence modification" refers to amino acid modifications that do not significantly affect or change the binding characteristics of the antibody or antibody fragment containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into the antibodies or antibody fragments of the present disclosure by standard techniques known in the art such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are amino acid substitutions in which the amino acid residue is replaced by an amino acid residue with a similar side chain. Families of amino acid residues with similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid and glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, and tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, and methionine), beta-branched side chains (e.g., threonine, valine, and isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, and histidine).

[0123] The term "coding" refers to the inherent properties of a specific nucleotide sequence in a polynucleotide, such as a gene, cDNA or mRNA serving as a template for synthesizing a determined amino acid sequence according to a genetic code. Therefore, if transcription and translation of the mRNA corresponding to a gene, cDNA or RNA produces a protein, the gene, cDNA or RNA encodes the protein. Coding strands (whose nucleotide sequence is identical to the mRNA sequence, and is generally provided in a sequence table) and non-coding strands (used as templates for transcription) may be referred to as coded protein products.

[0124] The term "sequence identity" as used herein means the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing sequences. In certain aspects, sequence identity is calculated based on the full length of two given SEQ ID NOs or a portion thereof. Its portion may mean at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% or any other specified percentage of two SEQ ID NOs. Depending on the circumstances, the term "identity" may also mean the degree of sequence relatedness between amino acid or nucleic acid sequences, determined by the match between such sequence strings.

[0125] Unless otherwise indicated, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and thus encode the same amino acid sequence. A nucleotide sequence encoding a protein may also include introns.

[0126] The term "isolated" means altered or removed from the natural state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated", but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated". An isolated nucleic acid or protein may exist in a substantially purified form, or may exist in a non-natural environment, such as, for example, a host cell.

[0127] The term "transfected" or "transformed" or "transduced" refers to the process of transferring or introducing exogenous nucleic acid into a host cell. A "transfected" or "transformed" or "transduced" cell is a cell that has been transfected, transformed or transduced with an exogenous nucleic acid. The cell includes the primary subject cell and its progeny cells.

[0128] The term "expression" refers to the transcription and / or translation of a specific nucleotide sequence driven by a promoter.

[0129] As used herein, "transient" refers to expression of a non-integrated transgene for a period of hours, days, or weeks, wherein the period of expression is less than the period of expression of the gene if integrated into the genome or contained within a stable plasmid replicon in the host cell.

[0130] The term "subject" is intended to include living organisms (e.g., mammals, people) that can cause an immune response. In some respects, the term "subject" is a rodent (e.g., rat or mouse), rabbit, sheep, dog, cat, horse, non-human primate or people. In some respects, the subject suffers from non-syndromic deafness or has the risk of developing non-syndromic deafness. In some respects, the subject has previously been identified as having a sudden change in the otoferlin gene. In some respects, the subject has been identified as having a sudden change in the otoferlin gene and has been diagnosed as suffering from non-syndromic sensorineural hearing loss. In some respects, the subject has been identified as suffering from non-syndromic sensorineural hearing loss.

[0131] As used herein, the term "therapeutic" means to treat. The therapeutic effect is achieved by reducing, inhibiting, alleviating or eliminating the disease state.

[0132] As used herein, the term "prophylaxis" means the preventive or protective treatment of a disease or disease state. "Prevention" herein includes reducing the likelihood that a subject will experience the disease.

[0133] The terms "effective amount" or "therapeutically effective amount" are used interchangeably herein and refer to the amount of a compound, formulation, material, or composition as described herein that is effective to achieve a specific biological outcome. In some aspects, a therapeutically effective amount of a composition may result in an increase in the expression level of active otoferlin (e.g., wild-type, full-length otoferlin, or an otoferlin variant with a desired activity) (e.g., compared to the expression level before treatment with the composition). In some aspects, a therapeutically effective amount of a composition may result in an increase in the expression level of active otoferlin (e.g., wild-type, full-length otoferlin, or an active variant) in a target cell (e.g., an inner hair cell of the cochlea). In some aspects, a therapeutically effective amount of a composition may result in different cellular localizations of active otoferlin (e.g., wild-type, full-length otoferlin, or an active variant) in a target cell (e.g., an inner hair cell of the cochlea). In some aspects, a therapeutically effective amount of the composition can result in an increase in the expression level of active otoferlin (e.g., wild-type, full-length otoferlin, or an active variant), and / or an increase in one or more activities of otoferlin in a target cell (e.g., compared to a reference level, such as the level in a subject before treatment, the level in a subject with a mutation in an otoferlin gene, or the level in a subject or population of subjects with non-syndromic sensorineural hearing loss).

[0134] The term "parenteral" administration of the immune composition includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im) or intrasternal injection or infusion techniques.

[0135] The term "nucleic acid" or "polynucleotide" refers to a polymer of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and single-stranded or double-stranded forms thereof. Unless otherwise specified, the term encompasses nucleic acids containing known natural nucleotide analogs that have binding properties similar to reference nucleotides and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as sequences explicitly specified. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).

[0136] In some aspects of any of the nucleic acids described herein, the nucleic acid is DNA. In some aspects of any of the nucleic acids described herein, the nucleic acid is RNA.

[0137] In the context of the present disclosure, the following abbreviations for common nucleic acid bases are used: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

[0138] As used herein, "in vitro transcribed RNA" refers to RNA, preferably mRNA, that has been synthesized in vitro. Generally, the in vitro transcribed RNA is generated by an in vitro transcription vector. The in vitro transcription vector contains a template for generating in vitro transcribed RNA.

[0139] The terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can comprise a protein sequence or a peptide sequence. A polypeptide includes any peptide or protein that comprises two or more amino acids linked to each other by peptide bonds. As used herein, the term refers to short chains (which are also commonly referred to in the art as, for example, peptides, oligopeptides and oligomers), as well as long chains (which are generally referred to in the art as proteins, of which there are many types). "Polypeptide" includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, and the like. Polypeptides include natural peptides, recombinant peptides, or combinations thereof.

[0140] The term "active otoferlin" means a protein encoded by a DNA that, if replaced with two wild-type alleles encoding full-length otoferlin in an auditory hair cell (e.g., an inner auditory hair cell) of a wild-type mammal, and if expressed in the auditory hair cells of the mammal, results in the mammal having a hearing level close to the normal hearing level of a similar mammal that is completely wild-type. A non-limiting example of an active otoferlin is a full-length otoferlin (e.g., any full-length otoferlin described herein).

[0141] The term "vector" includes any genetic element, such as a plasmid, a phage, a transposon, a cosmid, a chromosome, an artificial chromosome, a virus, a virion, etc., which is capable of replication when combined with appropriate control elements and can transfer gene sequences between cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors. In some aspects, useful vectors contemplated are those in which the nucleic acid segment to be transcribed is under the transcriptional control of a promoter.

[0142] Vectors include all vectors known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses and adeno-associated viruses) incorporating recombinant polynucleotides. The skilled person will be able to select suitable vectors and mammalian cells to prepare any nucleic acid described herein. The vector may, for example, contain sufficient cis-acting elements for expression; other expression elements for expression may be provided by the host mammalian cell or provided in an in vitro expression system.

[0143] "Promoter" refers to a DNA sequence recognized by the synthetic machinery of the cell or introduced synthetic machinery required to initiate specific transcription of a polynucleotide sequence (eg, a gene).

[0144] The term "expression vector", "construct" or "expression cassette" means any type of genetic construct containing a nucleic acid in which part or all of the nucleic acid coding sequence can be transcribed. In some aspects, expression includes transcription of the nucleic acid, for example, to generate a biologically active polypeptide product or inhibitory RNA (e.g., shRNA, miRNA, miRNA inhibitor) from a transcribed gene.

[0145] The terms "operably linked", "operably positioned", "operatively linked", "under control", "under transcriptional control" or "transcriptional control" refer to a functional connection between a regulatory sequence and a heterologous nucleic acid sequence, resulting in the expression of the latter. For example, a first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Operably linked DNA sequences can be contiguous to each other and, for example, as necessary to join two protein coding regions, be in the same reading frame.

[0146] The term "constitutive" promoter refers to a nucleotide sequence that, when operably linked to a protein-encoding nucleic acid (eg, otoferlin), causes RNA to be transcribed from the nucleic acid in a mammalian cell under most or all physiological conditions.

[0147] The term "inducible" promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding a gene product or designated gene product, results in substantial production of the gene product in a cell only when an inducer corresponding to the promoter is present in the cell.

[0148] The term "tissue-specific" promoter refers to a promoter that is active only in certain specific cell types and / or tissues (eg, transcription of a specific gene occurs only in cells that express a transcriptional regulatory protein that binds to the tissue-specific promoter).

[0149] As used herein, "polyadenylation" refers to the covalent attachment of a polyadenylic acid moiety or a modified variant thereof to a messenger RNA molecule. In eukaryotes, most messenger RNA (mRNA) molecules are polyadenylated at the 3' end. The 3' poly (A) tail is a long sequence (usually several hundred) of adenine nucleotides added to the precursor mRNA (pre-mRNA) by the action of an enzyme (polyadenylate polymerase). In higher eukaryotes, the poly (A) tail is added to transcripts containing a specific sequence (polyadenylation signal). The poly (A) tail and the proteins bound thereto help protect the mRNA from exonuclease degradation. Polyadenylation is also important for transcription termination, export of mRNA from the nucleus, and translation.

[0150] After DNA is transcribed into RNA, polyadenylation occurs immediately in the nucleus, but can also occur later in the cytoplasm. After transcription is terminated, the mRNA chain is cleaved by the action of an endonuclease complex associated with RNA polymerase. The cleavage site is usually characterized by the presence of the base sequence AAUAAA near the cleavage site. After the mRNA is cleaved, an adenosine residue is added to the free 3' end at the cleavage site.

[0151] As used herein, "poly(A)", "poly(A) signal sequence", "polyA sequence" or "polyadenylation signal sequence" is a sequence that triggers endonuclease cleavage of mRNA and adds a series of adenosines to the 3' end of the cleaved mRNA.

[0152] As used herein, the term "pharmaceutically acceptable carrier" includes buffers, surfactants, salts, solvents, dispersion media, coatings, antibacterial agents, antifungal agents, and the like that are compatible with pharmaceutical administration. Supplementary active compounds may also be incorporated into any of the compositions described herein.

[0153] As used herein, "carrier" includes any and all buffers, surfactants, salts, solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients may also be incorporated into the composition.

[0154] "Viral genome" or "vector genome" or "viral vector" refers to a sequence comprising one or more polynucleotide regions encoding or comprising a molecule of interest (e.g., a protein, peptide, and polynucleotide or a plurality thereof). Viral vectors are used to deliver genetic material into cells. Viral vectors can be modified for specific applications. In some aspects, the delivery vector comprises a viral vector selected from the group consisting of an adeno-associated virus (AAV) vector, an adenoviral vector, a lentiviral vector, or a retroviral vector.

[0155] As used herein, the term "adeno-associated virus vector" or "AAV vector" refers to any vector that contains or is derived from components of an adeno-associated vector and is suitable for infecting mammalian cells, preferably human cells. The term AAV vector generally refers to an AAV-type viral particle or virion that contains a payload. AAV vectors can be derived from various serotypes, including combinations of serotypes (i.e., "pseudotyped" AAV) or from various genomes (e.g., single-stranded or self-complementary). In addition, AAV vectors can be replication-defective and / or targeted. As used herein, the term "adeno-associated virus" (AAV) includes, but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including type 3A and type 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAVrh8, AAVrh10, AAVrh.74, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, and those AAV serotypes and clades disclosed by Gao et al. (J. Virol. 78:6381 (2004)) and Moris et al. (Virol. 33:375 (2004)), as well as any other AAV. See, e.g., FIELDS et al. VIROLOGY, Vol. 2, Chapter 69 (4th Edition, Lippincott-Raven Publishers). In some aspects, "AAV vectors" include derivatives of known AAV vectors. In some aspects, "AAV vectors" include modified or artificial AAV vectors. The terms "AAV genome" and "AAV vectors" are used interchangeably.

[0156] As used herein, a "recombinant AAV particle" or "rAAV particle" is an AAV virus comprising a capsid protein and an AAV vector having at least one payload region and at least one inverted terminal repeat (ITR) region.

[0157] "Serotypes" of vector or viral capsids are defined by different immunological profiles based on capsid protein sequence and capsid structure.

[0158] The term "ratio" refers to a comparison of two or more numbers that indicates their quantitative relationship to one another. In some aspects, a ratio can be used to compare two parts within a whole or total.

[0159] As used herein, the term "vector ratio" refers to the amount of one AAV vector in a vector genome (vg) compared to the amount of another AAV vector in the vector genome.

[0160] Otoferlin

[0161] The human OTOF gene encodes otoferlin, which is a protein that plays a key role in priming, fusing and / or replenishing synaptic vesicles at inner hair cell synapses during sound encoding. To date, hundreds of mutations in the human OTOF gene have been identified to cause extreme prelingual deafness DFNB9. In different populations, such mutations are the cause of deafness in 2%-8% of people born with autosomal, recessive, non-syndromic deafness (Rodriguez-Ballesteros et al. (2008) Hum. Mutat. 29 823-831; Choi et al. (2009) C1inical Genetics 75 237-243; Duman et al. (2011) Genet Test Mol Biomarkers 1529-33; Varga et al. (2006) J Med Genet 43 576-581; Iwasa et al. (2013) BMC Med.Genet.1495. Biallelic mutations in the otoferlin gene result in defects in localized synaptic transmission between hair cells and the auditory nerve. Otoferlin enables sensory cells to release neurotransmitters in response to sound stimuli to activate auditory neurons, and these neurons transmit electrically encoded auditory information to the brain to produce "hearing." When biallelic mutations are present in OTOF, this transmission is impaired, and as a result, most subjects suffer from congenital, bilateral severe to profound sensorineural hearing loss. For example, preservation of otoferlin Two substitutions in exon 15 at positions 490 and 515 in the C2C domain lead to DFNB9 (Mirqhomizadeh et al. (2002) Neurobiol. Dis. 10(2): 157-164). Migliosi et al. found a novel mutation Q829X in OTOF in a Spanish patient with prelingual nonsyndromic hearing loss (Migliosi et al. (2002) J. Med. Genet. 39(7): 502-506).

[0162] Other exemplary mutations in the otoferlin gene detected in subjects with hearing loss and methods for sequencing nucleic acids encoding otoferlin are described in, e.g., Rodriguez-Ballesteros et al. (2003) Hum Mutat. 22:451-456; Wang et al. (2010) BMC Med Genet. 11:79; Yildirim-Baylan et al. (2014) Int. J. Pediatr. Otorhinolaryngol 78:950-953; Choi et al. (2009) Clin. Genet. 75(3):237-243; and Marlin et al. (2010) Biochem Biophys Res Commun 394:737-742.

[0163] Otoacoustic emissions (e.g., distortion product otoacoustic emissions (DPOAEs)) are normal in DFNB9 subjects for at least the first decade of life, indicating morphological integrity of the inner ear and proper function of outer hair cells. Thus, in some aspects, the subjects have preserved DPOAEs. In addition to the lack of synaptic transmission and subsequent synaptic loss, the morphology and physiology of the inner ear remain preserved in DFNB9 during at least the first decade of human life. Thus, in some aspects, restoration of OTOF and / or otoferlin function can be used to mitigate or prevent secondary degeneration of one or more cochlear structures.

[0164] The study of mouse model shows that synapse is normal in structure, and IHC retains normal synapse number in mouse in the first week after birth. Between P6 and P15, about half of the synapse is lost (Roux et al. (2006) Cell 127277-289). Animal model allows to study the influence of mutation in otoferlin on synaptic transmission by recording the change of plasma membrane capacitance and auditory nerve activity after vesicle fusion. In otoferlin knockout (Otof- / -) mice, Ca2+ induced by depolarization flows into voltage-gated Ca2+ channels, and exocytosis is almost not triggered in IHC (Roux et al. (2006) Cell 127277-289). In profoundly hearing-impaired pachanga (OtofPga / Pga) mice with random point mutations in the C2F domain, short (<10 ms) depolarization of IHCs induced fusion of vesicles of similar size to wild-type mice, whereas sustained stimulation revealed a severe defect in recruiting vesicles to the readily releasable pool (Pangrsic et al. (2010) Nat. Neurosci. 13869-876). The p.Ile515Thr mutation was found in human subjects with only slightly elevated hearing thresholds but severely reduced speech comprehension and temperature-dependent deafness (Varga et al. (2006) J Med Genet 43576-581), and an intermediate phenotype was found when studied in mouse models (Strenzke et al. (2016) EMBO J. 35:2519-2535). Humans with biallelic pI1515Thr mutations have been shown to experience worsening hearing loss during fever, while recovering pre-fever hearing function in the absence of fever (Varga et al. (2006) J Med Genet 43576-581). OtofI515T / I515T mice showed a moderate elevation in hearing threshold with reduced wave I amplitude when assessed by ABR, but normal hearing thresholds in behavioral tests and single auditory nerve unit recordings. Exocytosis of the RRP was again intact, but sustained exocytosis was reduced, although not as severe as in OtofPga / Pga. At room temperature in wild-type mice, 750 vesicles can fuse per second per active zone during sustained stimulation, a rate that drops to 350 vesicles / second / active zone in Otof515T / I515T mice and to 200 vesicles / second / active zone in OtofPga / Pga IHCs (Pangrsic et al. (2010) Nat. Neurosci. 13 869-876; Strenzke et al. (2016) EMBO J. 35 2519-2535).This correlated with lower otoferlin levels at the plasma membrane of IHCs, indicating that the amount of otoferlin is proportional to exocytosis and hearing (Strenzke et al. (2016) EMBO J. 352519-2535).

[0165] Methods for detecting mutations in genes are well known in the art. Non-limiting examples of such techniques include: real-time polymerase chain reaction (RT-PCR), PCR, sequencing, Southern blotting and Northern blotting.

[0166] The OTOF gene encodes otoferlin, a protein involved in synaptic vesicle exocytosis in cochlear hair cells (see, e.g., Johnson and Hapman (2010) J. Cell Biol. 191(1): 187-198; and Heidrych et al. (2008) Hum. Mol. Genet. 17: 3814-3821).

[0167] The human OTOF gene is located on chromosome 2p23.3. It contains 48 exons, covering about 132 kilobases (kb) (NCBI accession number NG009937.1). The mRNA encoding the long form of otoferlin expressed in the brain contains 48 exons (Yasunaga et al., Am. J. Hum. Genet. 67: 591-600, 2000). Yasunaga et al., Am. J. Hum. Genet. 67: 591-600, 2000, Table 2 describes forward and reverse primers that can be used to amplify each of the 48 exons in the OTOF gene. In some instances, the full-length OTOF protein is a full-length wild-type OTOF protein. The length of the full-length wild-type OTOF protein expressed from the human OTOF gene is 1997 residues.

[0168] Exemplary human wild-type otoferlin is or includes the sequence of any one of SEQ ID NOs: 1-5. Isoform e of human otoferlin (SEQ ID NO: 5) is encoded by mRNA comprising exon 48 but not exon 47 of the otoferlin gene (Yasunaga et al., Am. J. Hum. Genet. 67: 591-600, 2000). In some aspects, active otoferlin has the sequence of SEQ ID NO: 5, but lacks 20 amino acids including the RXR motif identified in Strenzke et al., EMBO J. 35 (23): 2499-2615, 2016. Non-limiting examples of nucleic acids encoding wild-type otoferlin are or include any one of SEQ ID NOs: 7-11. As can be understood in the art, at least some or all of the codons in SEQ ID NOs: 7-11 can be codon-optimized to allow optimal expression in non-human mammals or humans. Orthologs of human otoferlin are known in the art.

[0169] Human otoferlin cDNA sequence:

[0170] Human canonical (long) isoform sequence (otoferlin) (SEQ ID NO: 1) (also known as otoferlin isoform a) (NCBI accession number AAD26117.1)

[0171] Human isoform 2 (short 1) (otoferlin) (SEQ ID NO: 2) (also known as otoferlin isoform d) (NCBI Accession No. NP_919304.1)

[0172] Human isoform 3 (short 2) (otoferlin) (SEQ ID NO: 3) (also known as otoferlin isoform c) (NCBI Accession No. NP_919303.1)

[0173] Human isoform 4 (short 3) (otoferlin) (SEQ ID NO: 4) (also known as otoferlin isoform b) (NCBI Accession No. NP_004793.2)

[0174] Human isoform 5 (short 4) (otoferlin) (SEQ ID NO: 5) (also known as otoferlin isoform e) (NCBI Accession No. NP_001274418.1)

[0175] Complete cds (Otoferlin cDNA) (www.ncbi.nlm.nih.gov / nuccore / AF107403.1) (SEQ ID NO: 6) (encoding the protein of SEQ ID NO: 1)

[0176] Human otoferlin transcript variant 1

[0177] (www.ncbi.nlm.nih.gov / nuccore / NM_194248.2) (SEQ ID NO: 7) (encoding protein of SEQ ID NO: 1)

[0178] Human otoferlin transcript variant 2

[0179] (www.ncbi.nlm.nih.gov / nuccore / NM_004802.3) (SEQ ID NO: 8) (encoding protein of SEQ ID NO: 4)

[0180] Human otoferlin transcript variant 3

[0181] (www.ncbi.nlm.nih.gov / nuccore / NM_194322.2) (SEQ ID NO: 9) (encoding protein of SEQ ID NO: 3)

[0182] Human otoferlin transcript variant 4

[0183] (www.ncbi.nlm.nih.gov / nuccore / NM_194323.2) (SEQ ID NO: 10) (encoding protein of SEQ ID NO: 2)

[0184] Human otoferlin transcript variant 5

[0185] (www.ncbi.nlm.nih.gov / nuccore / NM_001287489.1) (SEQ ID NO: 11) (encoding protein of SEQ ID NO: 5)

[0186] A non-limiting example of a human wild-type otoferlin genomic DNA sequence is SEQ ID NO: 12. The exons in SEQ ID NO: 12 are: nucleotide positions 5001-5206 (exon 1), nucleotide positions 25925-25983 (exon 2), nucleotide positions 35779-35867 (exon 3), nucleotide positions 44590-44689 (exon 4), nucleotide positions 47100-47281 (exon 5), nucleotide positions 59854-59927 (exon 6), nucleotide positions 61273-61399 (exon 7), nucleotide positions 61891-61945 (exon 8), nucleotide positions 68626-68757 (exon 9), nucleotide positions 73959-74021 (exon 10). exon 10), nucleotide positions 74404-74488 (exon 11), nucleotide positions 79066-79225 (exon 12), nucleotide positions 80051-80237 (exon 13), nucleotide positions 81107-81293 (exon 14), nucleotide positions 82690-82913 (exon 15), nucleotide positions 83388-83496 (exon 16), nucleotide positions 84046-84226 (exon 17), nucleotide positions 84315-84435 (exon 18), nucleotide positions 85950-86050 (exon 19), nucleotide positions 86193- 86283 (exon 20), nucleotide positions 86411-86527 (exon 21), nucleotide positions 86656-86808 (exon 22), nucleotide positions 87382-87571 (exon 23), nucleotide positions 87661-87785 (exon 24), nucleotide positions 88206-88340 (exon 25), nucleotide positions 89025-89186 (exon 26), nucleotide positions 89589-89708 (exon 27), nucleotide positions 90132-90293 (exon 28), nucleotide positions 90405-90567 (exon 29), nucleotide positions 91050-91180 (exon 30), nucleotide position 92549-92578 (exon 31), nucleotide position 92978-93106 (exon 32), nucleotide position 95225-95291 (exon 33), nucleotide position 96198-96334 (exon 34), nucleotide position 96466-96600 (exon 35), nucleotide position 96848-96985 (exon 36), nucleotide position 97623-97750 (exon 37), nucleotide position 97857-98027 (exon 38), nucleotide position 98670-98830 (exon 39),Nucleotide positions 99593-99735 (exon 40), nucleotide positions 100128-100216 (exon 41), nucleotide positions 101518-101616 (exon 42), nucleotide positions 101762-102003 (exon 43), nucleotide positions 102669-102847 (exon 44), nucleotide positions 102952-103052 (exon 45), nucleotide positions 103494-103691 (exon 46), nucleotide positions 105479-106496 (exon 47), and exon 48 (sequence beginning with CCGGCCCGAC; see also Yasunaga et al., Am. J. Hum. Genet. 67:591-600, 2000 for a description of this exon).

[0187] Introns are located between each adjacent exon pair in SEQ ID NO: 12, i.e., at nucleotide positions 100-5001 (intron 1), nucleotides 5207-25924 (intron 2), nucleotide positions 25984-35778 (intron 3), nucleotide positions 35868-44589 (intron 4), nucleotide positions 44690-47099 (intron 5), nucleotide positions 47282-59853 (intron 6), nucleotide positions 59928-61272 (intron 7), nucleotide positions 61400-61890 (intron 8), nucleotide positions 61946-68625 (intron 9), nucleotide positions 68758-73958 (intron 10). Nucleotide positions 74022-74403 (intron 11), nucleotide positions 74489-79065 (intron 12), nucleotide positions 79226-80050 (intron 13), nucleotide positions 80238-81106 (intron 14), nucleotide positions 81294-82689 (intron 15), nucleotide positions 82914-83387 (intron 16), nucleotide positions 83497-84045 (intron 17), nucleotide positions 84227-84314 (intron 18), nucleotide positions 84436-85949 (intron 19), nucleotide positions 86051-86192 (intron 20), nucleotide positions 86192-86237 (intron 21), nucleotide positions 86193-86238 (intron 22), nucleotide positions 86194-86239 (intron 23), nucleotide positions 86195-86239 (intron 24), nucleotide positions 86196-86237 (intron 25), nucleotide positions 86197-86238 (intron 26), nucleotide positions 86198-86239 (intron 27), nucleotide positions 86199-86239 (intron 28), nucleotide positions 86194-86238 (intron 29), nucleotide positions 86197-86239 (intron 29), nucleotide positions 86198-86239 (intron 29), nucleotide positions 86199-86239 (intron 2 20), nucleotide position 86284-86410 (intron 21), nucleotide position 86528-86655 (intron 22), nucleotide position 86809-87381 (intron 23), nucleotide position 87572-87660 (intron 24), nucleotide position 87786-88205 (intron 25), nucleotide position 88341-89024 (intron 26), nucleotide position 89187-89588 (intron 27), nucleotide position 89709-90131 (intron 28), nucleotide position 90294-90404 (intron 29), nucleotide position 90568-91049 (intron 30 )、nucleotide position 91181-92548 (intron 31)、nucleotide position 92579-92977 (intron 32)、nucleotide position 93107-95224 (intron 33)、nucleotide position 95292-96197 (intron 34)、nucleotide position 96335-96465 (intron 35)、nucleotide position 96601-96847 (intron 36)、nucleotide position 96986-97622 (intron 37)、nucleotide position 97751-97856 (intron 38)、nucleotide position 98028-98669 (intron 39)、nucleotide position 98831-99592 (intron 40)、Nucleotide positions 99736-100127 (intron 41), nucleotide positions 100217-101517 (intron 42), nucleotide positions 101617-101761 (intron 43), nucleotide positions 102004-102668 (intron 44), nucleotide positions 102848-102951 (intron 45), nucleotide positions 103053-103494 (intron 46), nucleotide positions 103692-105478 (intron 47), and nucleotide positions 106497-108496 (intron 48).

[0188] In some aspects, the otoferlin gene can be split into two or more segments between or within any appropriate exons and / or introns, wherein each segment is contained in a different vector of the present disclosure. In some aspects, the otoferlin gene is split at exon 21, i.e., exons 1 to (to) 21 are in the first vector and exons 22 to (to) 48 are in the second vector. In some such aspects, the otoferlin segments in the first and second vectors are derived from the otoferlin cDNA sequence and lack introns, i.e., exons 1 to (to) 21 are in the first vector and exons 22 to (to) 48 are in the second vector, each vector lacking an otoferlin intron. In some aspects, the otoferlin gene can be split at one or more other exons and / or introns, as long as the packaging capacity of the vector is not exceeded when combined with all other components of the vector.

[0189] Human otoferlin gene sequence (ncbi.nlm.nih.gov / nuccore / 224465243) (SEQ ID NO: 12)

[0190] Mouse otoferlin (SEQ ID NO: 13) (NCBI accession number NP_001300696.1)

[0191] Mouse otoferlin cDNA (SEQ ID NO: 14) (NCBI accession number NM_001313767.1)

[0192] Mouse otoferlin gene sequence (www.ncbi.nlm.nih.gov / gene / 83762) (SEQ ID NO: 15) Accession number: NC_000071 region: complementary sequence (30367066..30462730) GPC_000000778; NCBI reference sequence: NC_000071.6

[0193] Zebrafish otoferlin gene sequence (www.ncbi.nlm.nih.gov / gene / 557476) (SEQ ID NO: 16) Accession No. NC_007131 Region: 31173357..31310109GPC_000001574

[0194] NCBI reference sequence: NC_007131.7

[0195] Rhesus monkey otoferlin gene sequence

[0196] (www.ncbi.nlm.nih.gov / gene / 696717) (SEQ ID NO: 17) Accession No. NC_027905 Region: complementary sequence (26723411..26826586) GPC_000002105 NCBI reference sequence: NC_027905.1

[0197] Dog otoferlin gene sequence (www.ncbi.nlm.nih.gov / gene / 607961) (SEQ ID NO: 18)

[0198] Accession number NC_006599 region: complementary sequence (20518502..20619461) GPC_000000676 NCBI reference sequence: NC_006599.3

[0199] Chimpanzee otoferlin gene sequence (www.ncbi.nlm.nih.gov / gene / 459083) (SEQ ID NO: 19) Accession number NC_006469 Region: complementary sequence (27006052..27107747) GPC_000002338 NCBI reference sequence: NC_006469.4

[0200] Rat otoferlin (SEQ ID NO: 20)

[0201] Zebrafish otoferlin (SEQ ID NO: 21)

[0202] Otoferlin (SEQ ID NO: 22)

[0203] Baboon otoferlin (SEQ ID NO: 23)

[0204] In some aspects, the first vector comprises a 5' portion of an OTOF cDNA having a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 94. In some aspects, the first vector comprises a 5' portion of an OTOF cDNA having a sequence of SEQ ID NO: 94.

[0205] In some aspects, the second vector comprises a 3' portion of an OTOF cDNA having a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 95. In some aspects, the second vector comprises a 5' portion of an OTOF cDNA having the sequence of SEQ ID NO: 95.

[0206] 5'mOTOF DNA sequence (SEQ ID NO: 94)

[0207]

[0208] 3'mOTOF DNA sequence (SEQ ID NO: 95)

[0209]

[0210] Some aspects of any of the compositions described herein can include a first vector comprising the coding sequence of SEQ ID NO: 94 (or comprising a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 94). Some aspects of any of the compositions described herein can include a second vector comprising the coding sequence of SEQ ID NO: 95 (or comprising a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 95).

[0211] Some aspects of any of the compositions described herein may comprise a first rAAV vector having a 5' OTOF coding region comprising exons 1 to (to) 21 of an OTOF cDNA. In some aspects, the composition comprises a first rAAV vector comprising the nucleotide sequence of SEQ ID NO: 101 (or a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 101). In some aspects, the composition comprises a first rAAV vector comprising a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 101 and encodes the same amino acid sequence encoded by SEQ ID NO: 101.

[0212] In some aspects, the compositions of the present disclosure include a first rAAV vector comprising a codon-optimized version of SEQ ID NO: 101, i.e., a nucleotide sequence encoding the same amino acid sequence encoded by SEQ ID NO: 101, but having codons optimized for expression in a specific cell type, e.g., a mammalian cell, e.g., a human cell. In some aspects, the first vector does not include any other portion of the OTOF gene. In some aspects, the first vector does not include any other portion of the OTOF cDNA.

[0213] In some aspects, the composition comprises a second rAAV vector having a 3' OTOF coding region comprising exon 22 to (to) exon 48 of the OTOF cDNA. In some aspects, the composition comprises a second rAAV vector comprising the nucleotide sequence of SEQ ID NO: 107 (or a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 107). In some aspects, the composition comprises a second rAAV vector comprising a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 108 and encodes the same amino acid sequence encoded by SEQ ID NO: 107.

[0214] In some aspects, the composition comprises a second rAAV vector comprising a codon-optimized version of SEQ ID NO: 107, i.e., a nucleotide sequence encoding the same amino acid sequence as encoded by SEQ ID NO: 107, but having codons that have been optimized for expression in a particular cell type, e.g., a mammalian cell, e.g., a human cell. In some aspects, the second rAAV vector does not comprise any other portion of the OTOF gene. In some aspects, the second rAAV vector does not comprise any other portion of the OTOF cDNA.

[0215] Those skilled in the art will appreciate that amino acids that are not conserved between wild-type otoferlins from different species can be mutated without loss of activity, whereas those amino acids that are conserved between wild-type otoferlins from different species should not be mutated because they are more likely (than non-conserved amino acids between different species) to be involved in the activity.

[0216] ITR

[0217] In some aspects, the AAV vector comprises 5' and 3' inverted terminal repeats (ITRs). In some aspects, the rAAV vector comprises 5' and 3' inverted terminal repeats. In some aspects, the AAV sequence of the vector comprises cis-acting 5' and 3' inverted terminal repeats (see, e.g., BJ Carter, in "Handbook of Parvoviruses", edited by P. Tijsser, CRC Press, pages 155-168 (1990)). In some aspects, the length of the ITR sequence is about 145 nt. In some aspects, substantially complete sequences encoding ITRs are used in the molecule, but these sequences allow for a certain degree of minor modification. The ability to modify these ITR sequences is within the capabilities of those skilled in the art. (See, e.g., texts such as Sambrook et al. "Molecular Cloning. A Laboratory Manual", 2nd edition, Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J Virol., 70: 520 532 (1996)). An example of such a molecule employed in the present disclosure is a "cis-acting" plasmid containing a transgene, wherein the selected transgene sequence and associated regulatory elements are flanked by 5' and 3' AAV ITR sequences. The AAV ITR sequences can be obtained from any known AAV, including currently identified mammalian AAV types. In some aspects, the ITR is or comprises 145 nucleotides.

[0218] In some aspects, the ITR is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or Anc80 ITR. In some aspects, the ITR is an AAV2 ITR. In some aspects, the 5′ ITR has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 97. In some aspects, the 5′ ITR has the sequence of SEQ ID NO: 97. In some aspects, the 3′ ITR has the sequence of SEQ ID NO: 97. ′ The ITR has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 104. In some aspects, the 3' ITR has the sequence of SEQ ID NO: 104.

[0219] In some aspects, the ITR is a wild-type AAV2 ITR, e.g., the 5' ITR of SEQ ID NO: 97 and the 3' ITR of SEQ ID NO: 104. In some aspects, the ITR is derived from a wild-type AAV2 ITR and comprises one or more modifications, e.g., truncations, deletions, substitutions, or insertions, as known in the art. In some aspects, the ITR comprises less than 145 nucleotides, e.g., 127, 130, 134, or 141 nucleotides. For example, in some aspects, the ITR comprises 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, or 145 nucleotides.

[0220] In some aspects, the 5' ITR is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 59. In some aspects, the 3' ITR is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 60.

[0221] In some aspects, the 5'AAV ITR sequence has the sequence of SEQ ID NO: 59. In some aspects, the 3'AAV ITR sequence has the sequence of SEQ ID NO: 60. In some aspects, the vectors and / or constructs of the present disclosure comprise a 5'AAV ITR and / or a 3'AAV ITR. In some aspects, the 5'AAV ITR sequence has the sequence of SEQ ID NO: 97. In some aspects, the 3'AAV ITR sequence has the sequence of SEQ ID NO: 104. In some aspects, the 5'AAV ITR sequence is SEQ ID NO: 97 and the 3'AAV ITR sequence is SEQ ID NO: 104. In some aspects, the 5' and 3'AAV ITRs (e.g., SEQ ID NOs: 97 and 104) flank a portion of a transgene and / or construct comprising a portion of OTOF (e.g., SEQ ID NOs: 101 or 107).

[0222] In some aspects, the recombinant AAV vector comprises a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 96. In some aspects, the recombinant AAV vector comprises a nucleic acid sequence having the sequence of SEQ ID NO: 96.

[0223] In some aspects, the recombinant AAV vector comprises a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 105. In some aspects, the recombinant AAV vector comprises a nucleic acid sequence having the sequence of SEQ ID NO: 105.

[0224] Promoter

[0225] In some aspects, the first recombinant adeno-associated viral (rAAV) vector comprises a first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of the otoferlin gene. In some aspects, the first recombinant adeno-associated viral (rAAV) vector genome comprises a first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of the otoferlin gene.

[0226] In some embodiments, the promoter is selected from a constitutive promoter, an inducible promoter or a tissue-specific promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the constitutive promoter is selected from a CAG, CBA or CMV promoter. In some embodiments, the constitutive promoter is a CAG promoter.

[0227] Non-limiting examples of promoters are described herein. Additional examples of promoters are known in the art.

[0228] In some aspects, the vector encoding the N-terminal portion of an otoferlin (eg, human otoferlin) may comprise a promoter and / or enhancer. The vector encoding the N-terminal portion of an otoferlin may comprise any promoter and / or enhancer described herein or known in the art.

[0229] In some aspects, the promoter is an inducible promoter, a constitutive promoter, a mammalian cell promoter, a viral promoter, a chimeric promoter, an engineered promoter, a tissue-specific promoter, or any other type of promoter known in the art. In some aspects, the promoter is an RNA polymerase II promoter, such as a mammalian RNA polymerase II promoter. In some aspects, the promoter is an RNA polymerase III promoter, including but not limited to an H1 promoter, a human U6 promoter, a mouse U6 promoter, or a pig U6 promoter. The promoter is generally a promoter that can promote transcription in cochlear cells such as hair cells. In some instances, the promoter is a cochlear-specific promoter or a cochlear-directional promoter.

[0230] A variety of promoters are known in the art and can be used herein. Non-limiting examples of promoters that can be used herein include: human elongation factor 1 alpha-subunit (EF1a) (Liu et al. (2007) Exp. Mol. Med. 39 (2): 170-175; Accession No. J04617.1; Gill et al., Gene Ther. 8 (20): 1539-1546, 2001; Xu et al., Human Gene Ther. 12 (5): 563-573, 2001; Xu et al., Gene Ther. 8: 1323-1332; Ikeda et al., . Gene Ther. 9:932-938,2002; Gilham et al., J. Gene Med. 12(2):129-136, 2010), cytomegalovirus (Xu et al., Human Gene Ther. 12(5):563-573, 2001; Xu et al., Gene Ther. 8:1323-1332; Gray et al., Human Gene Ther. 22:1143-1153, 2011), human immediate-early cytomegalovirus (CMV) (U.S. Pat. No. 5,168,062, Liu et al. (2007) Exp. Mol. Med. 39(2):170-175; Accession No. X17403.1 or KY490085.1), human ubiquitin C (UBC) (Gill et al., Gene Ther. 8(20):1539-1546, 2001; Qin et al., PLoS One 5(5):e10611, 2010), mouse phosphoglycerate kinase 1, polyoma adenovirus, simian virus 40 (SV40), β-globin, β-actin, α-fetoprotein, γ-globin, β-interferon, γ-glutamyl transferase, mouse mammary tumor virus (MMTV), Roussarcoma virus, rat insulin, glyceraldehyde-3-phosphate dehydrogenase, metallothionein II (MT II), amylase, cathepsin, MI muscarinic receptor, retroviral LTR (e.g., human T-cell leukemia virus HTLV), AAV ITR, interleukin-2, collagenase, platelet-derived growth factor, adenovirus 5E2, stromelysin, mouse MX gene, glucose-regulated proteins (GRP78 and GRP94), α-2-macroglobulin, vimentin, MHC class I gene H-2κ b, HSP70, proliferin, tumor necrosis factor, thyroid stimulating hormone alpha gene, immunoglobulin light chain, T cell receptor, HLA DQα and DQB, interleukin-2 receptor, MHC class II, MHC class II HLA-DRα, muscle creatine kinase, prealbumin (transthyretin), elastase I, albumin gene, c-fos, c-HA-ras, neural cell adhesion molecule (NCAM), H2B (TH2B) histone, rat growth hormone, human serum amyloid protein (SAA), troponin I (TN I), Duchenne muscular dystrophy, human immunodeficiency virus, gibbon ape leukemia virus (GALV) promoter, HNRPA2B1-CBX1 (UCOE) promoter (Powell and Gray (2015) Discov. Med. 19(102): 49-57; Antoniou et al., Human Gene Ther.24(4):363-374, 2013), β-glucuronidase (GUSB) (Husain et al., Gene Ther. 16:927-932, 2009), chicken β-actin (CBA) (Liu et al. (2007) Exp. Mol. Med. 39(2):170-175; Stone et al. (2005) Mol. Ther. 11(6):843-848; Klein et al., Exp. Neurol. 176(1):66-74, 2002; Ohlfest et al., Blood 105:2691-2698, 2005; Gray et al., Human Gene Ther. 22: 1143-1153, 2011), human β-actin promoter (HBA) (Accession No. Y00474.1), mouse myosin VIIA (musMyo7) (Boeda et al. (2001) Hum. Mol. Genet. 10(15): 1581-1589; Accession No. AF384559.1), human myosin VIIA (hsMyo7) (Boeda et al. (2001) Hum. Mol. Genet. 10(15): 1581-1589; Accession No. AF384559.1), human myosin VIIA (hsMyo7) (Boeda et al. Human (2001) Hum. Mol. Genet. 10(15): 1581-1589; Accession No. NG_009086.1), mouse poly(ADP-ribose) polymerase 2 (musPARP2) (Ame et al. (2001) J. Biol. Chem. 276(14): 11092-11099; Accession No. AF191547.1), human poly(ADP-ribose) polymerase 2 (hsPARP2) (Ame et al. (2001) J. Biol. Chem. 276 (14): 11092-11099; Accession No. X16612.1 or AF479321.1), acetylcholine receptor ε-subunit (AChε) (Duclert et al. (1993) PNAS 90 (7): 3043-3047; Accession No. S58221.1 or CR933736.12), Rous sarcoma virus (RSV) (Liu et al. (2007) Exp. Mol. Med. 39(2): 170-175; Accession No. M77786.1), (GFAP) (Liu et al. (2007) Exp. Mol. Med. 39(2): 170-175; Stone et al. (2005) Mol. Ther. 11(6): 843-848; Accession No. NG_008401.1 or M67446.1), hAAT (Van Linthout et al., Human Gene Ther. 13(7): 829-840, 2002; Cunningham et al., Mol. Ther.16(6):1081-1088, 2008), and CBA hybrid (CBh) (Gray et al. (2011) Hum. Gen. Therapy 22:1143-1153; Accession No. KF926476.1 or KC152483.1). Additional examples of promoters are known in the art. See, e.g., Lodish, Molecular Cell Biology, Freeman and Company, New York 2007. In some aspects, the promoter is the CMV immediate early promoter. .

[0231] In some aspects, the promoter is a CAG promoter or a CAG / CBA promoter.In some aspects, the vectors or constructs of the present disclosure comprise a CAG promoter.

[0232] In some aspects, the CAG promoter comprises the nucleotide sequences of SEQ ID NOs: 98, 99, and 100 in 5' to 3' order.

[0233] In some aspects, the CAG promoter comprises a CMV early enhancer element, a chicken beta actin (CBA) gene sequence, and a chimeric intron / 3' splice sequence from a rabbit beta globin gene.

[0234] In some aspects, the CMV early enhancer element comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 98. In some aspects, the CMV early enhancer element has the sequence of SEQ ID NO: 98.

[0235] In some aspects, the CBA gene sequence has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 99. In some aspects, the CBA gene sequence has the sequence of SEQ ID NO: 99.

[0236] In some aspects, the chimeric intron / 3' splice sequence from a rabbit beta globin gene is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 100. In some aspects, the chimeric intron / 3' splice sequence from a rabbit beta globin gene has the sequence of SEQ ID NO: 100.

[0237] Examples of constitutive promoters include, but are not limited to, the CAG promoter, the retroviral Rous sarcoma virus (RSV) LTR promoter, the cytomegalovirus (CMV) promoter (see, e.g., Boshart et al. Cell 41:521-530, 1985), the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1-α promoter (Invitrogen).

[0238] Inducible promoters allow for regulation of gene expression and can be regulated by the presence of exogenously provided compounds, environmental factors (such as temperature), or a particular physiological state (e.g., acute phase, a particular differentiation state of a cell) or simply in replicating cells. Inducible promoters and inducible systems are available from a variety of commercial sources, including but not limited to Invitrogen, Clontech, and Ariad. Many other systems have been described and can be readily selected by those skilled in the art.

[0239] Examples of inducible promoters regulated by exogenously provided compounds include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088), ecdysone insect promoter (No et al. Proc. Natl. Acad. Sci. USA 93:3346-3351, 1996), tetracycline repressible system (Gossen et al. Proc. Natl. Acad. Sci. USA 89:5547-5551, 1992), tetracycline inducible system (Gossen et al. Science 268:1766-1769, 1995, see also Harvey et al. Curr. Opin. Chem. Biol. 2:512-518, 1998), RU486 inducible system (Wang et al. Nat. Biotech. 15:239-243, 1997) and Wang et al. Gene Ther. 4:432-441, 1997), and rapamycin inducible system (Magari et al. J. Clin. Invest. 100:2865-2872, 1997).

[0240] In some aspects, the tissue-specific promoter is active only in the inner ear. In some aspects, the tissue-specific promoter is active only in the cochlea. In some aspects, the tissue-specific promoter is active only in hair cells. In some aspects, the tissue-specific promoter is active only in inner hair cells.

[0241] Exemplary tissue-specific promoters include, but are not limited to, the following tissue-specific promoters: liver-specific thyroxine binding globulin (TBG) promoter, insulin promoter, glucagon promoter, somatostatin promoter, pancreatic polypeptide (PPY) promoter, synapsin-1 (Syn) promoter (Kugler et al., Virology 311:89-95, 2003; Hioki et al., Gene Ther. 14:872-882, 2007; Kuroda et al., J. Gene Med. 10:1163-1175, 2008), creatine kinase (MCK) promoter (Wang et al., Gene Ther. 15:1489-1499, 2008; Talbot et al., Mol. Ther. 18:601-608, 2010; Katwal et al., Gene Ther. 20(9):930-938, 2013), mammalian desmin (DES) promoter (Talbot et al., Mol. Ther. 18:601-608, 2010), C5-12 promoter (Wang et al., Gene Ther. 15:1489-1499, 2008), α-myosin heavy chain (a-MHC) promoter, PDGF promoter (Patterna, Gene Ther. 7(15):1304-1311, 2000; Hioki et al., Gene Ther. 14:872-882, 2007), MecP2 promoter (Rastegar et al., PLoS One 4:e6810, 2009; Gray et al., Human Gene Ther. 22:1143-1153, 2011), CaMKII promoter (Hioki et al., Gene Ther. 23:1154-1163, 2012), Ther. 14: 872-882, 2007; Kuroda et al., J. Gene Med. 10: 1163-1175, 2008), mGluR2 promoter (Brene et al., Eur. J. Eurosci. 12: 1525-1533, 2000; Kuroda et al., J. Gene Med. 10: 1163-1175, 2008), NFL promoter (Xu et al., Human Gene Ther. 12 (5): 563-573, 2001; Xu et al., Gene Ther. 8: 1323-1332, 2001), NFH promoter (Xu et al., Human Gene Ther. 12 (5): 563-573, 2001; Xu et al., Gene Ther. 8: 1323-1332, 2001), n Promoter (Xu et al., Human Gene Ther. 12(5):563-573, 2001; Xu et al., Gene Ther. 8:1323-1332, 2001), PPE promoter (Xu et al., Human Gene Ther. 12(5):563-573, 2001; Xu et al., Gene Ther. 8:1323-1332, 2001), Enk promoter (Xu et al., Human Gene Ther. 12(5):563-573, 2001; Xu et al., Gene Ther. 8:1323-1332, 2001), EAAT2 promoter (Su et al., Proc. Natl. Acad. Sci. U.S.A. 100:1955-1960, 2003; Kuroda et al., J. Gene Med. 10: 1163-1175, 2008), GFAP promoter (Brenner et al., J. Neurosci. 14: 1030-1037, 1994; Xu et al., Human Gene Ther. 12(5): 563-573, 2001; Xu et al., Gene Ther. 8: 1323-1332, 2001; Lee et al., Glia 56: 481-493, 2008; Dirren et al., Human Gene Ther. 25: 109-120, 2014), MBP promoter (Chen et al., Gene Ther. 5(1): 50-58, 1998) or cardiac troponin T (cTnT) promoter.Other exemplary promoters include the β-actin promoter, the hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002-9 (1996); the alpha-fetoprotein (AFP) promoter, Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), the osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); the bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11: 654-64 (1996)), CD2 promoter (Hansal et al., J. Immunol., 161: 1063-8 (1998), immunoglobulin heavy chain promoter, T cell receptor α chain promoter, neurons such as neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobio1., 13: 503-15 (1993); Xu et al., Human Gene Ther. 12(5): 563-573, 2001; Xu et al., Gene Ther. 8: 1323-1332, 2001), the neurofilament light chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88: 5611-5 (1991)), and the neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15: 373-84 (1995)), as well as other promoters apparent to those skilled in the art.

[0242] In some aspects, the regulatory sequence confers tissue-specific gene expression capability. In some cases, the tissue-specific regulatory sequence binds a tissue-specific transcription factor that induces transcription in a tissue-specific manner.

[0243] In some aspects, the tissue-specific promoter is a cochlear-specific promoter. In some aspects, the tissue-specific promoter is a cochlear hair cell-specific promoter. Non-limiting examples of cochlear hair cell-specific promoters include, but are not limited to, ATOH1 promoter, POU4F3 promoter, LHX3 promoter, MYO7A promoter, MYO6 promoter, α9ACHR promoter, and α10ACHR promoter.

[0244] On the other hand, the native promoter of the transgene will be used. When it is desired that the expression of the transgene should mimic the native expression, the native promoter may be preferred. When the expression of the transgene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to a specific transcriptional stimulus, the native promoter may be used. On the other hand, other native expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences may also be used to mimic the native expression.

[0245] Enhancer

[0246] In some cases, the vector may include a promoter sequence and / or an enhancer sequence. The term "enhancer" refers to a nucleotide sequence that can increase the transcription level of a nucleic acid encoding a protein of interest (e.g., otoferlin). An enhancer sequence (50-1500 base pairs in length) generally increases the transcription level by providing additional binding sites for transcription-related proteins (e.g., transcription factors). In some aspects, enhancer sequences are found within intron sequences. Unlike promoter sequences, enhancer sequences can function at a much greater distance from the transcription start site (e.g., compared to promoters). Non-limiting examples of enhancers include RSV enhancers, CMV enhancers, and SV40 enhancers. Examples of CMV enhancers are described in, for example, Boshart et al., Cell 41 (2): 521-530, 1985.

[0247] In some aspects, the enhancer is a CMV early enhancer. In some aspects, the CMV early enhancer element comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO: 98. In some aspects, the CMV early enhancer has the sequence of SEQ ID NO: 98.

[0248] Poly(A) sequence

[0249] In some aspects, any vector provided herein may comprise a poly(A) sequence. Most nascent eukaryotic mRNAs have a poly(A) tail added at their 3' end during a complex process, including cleavage of the primary transcript and coupled polyadenylation reactions (see, e.g., Proudfoot et al., Cell 108:501-512, 2002). The poly(A) tail confers stability and transferability to mRNA (B. Alberts et al., Molecular Biology of the Cell, 3rd edition, Garland Publishing, 1994). In some aspects, the poly(A) sequence is located 3' of the nucleic acid sequence encoding the C-terminus of otoferlin.

[0250] The poly(A) sequence can be modified chemically or enzymatically to modulate mRNA functionality, such as localization, stability, or translation efficiency.

[0251] Several poly(A) signal sequences are available, including those derived from bovine growth hormone (bgh) (Woychik et al., Proc. Natl. Acad. Sci. USA 81(13):3944-3948, 1984; U.S. Pat. No. 5,122,458; Yew et al., Human Gene Ther. 8(5):575-584, 1997; Xu et al., Human Gene Ther. 12(5):563-573, 2001; Xu et al., Gene Ther. 8:1323-1332, 2001; Wu et al., Mol. Ther. 16(2):280-289, 2008; Gray et al., Human Gene Ther. 22: 1143-1153, 2011; Choi et al., Mol. Brain 7: 17, 2014), mouse-β-globin, mouse-α-globin (Orkin et al., EMBO J. 4(2): 453-456, 1985; Thein et al., Blood 71(2): 313-319, 1988), human collagen, polyomavirus (Batt et al., Mol. Cell Biol. 15(9): 4783-4790, 1995), herpes simplex virus thymidine kinase gene (HSVTK), IgG heavy chain gene polyadenylation signal (US2006 / 0040354), human growth hormone (hGH) (Szymanski et al., Mol. Therapy 15(7): 1340-1347, 2007; Ostegaard et al., Proc. Natl. Acad. Sci. USA 102 (8): 2952-2957, 2005), synthetic poly A (Levitt et al., Genes Dev. 3 (7): 1019-1025, 1989; Yew et al., Human Gene Ther. 8 (5): 575-584, 1997; Ostegaard et al., Proc. Natl. Acad. Sci. USA 102(8):2952-2957, 2005; Choi et al., Mol. Brain 7:17, 2014), HIV-1 upstream poly(A) enhancer (Schambach et al., Mol. Ther. 15(6):1167-1173, 2007), adenovirus (L3) upstream poly(A) enhancer (Schambach et al., Mol. Ther. 15(6):1167-1173, 2007), hTHGB upstream poly(A) enhancer (Schambach et al., Mol. Ther.15(6):1167-1173, 2007), hC2 upstream poly(A) enhancer (Schambach et al., Mol. Ther. 15(6):1167-1173, 2007), a group consisting of SV40 poly(A) signal sequences, such as SV40 late and early poly(A) signal sequences (Schek et al., Mol. Cell Biol. 12(12):5386-5393, 1992; Choi et al., Mol. Brain 7:17, 2014; Schambach et al., Mol. Ther. 15(6):1167-1173, 2007). In some aspects, the polyA sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 68. In some aspects, the polyA sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 76. In some aspects, the polyA sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 77. Non-limiting examples of poly(A) signal sequences are SEQ ID NO: 68, 76, or 77.

[0252] The poly(A) signal sequence can be the sequence AATAAA. The AATAAA sequence can be replaced by other hexanucleotide sequences homologous to AATAAA that can emit a polyadenylation signal, including ATTAAA, AGTAAA, CATAAA, TATAAA, GATAAA, ACTAAA, AATATA, AAGAAA, AATGAA, AATCAA, AACAAA, AATCAA, AATTAAC, AATTAGA, AATTAAA or AATAAG (see, e.g., WO 06 / 12414).

[0253] In some aspects, the poly (A) signal sequence can be a synthetic polyadenylation site (see, e.g., Promega's pCl-neo expression vector, which is based on Levitt et al., Genes Dev. 3 (7): 1019-1025, 1989). In some aspects, the poly (A) signal sequence is the polyadenylation signal (AAATAAAATACGAAATG) of soluble neuropilin-1 (sNRP) (see, e.g., WO 05 / 073384).

[0254] In some aspects, the poly(A) sequence is a bovine growth hormone poly(A) sequence. In some aspects, the polyA sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 108. In some such aspects, the bGH poly(A) sequence comprises or is the sequence of SEQ ID NO: 108. In some aspects, the vectors or constructs of the present disclosure comprise the bovine growth hormone polyA sequence represented by SEQ ID NO: 108. Additional examples of poly(A) signal sequences are known in the art.

[0255] Flanking untranslated region (UTR)

[0256] In some aspects, any vector described herein (eg, any of the at least two different vectors) can comprise an untranslated region. In some aspects, the vector can comprise a 5'UTR or a 3'UTR.

[0257] The untranslated region (UTR) of a gene is transcribed but not translated. The 5'UTR begins at the transcription start site and continues to, but not including, the start codon. ′ The UTR starts immediately after the stop codon and continues until the transcription termination signal. There is increasing evidence that the UTR plays a regulatory role in the stability and translation of nucleic acid molecules. The regulatory features of the UTR can be incorporated into any of the vectors, compositions, kits or methods described herein to enhance the stability of the otoferlin.

[0258] Splice donor and splice acceptor sequences

[0259] In other aspects, non-UTR sequences can be incorporated into 5' or 3' UTRs. In some aspects, introns or portions of intronic sequences can be incorporated into the flanking regions of the polynucleotides in any of the vectors, compositions, kits, and methods provided herein. Incorporation of intronic sequences can increase protein production as well as mRNA levels. Introns can be introns from the otoferlin gene or can be introns from heterologous genes, for example, hybrid adenovirus / mouse immunoglobulin introns (Yew et al., Human Gene Ter. 8(5): 575-584, 1997), SV40 intron (Ostedgaard et al., Proc. Natl. Acad. Sci. USA 102(8): 2952-2957, 2005), MVM intron (Wu et al., Mol. Ther. 16(2): 280-289, 2008), factor IX truncated intron 1 (Wu et al., Mol. Ther. 16(2): 280-289, 2008; Kurachi et al., J. Biol. Chem. 270(10): 5276-5281, 1995), chimeric θ-globulin splice donor / immunoglobulin heavy chain splice acceptor intron (Wu et al., Mol. Ther. 16(2): 280-289, 2008; Choi et al., Mol. Brain. 270(10): 5276-5281, 1995), 7:17, 2014), SV40 late splice donor / splice acceptor intron (19S / 16S) (Yew et al., Human Gene Ther. 8(5):575-584, 1997), hybrid adenovirus splice donor / IgG splice acceptor (Choi et al., Mol. Brain 7:17, 1991; Huang and Gorman, Mol. Cell Biol. 10(4):1805-1810, 1990).

[0260] In some aspects, the splice donor has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 64. In some aspects, the splice donor has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 72. In some aspects, the splice donor has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 74. In some aspects, the splice donor has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 102. In some aspects, the splice donor has the sequence of SEQ ID NO: 102.

[0261] In some aspects, the splice acceptor has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 65. In some aspects, the splice acceptor has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 73. In some aspects, the splice acceptor has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 75. In some aspects, the splice acceptor has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 106. In some aspects, the splice acceptor has the sequence of SEQ ID NO: 106.

[0262] Non-limiting examples of splice donor and splice acceptor sequences are SEQ ID NOs: 64 and 65, respectively; SEQ ID NOs: 72 and 73, respectively; SEQ ID NOs: 74 and 75, respectively, and SEQ ID NOs: 102 and 106, respectively.

[0263] In some aspects, the splice donor sequence has the sequence of SEQ ID NO: 102. In some aspects, the vector of the construct of the present disclosure comprises the splice donor sequence of SEQ ID NO: 102. In some such aspects, the vector or construct comprising the splice donor sequence (e.g., SEQ ID NO: 102) further comprises the 5′ portion of the OTOF gene or OTOF cDNA upstream of the splice donor sequence (e.g., SEQ ID NO: 101).

[0264] In some aspects, the first rAAV vector comprises a splice donor sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 102. In some aspects, the first rAAV vector comprises a first expression cassette comprising a splice donor sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 102.

[0265] In some aspects, the first rAAV vector genome comprises a splice donor sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 102. In some aspects, the first rAAV vector genome comprises a first expression cassette comprising a splice donor sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 102. In some aspects, the splice donor has the sequence of SEQ ID NO: 102.

[0266] In some aspects, the splice acceptor sequence has the sequence of SEQ ID NO: 106. In some aspects, the vectors or constructs of the present disclosure comprise the splice acceptor sequence of SEQ ID NO: 106. In some such aspects, the vectors or constructs comprising the splice acceptor sequence (e.g., SEQ ID NO: 106) further comprise the 3′ portion of the OTOF gene or OTOF cDNA downstream of the splice acceptor sequence (e.g., SEQ ID NO: 107).

[0267] In some aspects, the second rAAV vector comprises a splice acceptor sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 106. In some aspects, the second rAAV vector comprises a second expression cassette comprising a splice acceptor sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 106.

[0268] In some aspects, the second rAAV vector genome comprises a splice acceptor sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 106. In some aspects, the second rAAV vector genome comprises a second expression cassette comprising a splice acceptor sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 106. In some aspects, the splice acceptor has the sequence of SEQ ID NO: 106.

[0269] Recombination-causing sequence

[0270] In some aspects, the vectors or constructs of the present disclosure comprise one or more recombinogenic sequences. In some aspects, the recombinogenic sequence is a gene sequence that is or comprises a portion of a gene sequence. In some aspects, the recombinogenic sequence is derived from an alkaline phosphatase gene. In some aspects, the recombinogenic sequence is derived from an F1 phage. In some such aspects, the recombinogenic sequence is an AK sequence derived from an F1 phage.

[0271] In some aspects, the AK recombinogenic sequence has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 103. In some aspects of the dual vector system of the present disclosure, each of the two vectors comprises a recombinogenic sequence.

[0272] In some aspects, the first rAAV vector comprises an AK recombinogenic sequence having a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 103. In some aspects, the first rAAV vector comprises an expression cassette comprising an AK recombinogenic sequence having a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 103. In some aspects, the AK recombinogenic sequence has the sequence of SEQ ID NO: 103.

[0273] In some aspects, the first rAAV vector genome comprises an AK recombinogenic sequence having a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 103. In some aspects, the first rAAV vector genome comprises an expression cassette comprising an AK recombinogenic sequence having a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 103. In some aspects, the AK recombinogenic sequence has the sequence of SEQ ID NO: 103.

[0274] Additional Sequences

[0275] In addition to the major elements identified above for recombinant AAV vectors, the vectors also comprise conventional control elements operably linked to the transgene in a manner that permits its transcription, translation and / or expression in cells transfected with the plasmid vector or infected with the viruses produced by the disclosure.

[0276] Any of the vectors provided herein may optionally contain additional nucleotide sequences ("stuffer sequences") to optimize the total number of base pairs in the vector.

[0277] In some aspects, the stuffer sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 54. In some aspects, the stuffer sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 55. In some aspects, the stuffer sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 56. In some aspects, the stuffer sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 57. In some aspects, the stuffer sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 58. In some aspects, the stuffer sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 90. In some aspects, the stuffer sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 91. SEQ ID NOs. 54-58, 90, and 91 are exemplary human Factor VIII stuffer sequences that can be used in any of the vectors described herein. Additional stuffer sequences are known in the art.

[0278] Capsid

[0279] In some aspects, the recombinant AAV vectors of the present disclosure are packaged into capsids of AAV2, 3, 4, 5, 6, 7, 8, 9, 10, rh8, rh10, rh39, rh43, or Anc80 serotypes, or one or more hybrids thereof. In some aspects, the capsid is from an ancestral serotype. For example, in some aspects, the capsid is an Anc80 capsid (e.g., an Anc80L65 capsid).

[0280] In some aspects, the capsid comprises a polypeptide that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 109. In some aspects, the capsid comprises a polypeptide represented by SEQ ID NO: 109.

[0281] Any combination of ITRs and capsids can be used in the recombinant AAV vectors of the present disclosure, e.g., wild-type or variant AAV2 ITRs and Anc80 capsids, wild-type or variant AAV2 ITRs and AAV6 capsids, etc. In some aspects of the present disclosure, the rAAV particle is a rAAV2 / Anc80 particle comprising an Anc80 capsid (e.g., comprising a polypeptide of SEQ ID NO: 109) that encapsidates a nucleic acid vector having wild-type AAV2 ITRs (e.g., SEQ ID NOs: 97 and 104) flanked by a transgene and / or a construct portion comprising a portion of OTOF (e.g., SEQ ID NOs: 101 or 107).

[0282] In some aspects, the first and second rAAV vectors are encapsulated by AAV capsids. In some aspects, the AAV capsid encapsulating the first rAAV vector is a serotype selected from any one of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43 or Anc80. In some aspects, the AAV capsid encapsulating the second rAAV vector is a serotype selected from any one of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43 or Anc80. In some aspects, the first rAAV vector is encapsulated by Anc80 capsids and the second rAAV vector is encapsulated by Anc80 capsids.

[0283] In some aspects, the first and second rAAV vector genomes are encapsulated by AAV capsids. In some aspects, the AAV capsid encapsulating the first rAAV vector genome is a serotype selected from any one of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43 or Anc80. In some aspects, the AAV capsid encapsulating the second rAAV vector genome is a serotype selected from any one of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43 or Anc80. In some aspects, the first rAAV vector genome is encapsulated by Anc80 capsids and the second rAAV vector genome is encapsulated by Anc80 capsids.

[0284] In some aspects, the Anc80 capsid comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 109. In some aspects, the Anc80 capsid comprises the polypeptide of SEQ ID NO: 109.

[0285] In some aspects, the first recombinant AAV particle comprises a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 96. In some aspects, the first recombinant AAV particle comprises a nucleic acid sequence having the sequence of SEQ ID NO: 96.

[0286] In some aspects, the second recombinant AAV particle comprises a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 105. In some aspects, the second recombinant AAV particle comprises a nucleic acid sequence having the sequence of SEQ ID NO: 105.

[0287] Carrier

[0288] Provided herein are material compositions and methods for treating hearing loss using nucleic acid therapeutic agents, such as auditory polypeptide messenger RNA (e.g., otoferlin gene). In some aspects, the auditory polypeptide nucleic acid (e.g., otoferlin gene) is present in a viral vector, such as an adeno-associated viral vector, an adenoviral vector, a lentiviral vector, and a retroviral vector. In some aspects, the vector is an adeno-associated viral vector. In some aspects, the vector is a recombinant adeno-associated viral vector.

[0289] The foregoing methods for packaging recombinant vectors in desired AAV capsids to produce rAAV (or rAAV particles) of the present disclosure are not intended to be limiting, and other suitable methods will be apparent to those skilled in the art.

[0290] Recombinant AAV vector

[0291] In some aspects, the viral vector is an adeno-associated virus (AAV) vector. In some aspects, the viral vector is a recombinant adeno-associated virus (rAAV) vector. "Recombinant AAV vector" or "rAAV" disclosed herein minimally comprises a transgene or a portion thereof and a regulatory sequence (e.g., a promoter), and 5' and 3' AAV inverted terminal repeats (ITRs). It is such a recombinant AAV vector that is packaged into capsid protein and delivered to selected target cells. In some aspects, transgene is a nucleic acid sequence heterologous to the vector sequence, which encodes a polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor) or other gene product of interest. The nucleic acid coding sequence is operably connected to a regulatory component in a manner that allows transgene to be transcribed, translated and / or expressed in the cells of the target tissue.

[0292] Such recombinant AAV vectors are packaged into capsids to form rAAV particles and delivered to selected target cells (e.g., inner hair cells). In some aspects, one or more recombinant AAV vectors of the present disclosure are packaged into capsids of AAV2, 3, 4, 5, 6, 7, 8, 9, 10, rh8, rh10, rh39, rh43 or Anc80 serotypes or one or more hybrids thereof.

[0293] In some aspects, the rAAV of the present disclosure is encapsidated by an Anc80 capsid. In some aspects, the Anc80 capsid comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 109. In some aspects, the Anc80 capsid comprises the polypeptide of SEQ ID NO: 109.

[0294] In some aspects of any of the compositions described herein, the first vector comprises an ITR (e.g., any exemplary ITR sequence described herein), a promoter and / or enhancer (e.g., any exemplary enhancer and any exemplary promoter described herein), a sequence encoding a first N-terminal portion of human otoferlin (e.g., any exemplary sequence encoding a first N-terminal portion of human otoferlin described herein), a splice donor site (e.g., any exemplary splice donor site described herein), an AK sequence (e.g., any exemplary AK sequence described herein), and an ITR (e.g., any exemplary ITR sequence described herein).

[0295] In some aspects of any of the compositions described herein, the second vector comprises an ITR sequence (e.g., any exemplary ITR sequence described herein), an AK sequence (e.g., any exemplary AK sequence described herein), a splice acceptor sequence (e.g., any splice acceptor sequence described herein), a sequence encoding a second portion of human otoferlin (e.g., any exemplary sequence encoding a second C-terminal portion of human otoferlin described herein), a poly (A) signal sequence (e.g., any exemplary poly (A) signal sequence described herein), and an ITR sequence (e.g., any exemplary ITR sequence described herein).

[0296] The carrier provided herein may have different sizes. The selection of the carrier in any one of the compositions, kits and methods described herein may depend on the size of the carrier. In some aspects, the carrier is an adeno-associated virus (AAV carrier), and may include a total nucleotide of up to 5kb. In some aspects, the AAV carrier may include a total nucleotide in the following range: about 1kb to about 2kb, about 1kb to about 3kb, about 1kb to about 4kb, about 1kb to about 5kb, about 2kb to about 3kb, about 2kb to about 4kb, about 2kb to about 5kb, about 3kb to about 4kb, about 3kb to about 5kb, about 4kb to about 5kb, about 3kb to about 4kb, about 3kb to about 5kb or about 4kb to about 5kb.

[0297] In some aspects of any one of the compositions, kits and methods provided herein, the two different carriers can be carriers of substantially the same type and can differ in size. In some aspects, the two different carriers can be carriers of different types and can have substantially the same size or have different sizes.

[0298] Any vector disclosed herein can be introduced into mammalian cells (e.g., cochlear inner hair cells) using a variety of different methods known in the art. Non-limiting examples of methods for introducing nucleic acids into mammalian cells include: lipofection, transfection (e.g., calcium phosphate transfection, transfection using highly branched organic compounds, transfection using cationic polymers, dendrimer-based transfection, optical transfection, particle-based transfection (e.g., nanoparticle transfection) or transfection using liposomes (e.g., cationic liposomes)), microinjection, electroporation, cell squeezing, sonoporation, protoplast fusion, puncture transfection, hydrodynamic delivery, gene gun, magnetofection, viral transfection, and nuclear transfection.

[0299] Those skilled in the art will appreciate that any of the vectors described herein can be introduced into mammalian cells by, for example, lipofection.

[0300] Various molecular biology techniques that can be used to introduce one or more mutations and / or one or more deletions into endogenous genes are also known in the art. Non-limiting examples of such techniques include site-directed mutagenesis, CRISPR (e.g., CRISPR / Cas9-induced knock-in mutations and CRISPR / Cas9-induced knock-out mutations) and TALEN. These methods can be used to correct the sequence of defective endogenous genes present in the chromosome of the target cell.

[0301] In some aspects, the compositions of the present disclosure comprise a first rAAV vector comprising a first expression cassette comprising a 5′ inverted terminal repeat, a promoter operably linked to the 5′ portion of the OTOF gene or OTOF cDNA, a splice donor sequence, an AK recombination sequence, and a 3′ inverted terminal repeat.

[0302] In some aspects, the compositions of the present disclosure comprise a second rAAV vector comprising a second expression cassette comprising a 5′ inverted terminal repeat, an AK recombination sequence, a splice acceptor sequence, a 3′ portion of the OTOF gene or OTOF cDNA, a polyadenylation sequence, and a 3′ inverted terminal repeat.

[0303] In some aspects, the compositions of the present disclosure comprise a first rAAV vector genome comprising a first expression cassette comprising a 5′ inverted terminal repeat, a promoter operably linked to the 5′ portion of the OTOF gene or OTOF cDNA, a splice donor sequence, an AK recombination sequence, and a 3′ inverted terminal repeat.

[0304] In some aspects, the compositions of the present disclosure comprise a second rAAV vector genome comprising a second expression cassette comprising a 5′ inverted terminal repeat, an AK recombination sequence, a splice acceptor sequence, a 3′ portion of the OTOF gene or OTOF cDNA, a polyadenylation sequence, and a 3′ inverted terminal repeat.

[0305] In some aspects, the compositions of the present disclosure comprise a first rAAV vector comprising a first expression cassette comprising a 5′ inverted terminal repeat sequence, a promoter operably linked to the 5′ portion of the OTOF gene or OTOF cDNA, a splice donor sequence, an AK recombination sequence, and a 3′ inverted terminal repeat sequence in a 5′ to 3′ orientation.

[0306] In some aspects, the compositions of the present disclosure comprise a second rAAV vector comprising a second expression cassette comprising a 5′ inverted terminal repeat, an AK recombination sequence, a splice acceptor sequence, a 3′ portion of the OTOF gene or OTOF cDNA, a polyadenylation sequence, and a 3′ inverted terminal repeat in a 5′ to 3′ orientation.

[0307] In some aspects, the compositions of the present disclosure comprise a first rAAV vector genome comprising a first expression cassette comprising a 5′ inverted terminal repeat sequence, a promoter operably linked to the 5′ portion of the OTOF gene or OTOF cDNA, a splice donor sequence, an AK recombination sequence, and a 3′ inverted terminal repeat sequence in a 5′ to 3′ orientation.

[0308] In some aspects, the compositions of the present disclosure comprise a second rAAV vector genome comprising a second expression cassette comprising a 5′ inverted terminal repeat, an AK recombination sequence, a splice acceptor sequence, a 3′ portion of the OTOF gene or OTOF cDNA, a polyadenylation sequence, and a 3′ inverted terminal repeat in a 5′ to 3′ orientation.

[0309] In some aspects, the composition of the present disclosure comprises a first rAAV vector comprising a first expression cassette comprising i) a 5′ inverted terminal repeat sequence having a sequence of SEQ ID NO: 97, ii) a promoter having sequences of SEQ ID NOs: 98, 99 and 100, which is operably linked to iii) a 5′ portion of an OTOF gene or OTOF cDNA having a sequence of SEQ ID NO: 101, iv) a splice donor sequence having a sequence of SEQ ID NO: 102, v) an AK recombination sequence having a sequence of SEQ ID NO: 103, and vi) a 3′ inverted terminal repeat sequence having a sequence of SEQ ID NO: 104.

[0310] In some aspects, the composition of the present disclosure comprises a second rAAV vector comprising a second expression cassette comprising i) a 5′ inverted terminal repeat sequence having a sequence of SEQ ID NO: 97, ii) a promoter AK recombination sequence having a sequence of SEQ ID NO: 103, iii) a splice acceptor sequence having a sequence of SEQ ID NO: 106, iv) a 3′ portion of an OTOF gene or OTOF cDNA having a sequence of SEQ ID NO: 107, v) a polyadenylation sequence having a sequence of SEQ ID NO: 108, and vi) a 3′ inverted terminal repeat sequence having a sequence of SEQ ID NO: 104.

[0311] In some aspects, the composition of the present disclosure comprises a first rAAV vector genome comprising a first expression cassette comprising i) a 5′ inverted terminal repeat sequence having a sequence of SEQ ID NO: 97, ii) a promoter having sequences of SEQ ID NOs: 98, 99 and 100, which is operably linked to iii) a 5′ portion of an OTOF gene or OTOF cDNA having a sequence of SEQ ID NO: 101, iv) a splice donor sequence having a sequence of SEQ ID NO: 102, v) an AK recombination sequence having a sequence of SEQ ID NO: 103, and vi) a 3′ inverted terminal repeat sequence having a sequence of SEQ ID NO: 104.

[0312] In some aspects, the compositions of the present disclosure comprise a second rAAV vector genome comprising a second expression cassette comprising i) a 5-mer having a sequence of SEQ ID NO: 97; ′ inverted terminal repeat sequence, ii) an AK recombinogenic sequence having the sequence of SEQ ID NO: 103, iii) a splice acceptor sequence having the sequence of SEQ ID NO: 106, iv) a 3' portion of an OTOF gene or OTOF cDNA having the sequence of SEQ ID NO: 107, v) a polyadenylation sequence having the sequence of SEQ ID NO: 108, and vi) a 3' inverted terminal repeat sequence having the sequence of SEQ ID NO: 104.

[0313] In some aspects, the compositions of the present disclosure comprise a first rAAV vector comprising a first expression cassette comprising, in a 5′ to 3′ orientation, i) a 5′ inverted terminal repeat having a sequence of SEQ ID NO: 97, ii) a promoter having a sequence of SEQ ID NOs: 98, 99 and 100, operably linked to iii) a 5′ portion of an OTOF gene or OTOF cDNA having a sequence of SEQ ID NO: 101, iv) a splice donor sequence having a sequence of SEQ ID NO: 102, v) an AK recombination sequence having a sequence of SEQ ID NO: 103, and vi) a 3′ inverted terminal repeat having a sequence of SEQ ID NO: 104.

[0314] In some aspects, the compositions of the present disclosure comprise a second rAAV vector comprising a second expression cassette comprising, in a 5′ to 3′ orientation, i) a 5′ inverted terminal repeat having a sequence of SEQ ID NO: 97, ii) an AK recombinogenic sequence having a sequence of SEQ ID NO: 103, iii) a splice acceptor sequence having a sequence of SEQ ID NO: 106, iv) a 3′ portion of an OTOF gene or OTOF cDNA having a sequence of SEQ ID NO: 107, v) a polyadenylation sequence having a sequence of SEQ ID NO: 108, and vi) a 3′ inverted terminal repeat having a sequence of SEQ ID NO: 104.

[0315] In some aspects, the compositions of the present disclosure comprise a first rAAV vector genome comprising a first expression cassette comprising, in a 5′ to 3′ orientation, i) a 5′ inverted terminal repeat having a sequence of SEQ ID NO: 97, ii) a promoter having a sequence of SEQ ID NOs: 98, 99 and 100, operably linked to iii) a 5′ portion of an OTOF gene or OTOF cDNA having a sequence of SEQ ID NO: 101, iv) a splice donor sequence having a sequence of SEQ ID NO: 102, v) an AK recombination sequence having a sequence of SEQ ID NO: 103, and vi) a 3′ inverted terminal repeat having a sequence of SEQ ID NO: 104.

[0316] In some aspects, the compositions of the present disclosure comprise a second rAAV vector genome comprising a second expression cassette comprising, in a 5′ to 3′ orientation, i) a 5′ inverted terminal repeat having a sequence of SEQ ID NO: 97, ii) an AK recombinogenic sequence having a sequence of SEQ ID NO: 103, iii) a splice acceptor sequence having a sequence of SEQ ID NO: 106, iv) a 3′ portion of an OTOF gene or OTOF cDNA having a sequence of SEQ ID NO: 107, v) a polyadenylation sequence having a sequence of SEQ ID NO: 108, and vi) a 3′ inverted terminal repeat having a sequence of SEQ ID NO: 104.

[0317] In some aspects, the compositions of the present disclosure comprise a first rAAV vector comprising a first expression cassette comprising the sequence of SEQ ID NO: 96. In some aspects, the compositions of the present disclosure comprise a second rAAV vector comprising a second expression cassette comprising the sequence of SEQ ID NO:105.

[0318] In some aspects, the compositions of the present disclosure comprise a first rAAV vector genome comprising a first expression cassette comprising the sequence of SEQ ID NO: 96. In some aspects, the compositions of the present disclosure comprise a second rAAV vector genome comprising a second expression cassette comprising the sequence of SEQ ID NO:105.

[0319] In some aspects, the present disclosure provides a composition comprising a) a first recombinant adeno-associated virus (rAAV) vector genome (vg), comprising a first expression cassette, the first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5' portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome, comprising a second expression cassette, the second expression cassette comprising a nucleic acid sequence comprising the 3' portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition comprises approximately 4.1E10-8.1E12 total vg.

[0320] In some aspects, the present disclosure provides a composition comprising a) a first recombinant adeno-associated virus (rAAV) vector genome (vg), comprising a first expression cassette, the first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5' portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome, comprising a second expression cassette, the second expression cassette comprising a nucleic acid sequence comprising the 3' portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition comprises about 4.1E10-4.1E12 total vg or about 8.1E10-8.1E12 total vg.

[0321] In some aspects, the composition comprises the first rAAV vector genome and the second rAAV vector genome in about a 1:1 ratio.

[0322] In some aspects, the composition comprises about 4.1E10-8.1E12 total vg. In some aspects, the composition comprises about 4.1E10-4.1E12 total vg or about 8.1E10-8.1E12 total vg.

[0323] In some aspects, the composition comprises about 4.1E10-4.1E12, about 5.1E10-3.1E12, about 6.1E10-2.1E12, about 7.1E10-1.1E12, about 8.1E10-10.1E11, about 9.1E10-9.1E11, about 10.1E11-8.1E11, about 1.1E11-7.1E11, about 2.1E11-6.1E11, or about 3.1E11-5.1E11 total vg. In some aspects, the composition comprises about 3.1E11-5.1E11, about 3.2E11-5.0E11, about 3.3E11-4.9E11, about 3.4E11-4.8E11, about 3.5E11-4.7E11, about 3.6E11-4.6E11, about 3.7E11-4.5E11, about 3.8E11-4.4E11, about 3.9E11-4.3E11, or about 4.0E11-4.2E11 total vg. In some aspects, the composition comprises about 4.1E11 total vg.

[0324] In some aspects, the composition comprises about 4.1E10-8.1E12 total vg / cochlea. In some aspects, the composition comprises about 4.1E10-4.1E12 total vg / cochlea or about 8.1E10-8.1E12 total vg / cochlea.

[0325] In some aspects, the composition comprises about 4.1E10-4.1E12, about 5.1E10-3.1E12, about 6.1E10-2.1E12, about 7.1E10-1.1E12, about 8.1E10-10.1E11, about 9.1E10-9.1E11, about 10.1E11-8.1E11, about 1.1E11-7.1E11, about 2.1E11-6.1E11, or about 3.1E11-5.1E11 total vg / cochlea. In some aspects, the composition comprises about 3.1E11-5.1E11, about 3.2E11-5.0E11, about 3.3E11-4.9E11, about 3.4E11-4.8E11, about 3.5E11-4.7E11, about 3.6E11-4.6E11, about 3.7E11-4.5E11, about 3.8E11-4.4E11, about 3.9E11-4.3E11, or about 4.0E11-4.2E11 total vg / cochlea. In some aspects, the composition comprises about 4.1E11 total vg / cochlea.

[0326] In some aspects, the composition comprises about 3.0E11, about 3.1E11, about 3.2E11, about 3.3E11, about 3.4E11, about 3.5E11, about 3.6E11, about 3.7E11, about 3.8E11, about 3.9E11, about 4.0E11, about 4.1E11, about 4.2E11, about 4.3E11, about 4.4E11, about 4.5E11, about 4.6E11, about 4.7E11, about 4.8E11, about 4.9E11, about 5.0E11, about 5.1E11, about 5.2E11, about 5.3E11, about 5.4E11, about 5.5E11, about 5.6E11, about 5.7E11, about 5.8E11, about 5.9 E11, about 6.0E11, about 6.1E11, about 6.2E11, about 6.3E11, about 6.4E11, about 6.5E11, about 6.6E11, about 6.7E11, about 6.8E11, about 6.9E11, about 7.0E11, about 7.1E11, about 7.2E11, about 7.3E11, about 7.4E11 , about 7.5E11, about 7.6E11, about 7.7E11, about 7.8E11, about 7.9E11, about 8.0E11, about 8.1E11, about 8.2E11, about 8.3E11, about 8.4E11, about 8.5E11, about 8.6E11, about 8.7E11, about 8.8E11 or about 8.9E11 total vg.

[0327] In some aspects, the composition comprises about 3.0E11, about 3.1E11, about 3.2E11, about 3.3E11, about 3.4E11, about 3.5E11, about 3.6E11, about 3.7E11, about 3.8E11, about 3.9E11, about 4.0E11, about 4.1E11, about 4.2E11, about 4.3E11, about 4.4E11, about 4.5E11, about 4.6E11, about 4.7E11, about 4.8E11, about 4.9E11, about 5.0E11, about 5.1E11, about 5.2E11, about 5.3E11, about 5.4E11, about 5.5E11, about 5.6E11, about 5.7E11, about 5.8E11, about 5.9E11 11, about 6.0E11, about 6.1E11, about 6.2E11, about 6.3E11, about 6.4E11, about 6.5E11, about 6.6E11, about 6.7E11, about 6.8E11, about 6.9E11, about 7.0E11, about 7.1E11, about 7.2E11, about 7.3E11, about 7.4E11, about 7.5E11, about 7.6E11, about 7.7E11, about 7.8E11, about 7.9E11, about 8.0E11, about 8.1E11, about 8.2E11, about 8.3E11, about 8.4E11, about 8.5E11, about 8.6E11, about 8.7E11, about 8.8E11 or about 8.9E11 total vg / cochlea.

[0328] In some aspects, the composition comprises about 8.1E10-8.1E12, about 9.1E10-7.1E12, about 10.1E10-6.1E12, about 1.1E11-5.1E12, about 2.1E11-4.1E12, about 3.1E11-3.1E12, about 4.1E11-2.1E12, about 5.1E11-1.1E12, about 6.1E11-10.1E11, or about 7.1E11-9.1E11 total vg. In some aspects, the composition comprises about 7.1E11-9.1E11, about 7.2E11-9.0E11, about 7.3E11-8.9E11, about 7.4E11-8.8E11, about 7.5E11-8.7E11, about 7.6E11-8.6E11, about 7.7E11-8.5E11, about 7.8E11-8.4E11, about 7.9E11-8.3E11, or about 8.0E11-8.2E11 total vg. In some aspects, the composition comprises about 8.1E11 total vg.

[0329] In some aspects, the composition comprises about 8.1E10-8.1E12, about 9.1E10-7.1E12, about 10.1E10-6.1E12, about 1.1E11-5.1E12, about 2.1E11-4.1E12, about 3.1E11-3.1E12, about 4.1E11-2.1E12, about 5.1E11-1.1E12, about 6.1E11-10.1E11, or about 7.1E11-9.1E11 total vg / cochlea. In some aspects, the composition comprises about 7.1E11-9.1E11, about 7.2E11-9.0E11, about 7.3E11-8.9E11, about 7.4E11-8.8E11, about 7.5E11-8.7E11, about 7.6E11-8.6E11, about 7.7E11-8.5E11, about 7.8E11-8.4E11, about 7.9E11-8.3E11, or about 8.0E11-8.2E11 total vg / cochlea. In some aspects, the composition comprises about 8.1E11 total vg / cochlea.

[0330] In some aspects, the concentration of the composition comprises about 4.5E11-9E13 total vg / mL. In some aspects, the concentration of the composition comprises about 4.5E11-4.5E13 total vg / mL or about 9E11-9E13 total vg / mL.

[0331] In some aspects, the concentration of the composition comprises about 4.5E11-4.5E13 total vg / mL. In some aspects, the concentration of the composition comprises about 5.5E11-3.5E13, about 6.5E11-2.5E13, about 7.5E11-1.5E13, about 8.5E11-10.5E12, about 9.5E11-9.5E12, about 10.5E11-8.5E12, about 1.5E12-7.5E12, about 2.5E12-6.5E12, or about 3.5E12-5.5E12 total vg / mL. In some aspects, the concentration of the composition comprises about 3.5E12-5.5E12, about 3.6E12-5.4E12, about 3.7E12-5.3E12, about 3.8E12-5.2E12, about 3.9E12-5.1E12, about 4.0E12-5.0E12, about 4.1E12-4.9E12, about 4.2E12-4.8E12, about 4.3E12-4.7E12, or about 4.4E12-4.6E12 total vg / mL. In some aspects, the concentration of the composition comprises about 4.5E12 total vg / mL.

[0332] In some aspects, the concentration of the composition comprises about 3.5E12, about 3.6E12, about 3.7E12, about 3.8E12, about 3.9E12, about 4.0E12, about 4.1E12, about 4.2E12, about 4.3E12, about 4.4E12, about 4.5E12, about 4.6E12, about 4.7E12, about 4.8E12, about 4.9E12, about 5.0E12, about 5.1E12, about 5.2E12, about 5.3E12, about 5.4E12, about 5.5E12, about 5.6E12, about 5.7E12, about 5.8E12, about 5.9E12, about 6.0E12, about 6.1E12, about 6.2E12, about 6.3E12, about 6.4E12, about 6.5E12, about 6.6E12, about 6.7E12, about 6.8E12, about 6.9E12, about 7.0E12, about 7.1E12, about 7.2E12, about 7.3E12, about 7.4E12, about 7.5E12, about 7.6E12, about 7.7E12, about 7.8E12, about 7.9E12, about 8.0E12, about 8.1E12, about 8.2E12, about 8.3E12 , about 8.4E12, about 8.5E12, about 8.6E12, about 8.7E12, about 8.8E12, about 8.9E12, about 9.0E12, about 9.1E12, about 9.2E12, about 9.3E12, about 9.4E12, about 9.5E12, about 9.6E12, about 9.7E12, about 9.8E12 or about 9.9E12 total vg / mL.

[0333] In some aspects, the concentration of the composition comprises about 9E11-9E13 total vg / mL. In some aspects, the concentration of the composition comprises about 9E11-9E13, about 10E11-8E13, about 1E12-7E13, about 2E12-6E13, about 3E12-5E13, about 4E12-4E13, about 5E12-3E13, about 6E12-2E13, about 7E12-1E13, or about 8E12-10E12 total vg / mL. In some aspects, the concentration of the composition comprises about 8E12-10E12, about 8.1E12-9.9E12, about 8.2E12-9.8E12, about 8.3E12-9.7E12, about 8.4E12-9.6E12, about 8.5E12-9.5E12, about 8.6E12-9.4E12, about 8.7E12-9.3E12, about 8.8E12-9.2E12, or about 8.9E12-9.1E12. In some aspects, the concentration of the composition comprises 9E12 total vg / mL.

[0334] In some aspects, the first and second rAAV vectors are capable of constituting a polypeptide messenger RNA encoding a full-length human otoferlin in a subject. In some aspects, the first and second rAAV vectors are capable of reconstructing an active otoferlin gene (e.g., a full-length otoferlin gene) in a cell after intermolecular i) concatemerization, ii) recombination, iii) trans-splicing, iv) concatemerization and trans-splicing, or v) recombination and trans-splicing.

[0335] Mammalian cells

[0336] Also provided herein is a cell (e.g., a mammalian cell) comprising any nucleic acid described herein, a vector (e.g., at least two different vectors described herein) or a composition. The skilled person will appreciate that the nucleic acid and vector described herein can be introduced into any mammal. Non-limiting examples of vectors and methods for introducing vectors into mammalian cells are described herein. In some aspects, the cell is a human cell, a mouse cell, a pig cell, a rabbit cell, a dog cell, a cat cell, a rat cell, a sheep cell, a cat cell, a horse cell, or a non-human primate cell. In some aspects, the cell is a specialized cell of the cochlea. In some aspects, the cell is an inner hair cell of the cochlea or an outer hair cell of the cochlea. In some aspects, the cell is an inner hair cell of the cochlea. In some aspects, the cell is an inner hair cell of the cochlea. In some aspects, the cell is an inner hair cell of the cochlea.

[0337] In some aspects, the mammalian cell is in vitro. In some aspects, the mammalian cell is present in a mammal. In some aspects, the mammalian cell is a human cell. In some aspects, the mammalian cell is obtained from a subject. In some aspects, the mammalian cell is an autologous cell obtained from a subject and / or cultured in vitro.

[0338] How to use

[0339] Method of introduction into the cochlea

[0340] Also provided herein are methods of introducing a composition described herein into the cochlea of ​​a mammal (eg, a human).

[0341] Also provided are methods of increasing expression of active otoferlin (eg, full-length otoferlin) in inner hair cells in the cochlea of ​​a mammal (eg, a human), comprising introducing any of the compositions described herein into the cochlea.

[0342] Also provided are methods of treating hearing loss in a subject (e.g., a human) identified as having a defective otoferlin gene (e.g., an otoferlin gene having a mutation that results in reduced expression and / or activity of the otoferlin protein encoded by the gene), wherein the method comprises administering any of the compositions described herein to the cochlea of ​​the subject.

[0343] Also provided are methods of treating non-syndromic sensorineural hearing loss in a subject (e.g., a human) identified as having a defective otoferlin gene (e.g., an otoferlin gene having a mutation that results in reduced expression and / or activity of the otoferlin protein encoded by the gene), wherein the method comprises administering any of the compositions described herein to the cochlea of ​​the subject.

[0344] Also provided are methods of treating hearing loss in a subject (eg, a human) identified as having a biallelic otoferlin gene mutation, wherein the method comprises administering any of the compositions described herein to the cochlea of ​​the subject.

[0345] In some aspects, the methods described herein may further comprise administering a neurotrophic factor to the cochlea of ​​the subject (e.g., at substantially the same time, before, or after administering any of the compositions described herein to the subject). In some examples, the methods described herein may further comprise administering a cochlear implant to the subject (e.g., at substantially the same time, before, or after administering any of the compositions described herein to the subject).

[0346] In some aspects of any of these methods, mammals have previously been identified as having a defective otoferlin gene (e.g., an otoferlin gene with a mutation that causes a reduction in the expression and / or activity of an otoferlin encoded by a gene). In some aspects, these methods further include, before introducing or applying a step, determining that the subject has a defective otoferlin gene. In some aspects, these methods may further include detecting a mutation in the otoferlin gene of the subject. In some aspects, the method may further include identifying or diagnosing the subject as suffering from non-syndromic sensorineural hearing loss.

[0347] In some aspects, the subject identified as having a biallelic otoferlin gene mutation has previously been identified as having a biallelic otoferlin gene mutation. In some aspects, the methods further include determining that the subject has a biallelic otoferlin gene mutation before the introduction or application step. In some aspects, the biallelic otoferlin gene mutation may include any mutation of the otoferlin gene described herein. In some aspects, the biallelic otoferlin gene mutation results in a local synaptic transmission defect between the hair cells and the auditory nerve of the subject.

[0348] In some respects, mammal or experimenter has the clinical manifestation of extreme sensorineural hearing loss.In some respects, extreme sensorineural hearing loss is bilateral extreme sensorineural hearing loss.In some respects, experimenter accredited as having defective otoferlin gene has the clinical manifestation of extreme sensorineural hearing loss when not having a fever.

[0349] In some aspects, the mammal or subject has preserved distortion product otoacoustic emissions (DPOAEs).In some aspects, the mammal or subject has normal outer hair cell function.

[0350] In some aspects, the method can include administering a single dose of a composition described herein to the cochlea of ​​a mammal or subject.

[0351] In some aspects, the methods can include introducing or administering a first dose of the composition into the cochlea of ​​a mammal or subject, assessing the hearing function of the mammal or subject after introducing or administering the first dose, and administering additional doses of the composition to the cochlea of ​​a mammal or subject found not to have hearing function within a normal range (e.g., as determined using any hearing test known in the art).

[0352] In some aspects, the composition is administered in multiple doses. In some aspects, the composition is administered in 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses.

[0353] In some aspects, a single dose comprises about 0.01 mL-0.2 mL. In some aspects, a single dose comprises about 0.01 mL-0.2 mL, about 0.02 mL-0.18 mL, about 0.03 mL-0.16 mL, about 0.04 mL-0.14 mL, about 0.05 mL-0.13 mL, about 0.06 mL-0.12 mL, about 0.07 mL-0.11 mL, about 0.08 mL-0.10 mL. In some aspects, a single dose comprises about 0.01 mL, about 0.02 mL, about 0.03 mL, about 0.04 mL, about 0.05 mL, about 0.06 mL, about 0.07 mL, about 0.08 mL, about 0.09 mL, about 0.1 mL, about 0.11 mL, about 0.012 mL, about 0.13 mL, about 0.14 mL, about 0.15 mL, about 0.16 mL, about 0.17 mL, about 0.18 mL, about 0.19 mL or about 0.2 mL. In some aspects, a single dose comprises about 0.09 mL.

[0354] In some aspects, the composition is administered as a single injection. In some aspects, the composition is administered as multiple injections. In some aspects, the composition is administered as 2, 3, 4, 5, 6, 7, 8, 9, or 10 injections.

[0355] In some aspects of any method described herein, the composition can be formulated for intracochlear administration. In some aspects, the composition comprises one or more pharmaceutically acceptable carriers, diluents or excipients. In some aspects, the composition further comprises one or more buffers and one or more surfactants. In some aspects, the buffer is selected from potassium dihydrogen phosphate, sodium hydrogen phosphate, potassium chloride, sodium chloride, TrisHCl, Tris alkali, histidine, boric acid, citric acid, glycine, HEPES and MOPS. In some aspects, the surfactant is selected from poloxamer 188, Labasso, Tween, ethanol, Pluronic F68 and polyethylene glycol. In some aspects, the composition comprises potassium dihydrogen phosphate, sodium hydrogen phosphate, potassium chloride, sodium chloride and poloxamer 188.

[0356] In some aspects, the composition comprises a) about 1.35 mM-1.65 mM potassium dihydrogen phosphate; b) about 7.29 mM-8.91 mM sodium dihydrogen phosphate; c) about 2.43 mM-2.97 mM potassium chloride; d) about 154.8 mM-189.2 mM sodium chloride; and e) about 0.0001%-0.01% poloxamer 188.

[0357] In some aspects, the composition comprises a) about 1.35 mM, about 1.375 mM, about 1.4 mM, about 1.425 mM, about 1.45 mM, about 1.475 mM, about 1.5 mM, about 1.525 mM, about 1.55 mM, about 1.575 mM, about 1.6 mM, about 1.625 mM, or about 1.65 mM potassium phosphate monobasic; b) about 7.29 mM, about 7.4 mM, about 7.5 mM about 7.6 mM, about 7.7 mM about 7.8 mM, about 7.9 mM, about 8.0 mM, about 8.1 mM, about 8.2 mM, about 8.3 mM, about 8.4 mM, about 8.5 mM, about 8.6 mM, about 8.7 mM, about 8.8 mM, or about 8.91 mM sodium phosphate dibasic; c) about 2.43 mM, about 2.5 mM, about 2.55 mM, about 2.6 mM, about 2.65 mM, about 2.7 mM, about 2.75 mM, about 2.8 mM, about 2.85 mM, about 2.9 mM, about 2.95 mM, or about 2.97 mM potassium chloride; d) about 154.8 mM, about 160 mM, about 165 mM, about 170 mM, about 175 mM, about 180 mM, about 185 mM, or about 189.2 mM sodium chloride, and e) about 0.0001%, about 0.00025%, about 0.0005%, about 0.00075%, about 0.001%, about 0.0025%, about 0.005%, about 0.0075%, or about 0.01% poloxamer 188.

[0358] In some aspects, the composition comprises: a) about 1.5 mM potassium phosphate monobasic; b) about 8.1 mM sodium phosphate dibasic; c) about 2.7 mM potassium chloride; d) about 172 mM sodium chloride; and e) about 0.001% poloxamer 188.

[0359] In some aspects, compositions are formulated to include synthetic perilymph. In some aspects, synthetic perilymph includes one or more pharmaceutically acceptable carriers, diluents or excipients. In some aspects, synthetic perilymph further includes one or more buffers and one or more surfactants. In some aspects, buffer is selected from potassium dihydrogen phosphate, sodium hydrogen phosphate, potassium chloride, sodium chloride, Tris HCl, Tris alkali, histidine, boric acid, citric acid, glycine, HEPES and MOPS. In some aspects, surfactant is selected from poloxamer 188, rapasol, tween, ethanol, pluronic F68 and polyethylene glycol. In some aspects, synthetic perilymph includes potassium dihydrogen phosphate, sodium hydrogen phosphate, potassium chloride, sodium chloride and poloxamer 188.

[0360] In some aspects, the synthetic perilymph fluid comprises a) about 1.35 mM-1.65 mM potassium dihydrogen phosphate; b) about 7.29 mM-8.91 mM sodium dihydrogen phosphate; c) about 2.43 mM-2.97 mM potassium chloride; d) about 154.8 mM-189.2 mM sodium chloride; and e) about 0.0001%-0.01% poloxamer 188.

[0361] In some aspects, the synthetic perilymph comprises a) about 1.35 mM, about 1.375 mM, about 1.4 mM, about 1.425 mM, about 1.45 mM, about 1.475 mM, about 1.5 mM, about 1.525 mM, about 1.55 mM, about 1.575 mM, about 1.6 mM, about 1.625 mM, or about 1.65 mM monohydrogen phosphate; b) about 7.29mM, about 7.4mM, about 7.5mM, about 7.6mM, about 7.7mM, about 7.8mM, about 7.9mM, about 8.0mM, about 8.1mM, about 8.2mM, about 8.3mM, about 8.4mM, about 8.5mM, about 8.6mM, about 8.7mM, about 8.8mM or about 8.91mM dihydrogen phosphate c) about 2.43 mM, about 2.5 mM, about 2.55 mM, about 2.6 mM, about 2.65 mM, about 2.7 mM, about 2.75 mM, about 2.8 mM, about 2.85 mM, about 2.9 mM, about 2.95 mM or about 2.97 mM potassium chloride; d) about 154.8 mM, about 160 mM, about 165 mM, about 17 0 mM, about 175 mM, about 180 mM, about 185 mM or about 189.2 mM sodium chloride, and e) about 0.0001%, about 0.00025%, about 0.0005%, about 0.00075%, about 0.001%, about 0.0025%, about 0.005%, about 0.0075% or about 0.01% poloxamer 188.

[0362] In some aspects, the synthetic perilymph fluid comprises: a) about 1.5 mM potassium phosphate monobasic; b) about 8.1 mM sodium phosphate dibasic; c) about 2.7 mM potassium chloride; d) about 172 mM sodium chloride; and e) about 0.001% poloxamer 188.

[0363] In some aspects, the compositions described herein can be administered via intracochlear administration or topical administration. In some aspects, the compositions are administered using a medical device (e.g., any exemplary medical device described herein). In some aspects, the compositions are pre-loaded in the device.

[0364] In some aspects, the device is such as Figure 2-Figure 5 In some aspects, the device is a microcatheter. In some aspects, the microcatheter is shaped so that it can enter the middle ear cavity via the external auditory canal and contact the end of the microcatheter with the round window membrane (RWM). In some aspects, the distal end of the microcatheter includes at least one microneedle with a diameter between 10 microns and 1,000 microns. In some aspects, at least one microneedle includes a curved portion and an angled tip.

[0365] In some aspects, any method described herein or known in the art can be used for intracochlear administration. For example, the following surgical technique can be used to apply or introduce the composition into the cochlea: first use a 0 degree, 2.5-mm rigid endoscope for visualization, clean the external auditory canal and use a round knife to clearly delineate a tympanic membrane flap of about 5-mm. Then, the tympanic membrane flap is raised and enters the middle ear backward. Identify and separate the chorda tympani nerve, and use a curette to remove the scutellum (scutal bone), thereby exposing the round window membrane. In order to enhance the top distribution of the composition applied or introduced, a surgical laser can be used to make a small 2mm window in the elliptical window to allow the perilymph displacement of the composition during the round window membrane infusion. Then, prepare a microinfusion device and bring it into the surgical area. The device is moved to the round window, and the tip is placed in the bone-shaped round window overhang to allow one or more microneedles to penetrate the membrane. Engage the pedal to allow the composition to be measured and stably infused. Then withdraw the device, and seal the round window and stapes footplate with a gelatin sponge patch.

[0366] In some aspects, the present disclosure describes a delivery method that utilizes minimally invasive, widely accepted surgical techniques to access the middle ear and / or inner ear through the external auditory canal. The procedure includes opening one of the physical barriers between the middle ear and the inner ear at the oval window, and then using a device disclosed herein (e.g., such as Figure 2-Figure 5 ) (or microcatheter) to deliver the compositions disclosed herein at a controlled flow rate and in a fixed volume through the round window membrane.

[0367] In some aspects, a surgical procedure for a mammal (e.g., a rodent (e.g., a mouse, rat, hamster, or rabbit), a primate (e.g., a NHP (e.g., a macaque, chimpanzee, monkey, or ape), or a human) can include ventilation to increase the rate of AAV vector transduction along the length of the cochlea. In some aspects, the absence of ventilation during surgery can result in a lower rate of AAV vector cochlear cell transduction when compared to the rate of AAV vector cochlear cell transduction after ventilated surgery. In some aspects, ventilation promotes about 75%-100% IHC transduction throughout the cochlea. In some aspects, ventilation achieves about 50%-70%, about 60%-80%, about 70%-90%, or about 80%-100% IHC transduction at the base of the cochlea. In some aspects, ventilation achieves about 50%-70%, about 60%-80%, about 70%-90%, or about 80%-100% IHC transduction at the apex of the cochlea.

[0368] The delivery device described herein can be placed in the sterile field of the operating room, and the end of the tubing can be taken out of the sterile field and connected to a syringe, which has been loaded with a composition disclosed herein (e.g., one or more AAV vectors) and installed in a pump. After the system is properly primed to remove any air, the needle can then be passed through the middle ear under visualization (surgical microscope, endoscope, and / or distal tip camera). The RWM can be pierced with a needle (or microneedle). The needle can be inserted until the stopper contacts the RWM. The device can then be maintained in this position while the composition disclosed herein is delivered to the inner ear at a controlled flow rate for a selected duration. In some aspects, flow rate (or infusion rate) can include about 30 μ L / min, or about 25 μ L / min to about 35 μ L / min, or about 20 μ L / min to about 40 μ L / min, or about 20 μ L / min to about 70 μ L / min, or about 20 μ L / min to about 90 μ L / min, or about 20 μ L / min to about 100 μ L / min rate. In some aspects, the flow rate is about 20 μ L / min, about 30 μ L / min, about 40 μ L / min, about 50 μ L / min, about 60 μ L / min, about 70 μ L / min, about 80 μ L / min, about 90 μ L / min or about 100 μ L / min. In some aspects, the duration of selection (that is, the time of the flow of the composition disclosed herein) can be about 3 minutes, or about 2.5 minutes to about 3.5 minutes, or about 2 minutes to about 4 minutes, or about 1.5 minutes to about 4.5 minutes, or about 1 minute to about 5 minutes. In some aspects, the total volume of a composition disclosed herein that flows to the inner ear can be about 0.09 mL, or about 0.08 mL to about 0.10 mL, or about 0.07 mL to about 0.11 mL.

[0369] In some aspects, a single dose comprises about 0.01 mL-0.2 mL. In some aspects, a single dose comprises about 0.01 mL-0.2 mL, about 0.02 mL-0.18 mL, about 0.03 mL-0.16 mL, about 0.04 mL-0.14 mL, about 0.05 mL-0.13 mL, about 0.06 mL-0.12 mL, about 0.07 mL-0.11 mL, about 0.08 mL-0.10 mL. In some aspects, a single dose comprises about 0.01 mL, about 0.02 mL, about 0.03 mL, about 0.04 mL, about 0.05 mL, about 0.06 mL, about 0.07 mL, about 0.08 mL, about 0.09 mL, about 0.1 mL, about 0.11 mL, about 0.012 mL, about 0.13 mL, about 0.14 mL, about 0.15 mL, about 0.16 mL, about 0.17 mL, about 0.18 mL, about 0.19 mL or about 0.2 mL. In some aspects, a single dose comprises about 0.09 mL.

[0370] In some aspects, the total volume of a composition disclosed herein is equal to about 40% to about 50% of the volume of the inner ear.

[0371] Once delivery is completed, the device can be removed. In some aspects, the device described herein can be configured as a single-use disposable product. In other aspects, the device described herein can be configured as a sterilizable product for multiple uses, for example, with a replaceable and / or sterilizable needle subassembly. The single-use device can be appropriately discarded (e.g., discarded in a biohazard sharps container) after administration is completed.

[0372] In some aspects, the compositions disclosed herein comprise one or more AAV vectors. In some aspects, when more than one AAV vector is included in the composition, the AAV vectors are different. In some aspects, the AAV vector comprises an OTOF coding region, for example, as described herein. In some aspects, the composition comprises rAAV particles containing the AAV vectors described herein. In some aspects, the rAAV particles are encapsidated by Anc80 capsids. In some aspects, the Anc80 capsid comprises a polypeptide of SEQ ID NO: 109.

[0373] Subjects

[0374] In some aspects of any of the methods described herein, the subject or mammal is a rodent, a non-human primate, or a human. In some aspects of any of the methods described herein, the subject or mammal is an adult, a teenager, a juvenile, a child, a toddler, an infant, or a newborn. In some aspects of any of the methods described herein, the subject or mammal is 1 year old to 5 years old, 1 year old to 10 years old, 1 year old to 20 years old, 1 year old to 30 years old, 1 year old to 40 years old, 1 year old to 50 years old, 1 year old to 60 years old, 1 year old to 70 years old, 1 year old to 80 years old, 1 year old to 90 years old, 1 year old to 100 years old, 1 year old to 110 years old, 2 years old to 5 years old, 2 years old to 10 years old, 10 years old to 20 years old, 20 years old to 30 years old, 0 years old, 30-40 years old, 40-50 years old, 50-60 years old, 60-70 years old, 70-80 years old, 80-90 years old, 90-100 years old, 100-110 years old, 10-30 years old, 10-40 years old, 10-50 years old, 10-60 years old, 10-70 years old, 10-80 years old, 10-90 years old, 10-100 years old, 10 20-110, 20-40, 20-50, 20-60, 20-70, 20-80, 20-90, 20-100, 20-110, 30-50, 30-60, 30-70, 30-80, 30-90, 30-100, 40-60, 40-70 , 40-80 years old, 40-90 years old, 40-100 years old, 50-70 years old, 50-80 years old, 50-90 years old, 50-100 years old, 60-80 years old, 60-90 years old, 60-100 years old, 70-90 years old, 70-100 years old, 70-110 years old, 80-100 years old, 80-110 years old, or 90-110 years old. In some aspects of any of the methods described herein, the subject or mammal is 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, or 11 months old. In some aspects, the subject is between 2 and 17 years old.

[0375] In some aspects of any of the methods described herein, the method results in an improvement in hearing (e.g., any metric used to determine an improvement in hearing described herein) in a subject in need thereof for at least 10 days, at least 15 days, at least 20 days, at least 25 days, at least 30 days, at least 35 days, at least 40 days, at least 45 days, at least 50 days, at least 55 days, at least 60 days, at least 65 days, at least 70 days, at least 75 days, at least 80 days, at least 85 days, at least 100 days, at least 105 days, at least 110 days, at least 115 days, at least 120 days, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, or at least 12 months.

[0376] In some aspects, the subject or mammal suffers from non-syndromic sensorineural hearing loss or has the risk of developing non-syndromic sensorineural hearing loss. In some aspects, the subject or mammal has been identified as having a defective otoferlin gene. In some aspects, the subject or mammal has previously been identified as having a sudden change in an otoferlin gene. In some aspects, the subject or mammal has any sudden change in an otoferlin gene associated with non-syndromic sensorineural hearing loss described herein or known in the art.

[0377] In some respects, subject or mammal has been identified as the carrier of otoferlin gene mutation (for example, via gene detection). In some respects, subject or people have been identified as having the mutation in otoferlin gene and have been diagnosed as suffering from non-syndromic sensorineural hearing loss. In some respects, subject or people have been identified as suffering from non-syndromic sensorineural hearing loss.

[0378] In some aspects, any conventional functional hearing test known in the art can be used to determine the successful treatment of non-syndromic sensorineural hearing loss in a subject. Non-limiting examples of functional hearing tests are various types of audiometry (e.g., pure tone test, speech test, middle ear test, auditory brainstem response, and otoacoustic emissions). In some aspects, the use of the composition improves the auditory brainstem response (ABR) threshold response, age-appropriate behavioral audiometry, tympanometric and / or word / sentence recognition test of a subject or mammal.

[0379] Increased expression of active otoferlin

[0380] Also provided herein is a method for increasing the expression of active otoferlin (e.g., full-length otoferlin) in a mammalian cell, comprising introducing any of the compositions described herein into a mammalian cell. In some aspects, the mammalian cell is a cochlear cell. In some aspects, the mammalian cell is an inner ear hair cell. In some aspects, the mammalian cell is a human cell (e.g., human cochlear inner hair cell). In some aspects, the mammalian cell is in vitro. In some aspects, the mammalian cell is in a mammal. In some aspects, the mammalian cell is initially obtained from a mammal and / or is cultured in vitro. In some aspects, the mammalian cell has previously been determined to have a defective otoferlin gene.

[0381] Methods for introducing any of the compositions described herein into mammalian cells are known in the art (eg, using a viral vector, eg, any of the viral vectors described herein).

[0382] In some aspects, expression of an active otoferlin (eg, full-length otoferlin) as described herein is increased, eg, compared to a control or the expression level of an active otoferlin (eg, full-length otoferlin) prior to introduction of the vector.

[0383] Methods for detecting otoferlin

[0384] Methods for detecting the expression and / or activity of otoferlin are known in the art. In some aspects, the expression level of otoferlin can be directly detected (e.g., detecting otoferlin or detecting otoferlin mRNA). Non-limiting examples of techniques that can be used to directly detect the expression and / or activity of otoferlin include: real-time PCR, Western blot, immunoprecipitation, immunohistochemistry, or immunofluorescence. In some aspects, the expression of otoferlin can be detected indirectly (e.g., by functional hearing test).

[0385] Dosing and administration volume

[0386] In some aspects, the compositions disclosed herein are administered in a single dose or in multiple doses. In some aspects, the compositions are administered in a single dose.

[0387] In some aspects, the composition is administered in multiple doses. In some aspects, the composition is administered in 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses.

[0388] In some aspects, the composition is administered as a single injection. In some aspects, the composition is administered as multiple injections. In some aspects, the composition is administered as 2, 3, 4, 5, 6, 7, 8, 9, or 10 injections.

[0389] In some aspects, the compositions disclosed herein (e.g., compositions comprising one or more AAV vectors disclosed herein) are administered in the following volumes: about 0.01 mL, about 0.02 mL, about 0.03 mL, about 0.04 mL, about 0.05 mL, about 0.06 mL, about 0.07 mL, about 0.08 mL, about 0.09 mL, about 1.00 mL, about 1.10 mL, about 1.20 mL, about 1.30 mL, about 1.40 mL, about 1.50 mL, about 1.60 mL, about 1.70 mL, about 1.80 mL, about 1.90 mL, or about 2.00 mL. In some aspects, the compositions disclosed herein are administered in a volume of about 0.01 mL. In some aspects, the compositions disclosed herein are administered in a volume of about 0.02 mL. In some aspects, the compositions disclosed herein are administered in a volume of about 0.03 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 0.04 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 0.05 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 0.06 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 0.07 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 0.08 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 0.09 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 1.00 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 1.10 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 1.20 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 1.30 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 1.40 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 1.50 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 1.60 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 1.70 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 1.80 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 1.90 mL. In some aspects, the compositions disclosed herein are administered at a volume of about 2.00 mL.

[0390] In some aspects, a composition disclosed herein (e.g., a composition comprising one or more AAV vectors disclosed herein) is administered in a volume of about 0.01 mL to 2.00 mL, about 0.02 mL to 1.90 mL, about 0.03 mL to 1.8 mL, about 0.04 mL to 1.70 mL, about 0.05 mL to 1.60 mL, about 0.06 mL to 1.50 mL, about 0.06 mL to 1.40 mL, about 0.07 mL to 1.30 mL, about 0.08 mL to 1.20 mL, or about 0.09 mL to 1.10 mL. In some aspects, a composition disclosed herein (e.g., a composition comprising one or more AAV vectors disclosed herein) is administered in a volume of about 0.01 mL to 2.00 mL, about 0.02 mL to 2.00 mL, about 0.03 mL to 2.00 mL, about 0.04 mL to 2.00 mL, about 0.05 mL to 2.00 mL, about 0.06 mL to 2.00 mL, about 0.07 mL to 2.00 mL, about 0.08 mL to 2.00 mL, about 0.09 mL to 2.00 mL, about 0.10 mL to 2.00 mL, about 0.11 mL to 2.00 mL, about 0.12 mL to 2.00 mL, about 0.13 mL to 2.00 mL, about 0.14 mL to 2.00 mL, about 0.15 mL to 2.00 mL, about 0.16 mL to 2.00 mL, about 0.17 mL to 2.00 mL, about 0.18 mL to 2.00 mL, about 0.19 mL to 2.00 mL mL to 2.00 mL, about 0.01 mL to 1.90 mL, about 0.01 mL to 1.80 mL, about 0.01 mL to 1.70 mL, about 0.01 mL to 1.60 mL, about 0.01 mL to 1.50 mL, about 0.01 mL to 1.40 mL, about 0.01 mL to 1.30 mL, about 0.01 mL to 1.20 mL, about 0.01 mL to 1.10 mL, about 0.01 mL to 1.00 mL, about 0.01 mL to 0.09 mL.

[0391] In some aspects, a single dose comprises about 0.01 mL-0.2 mL. In some aspects, a single dose comprises about 0.01 mL-0.2 mL, about 0.02 mL-0.18 mL, about 0.03 mL-0.16 mL, about 0.04 mL-0.14 mL, about 0.05 mL-0.13 mL, about 0.06 mL-0.12 mL, about 0.07 mL-0.11 mL, or about 0.08 mL-0.10 mL. In some aspects, a single dose comprises about 0.01 mL, about 0.02 mL, about 0.03 mL, about 0.04 mL, about 0.05 mL, about 0.06 mL, about 0.07 mL, about 0.08 mL, about 0.09 mL, about 0.1 mL, about 0.11 mL, about 0.012 mL, about 0.13 mL, about 0.14 mL, about 0.15 mL, about 0.16 mL, about 0.17 mL, about 0.18 mL, about 0.19 mL or about 0.2 mL. In some aspects, a single dose comprises about 0.09 mL.

[0392] preparation

[0393] Also provided herein are formulations comprising any of the compositions herein.

[0394] In some aspects, the compositions of the present disclosure comprise a) a first recombinant adeno-associated virus (rAAV) vector genome (vg), comprising a first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of an otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome, comprising a second expression cassette comprising a nucleic acid sequence comprising the 3′ portion of an otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition comprises approximately 4.1E10-8.1E12 total vg.

[0395] In some aspects, the compositions of the present disclosure comprise a) a first recombinant adeno-associated virus (rAAV) vector genome (vg), comprising a first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of an otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome, comprising a second expression cassette comprising a nucleic acid sequence comprising the 3′ portion of an otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition comprises about 4.1E10-4.1E12 total vg or about 8.1E10-8.1E12 total vg.

[0396] In some aspects, the compositions of the present disclosure comprise (a) a first rAAV vector genome comprising a first expression cassette comprising a promoter, a first coding sequence encoding an N-terminal portion of otoferlin located 3' to the promoter, and a splice donor signal sequence located 3' to the first coding sequence; and (b) a second rAAV vector genome comprising a second expression cassette comprising a splice acceptor signal sequence, a second coding sequence encoding a C-terminal portion of otoferlin located 3' to the splice acceptor signal sequence, and a polyadenylation sequence located 3' to the second coding sequence, wherein the composition is formulated for intracochlear administration.

[0397] In some aspects, the compositions of the present disclosure comprise a) a first recombinant adeno-associated virus (rAAV) vector genome (vg) comprising a first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5' portion of an otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeats (ITRs); and b) a second rAAV vector genome comprising a second expression cassette comprising a nucleic acid sequence comprising the 3' portion of an otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition is formulated for intracochlear administration. In some aspects, the composition comprises a first rAAV vector genome and a second rAAV vector genome in a ratio of about 1:1.

[0398] In some aspects, the composition comprises about 4.1E10-8.1E12 total vg. In some aspects, the composition comprises about 4.1E10-4.1E12 total vg or about 8.1E10-8.1E12 total vg.

[0399] In some aspects, the composition comprises about 4.1E10-4.1E12, about 5.1E10-3.1E12, about 6.1E10-2.1E12, about 7.1E10-1.1E12, about 8.1E10-10.1E11, about 9.1E10-9.1E11, about 10.1E11-8.1E11, about 1.1E11-7.1E11, about 2.1E11-6.1E11, or about 3.1E11-5.1E11 total vg. In some aspects, the composition comprises about 3.1E11-5.1E11, about 3.2E11-5.0E11, about 3.3E11-4.9E11, about 3.4E11-4.8E11, about 3.5E11-4.7E11, about 3.6E11-4.6E11, about 3.7E11-4.5E11, about 3.8E11-4.4E11, about 3.9E11-4.3E11, or about 4.0E11-4.2E11 total vg. In some aspects, the composition comprises about 4.1E11 total vg.

[0400] In some aspects, the composition comprises about 4.1E10-8.1E12 total vg / cochlea. In some aspects, the composition comprises about 4.1E10-4.1E12 total vg / cochlea or about 8.1E10-8.1E12 total vg / cochlea.

[0401] In some aspects, the composition comprises about 4.1E10-4.1E12, about 5.1E10-3.1E12, about 6.1E10-2.1E12, about 7.1E10-1.1E12, about 8.1E10-10.1E11, about 9.1E10-9.1E11, about 10.1E11-8.1E11, about 1.1E11-7.1E11, about 2.1E11-6.1E11, or about 3.1E11-5.1E11 total vg / cochlea. In some aspects, the composition comprises about 3.1E11-5.1E11, about 3.2E11-5.0E11, about 3.3E11-4.9E11, about 3.4E11-4.8E11, about 3.5E11-4.7E11, about 3.6E11-4.6E11, about 3.7E11-4.5E11, about 3.8E11-4.4E11, about 3.9E11-4.3E11, or about 4.0E11-4.2E11 total vg / cochlea. In some aspects, the composition comprises about 4.1E11 total vg / cochlea.

[0402] In some aspects, the composition comprises about 3.0E11, about 3.1E11, about 3.2E11, about 3.3E11, about 3.4E11, about 3.5E11, about 3.6E11, about 3.7E11, about 3.8E11, about 3.9E11, about 4.0E11, about 4.1E11, about 4.2E11, about 4.3E11, about 4.4E11, about 4.5E11, about 4.6E11, about 4.7E11, about 4.8E11, about 4.9E11, about 5.0E11, about 5.1E11, about 5.2E11, about 5.3E11, about 5.4E11, about 5.5E11, about 5.6E11, about 5.7E11, about 5.8E11, about 5.9 E11, about 6.0E11, about 6.1E11, about 6.2E11, about 6.3E11, about 6.4E11, about 6.5E11, about 6.6E11, about 6.7E11, about 6.8E11, about 6.9E11, about 7.0E11, about 7.1E11, about 7.2E11, about 7.3E11, about 7.4E11 , about 7.5E11, about 7.6E11, about 7.7E11, about 7.8E11, about 7.9E11, about 8.0E11, about 8.1E11, about 8.2E11, about 8.3E11, about 8.4E11, about 8.5E11, about 8.6E11, about 8.7E11, about 8.8E11 or about 8.9E11 total vg.

[0403] In some aspects, the composition comprises about 3.0E11, about 3.1E11, about 3.2E11, about 3.3E11, about 3.4E11, about 3.5E11, about 3.6E11, about 3.7E11, about 3.8E11, about 3.9E11, about 4.0E11, about 4.1E11, about 4.2E11, about 4.3E11, about 4.4E11, about 4.5E11, about 4.6E11, about 4.7E11, about 4.8E11, about 4.9E11, about 5.0E11, about 5.1E11, about 5.2E11, about 5.3E11, about 5.4E11, about 5.5E11, about 5.6E11, about 5.7E11, about 5.8E11, about 5.9E11 11, about 6.0E11, about 6.1E11, about 6.2E11, about 6.3E11, about 6.4E11, about 6.5E11, about 6.6E11, about 6.7E11, about 6.8E11, about 6.9E11, about 7.0E11, about 7.1E11, about 7.2E11, about 7.3E11, about 7.4E11, about 7.5E11, about 7.6E11, about 7.7E11, about 7.8E11, about 7.9E11, about 8.0E11, about 8.1E11, about 8.2E11, about 8.3E11, about 8.4E11, about 8.5E11, about 8.6E11, about 8.7E11, about 8.8E11 or about 8.9E11 total vg / cochlea.

[0404] In some aspects, the composition comprises about 8.1E10-8.1E12, about 9.1E10-7.1E12, about 10.1E10-6.1E12, about 1.1E11-5.1E12, about 2.1E11-4.1E12, about 3.1E11-3.1E12, about 4.1E11-2.1E12, about 5.1E11-1.1E12, about 6.1E11-10.1E11, or about 7.1E11-9.1E11 total vg. In some aspects, the composition comprises about 7.1E11-9.1E11, about 7.2E11-9.0E11, about 7.3E11-8.9E11, about 7.4E11-8.8E11, about 7.5E11-8.7E11, about 7.6E11-8.6E11, about 7.7E11-8.5E11, about 7.8E11-8.4E11, about 7.9E11-8.3E11, or about 8.0E11-8.2E11 total vg. In some aspects, the composition comprises about 8.1E11 total vg.

[0405] In some aspects, the composition comprises about 8.1E10-8.1E12, about 9.1E10-7.1E12, about 10.1E10-6.1E12, about 1.1E11-5.1E12, about 2.1E11-4.1E12, about 3.1E11-3.1E12, about 4.1E11-2.1E12, about 5.1E11-1.1E12, about 6.1E11-10.1E11, or about 7.1E11-9.1E11 total vg / cochlea. In some aspects, the composition comprises about 7.1E11-9.1E11, about 7.2E11-9.0E11, about 7.3E11-8.9E11, about 7.4E11-8.8E11, about 7.5E11-8.7E11, about 7.6E11-8.6E11, about 7.7E11-8.5E11, about 7.8E11-8.4E11, about 7.9E11-8.3E11, or about 8.0E11-8.2E11 total vg / cochlea. In some aspects, the composition comprises about 8.1E11 total vg / cochlea.

[0406] In some aspects, the concentration of the composition comprises about 4.5E11-9E13 total vg / mL. In some aspects, the concentration of the composition comprises about 4.5E11-4.5E13 total vg / mL or about 9E11-9E13 total vg / mL. In some aspects, the concentration of the composition comprises about 4.5E11-4.5E13 total vg / mL. In some aspects, the concentration of the composition comprises about 5.5E11-3.5E13, about 6.5E11-2.5E13, about 7.5E11-1.5E13, about 8.5E11-10.5E12, about 9.5E11-9.5E12, about 10.5E11-8.5E12, about 1.5E12-7.5E12, about 2.5E12-6.5E12, or about 3.5E12-5.5E12 total vg / mL. In some aspects, the concentration of the composition comprises about 3.5E12-5.5E12, about 3.6E12-5.4E12, about 3.7E12-5.3E12, about 3.8E12-5.2E12, about 3.9E12-5.1E12, about 4.0E12-5.0E12, about 4.1E12-4.9E12, about 4.2E12-4.8E12, about 4.3E12-4.7E12, or about 4.4E12-4.6E12 total vg / mL. In some aspects, the concentration of the composition comprises about 4.5E12 total vg / mL.

[0407] In some aspects, the concentration of the composition comprises about 3.5E12, about 3.6E12, about 3.7E12, about 3.8E12, about 3.9E12, about 4.0E12, about 4.1E12, about 4.2E12, about 4.3E12, about 4.4E12, about 4.5E12, about 4.6E12, about 4.7E12, about 4.8E12, about 4.9E12, about 5.0E12, about 5.1E12, about 5.2E12, about 5.3E12, about 5.4E12, about 5.5E12, about 5.6E12, about 5.7E12, about 5.8E12, about 5.9E12, about 6.0E12, about 6.1E12, about 6.2E12, about 6.3E12, about 6.4E12, about 6.5E12, about 6.6E12, about 6.7E12, about 6.8E12, about 6.9E12, about 7.0E12, about 7.1E12, about 7.2E12, about 7.3E12, about 7.4E12, about 7.5E12, about 7.6E12, about 7.7E12, about 7.8E12, about 7.9E12, about 8.0E12, about 8.1E12, about 8.2E12, about 8.3E12 , about 8.4E12, about 8.5E12, about 8.6E12, about 8.7E12, about 8.8E12, about 8.9E12, about 9.0E12, about 9.1E12, about 9.2E12, about 9.3E12, about 9.4E12, about 9.5E12, about 9.6E12, about 9.7E12, about 9.8E12 or about 9.9E12 total vg / mL.

[0408] In some aspects, the concentration of the composition comprises about 9E11-9E13 total vg / mL. In some aspects, the concentration of the composition comprises about 9E11-9E13, about 10E11-8E13, about 1E12-7E13, about 2E12-6E13, about 3E12-5E13, about 4E12-4E13, about 5E12-3E13, about 6E12-2E13, about 7E12-1E13, or about 8E12-10E12 total vg / mL. In some aspects, the concentration of the composition comprises about 8E12-10E12, about 8.1E12-9.9E12, about 8.2E12-9.8E12, about 8.3E12-9.7E12, about 8.4E12-9.6E12, about 8.5E12-9.5E12, about 8.6E12-9.4E12, about 8.7E12-9.3E12, about 8.8E12-9.2E12, or about 8.9E12-9.1E12. In some aspects, the concentration of the composition comprises 9E12 total vg / mL.

[0409] The pharmaceutical compositions of the present disclosure may comprise a rAAV vector as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients.

[0410] In some aspects, the composition may include a buffer such as neutral buffered saline, phosphate buffered saline, potassium dihydrogen phosphate, sodium dihydrogen phosphate, potassium chloride, sodium chloride, Tris HCl, Tris base, histidine, boric acid, citric acid, glycine, HEPES, and MOPS; a carbohydrate such as glucose, mannose, sucrose, or dextran; mannitol; a protein; a polypeptide or an amino acid such as glycine; an antioxidant; a chelating agent such as EDTA or glutathione; an adjuvant (e.g., aluminum hydroxide); a surfactant such as poloxamer 188, labatsol, Tween, ethanol, Pluronic F68, and polyethylene glycol; and a preservative.

[0411] In some respects, compositions comprises one or more buffers and one or more surfactants. In some respects, buffer is selected from potassium dihydrogen phosphate, sodium hydrogen phosphate, potassium chloride, sodium chloride, TrisHCl, Tris alkali, histidine, boric acid, citric acid, glycine, HEPES and MOPS. In some respects, surfactant is selected from poloxamer 188, Labasso, Tween, ethanol, Pluronic F68 and polyethylene glycol.

[0412] In some aspects, the composition comprises potassium dihydrogen phosphate, sodium dihydrogen phosphate, potassium chloride, sodium chloride, and poloxamer 188. In some aspects, the composition comprises a) about 1.35 mM-1.65 mM potassium dihydrogen phosphate; b) about 7.29 mM-8.91 mM sodium dihydrogen phosphate; c) about 2.43 mM-2.97 mM potassium chloride; d) about 154.8 mM-189.2 mM sodium chloride; and e) about 0.0001%-0.01% poloxamer 188.

[0413] In some aspects, the composition comprises a) about 1.35 mM, about 1.375 mM, about 1.4 mM, about 1.425 mM, about 1.45 mM, about 1.475 mM, about 1.5 mM, about 1.525 mM, about 1.55 mM, about 1.575 mM, about 1.6 mM, about 1.625 mM, or about 1.65 mM potassium phosphate monobasic; b) about 7.29 mM, about 7.4 mM, about 7.5 mM about 7.6 mM, about 7.7 mM about 7.8 mM, about 7.9 mM, about 8.0 mM, about 8.1 mM, about 8.2 mM, about 8.3 mM, about 8.4 mM, about 8.5 mM, about 8.6 mM, about 8.7 mM, about 8.8 mM, or about 8.91 mM sodium phosphate dibasic; c) about 2.43 mM, about 2.5 mM, about 2.55 mM, about 2.6 mM, about 2.65 mM, about 2.7 mM, about 2.75 mM, about 2.8 mM, about 2.85 mM, about 2.9 mM, about 2.95 mM, or about 2.97 mM potassium chloride; d) about 154.8 mM, about 160 mM, about 165 mM, about 170 mM, about 175 mM, about 180 mM, about 185 mM, or about 189.2 mM sodium chloride, and e) about 0.0001%, about 0.00025%, about 0.0005%, about 0.00075%, about 0.001%, about 0.0025%, about 0.005%, about 0.0075%, or about 0.01% poloxamer 188.

[0414] In some aspects, the composition comprises a) about 1.5 mM potassium phosphate monobasic; b) about 8.1 mM sodium phosphate dibasic; c) about 2.7 mM potassium chloride; d) about 172 mM sodium chloride; and e) about 0.001% poloxamer 188.

[0415] In some aspects, the composition is formulated as a sterile suspension. In some aspects, the sterile suspension comprises a pharmaceutically acceptable carrier. In some aspects, the suspension comprises sterile water. In some aspects, the composition comprises a volume of about 0.01mL to 0.2mL. In some aspects, the composition comprises a volume of about 0.01mL-0.2mL, about 0.02mL-0.18mL, about 0.03mL-0.16mL, about 0.04mL-0.14mL, about 0.05mL-0.13mL, about 0.06mL-0.12mL, about 0.07mL-0.11mL, about 0.08mL-0.10mL. In some aspects, a single dose comprises about 0.01 mL, about 0.02 mL, about 0.03 mL, about 0.04 mL, about 0.05 mL, about 0.06 mL, about 0.07 mL, about 0.08 mL, about 0.09 mL, about 0.1 mL, about 0.11 mL, about 0.012 mL, about 0.13 mL, about 0.14 mL, about 0.15 mL, about 0.16 mL, about 0.17 mL, about 0.18 mL, about 0.19 mL or about 0.2 mL. In some aspects, the composition comprises a volume of about 0.09 mL.

[0416] In some aspects, the compositions of the present disclosure are formulated for intracochlear administration. In some aspects, the compositions of the present disclosure are formulated for intravenous administration.

[0417] In some respects, compositions is formulated to comprise synthetic perilymph.In some respects, synthetic perilymph comprises one or more buffers and one or more surfactants.In some respects, buffer is selected from potassium dihydrogen phosphate, sodium hydrogen phosphate, potassium chloride, sodium chloride, Tris HCl, Tris alkali, histidine, boric acid, citric acid, glycine, HEPES and MOPS.In some respects, surfactant is selected from poloxamer 188, labasso, tween, ethanol, pluronic F68 and polyethylene glycol.

[0418] In some aspects, the synthetic perilymph fluid comprises monopotassium phosphate, disodium phosphate, potassium chloride, sodium chloride, and poloxamer 188. In some aspects, the synthetic perilymph fluid comprises a) about 1.35 mM-1.65 mM monopotassium phosphate; b) about 7.29 mM-8.91 mM disodium phosphate; c) about 2.43 mM-2.97 mM potassium chloride; d) about 154.8 mM-189.2 mM sodium chloride; and e) about 0.0001%-0.01% poloxamer 188.

[0419] In some aspects, the synthetic perilymph comprises a) about 1.35 mM, about 1.375 mM, about 1.4 mM, about 1.425 mM, about 1.45 mM, about 1.475 mM, about 1.5 mM, about 1.525 mM, about 1.55 mM, about 1.575 mM, about 1.6 mM, about 1.625 mM, or about 1.65 mM monohydrogen phosphate; b) about 7.29mM, about 7.4mM, about 7.5mM, about 7.6mM, about 7.7mM, about 7.8mM, about 7.9mM, about 8.0mM, about 8.1mM, about 8.2mM, about 8.3mM, about 8.4mM, about 8.5mM, about 8.6mM, about 8.7mM, about 8.8mM or about 8.91mM dihydrogen phosphate c) about 2.43 mM, about 2.5 mM, about 2.55 mM, about 2.6 mM, about 2.65 mM, about 2.7 mM, about 2.75 mM, about 2.8 mM, about 2.85 mM, about 2.9 mM, about 2.95 mM or about 2.97 mM potassium chloride; d) about 154.8 mM, about 160 mM, about 165 mM, about 17 0 mM, about 175 mM, about 180 mM, about 185 mM or about 189.2 mM sodium chloride, and e) about 0.0001%, about 0.00025%, about 0.0005%, about 0.00075%, about O.001%, about 0.0025%, about 0.005%, about 0.0075% or about 0.01% Poloxamer 188.

[0420] In some aspects, the synthetic perilymph fluid comprises a) about 1.5 mM potassium phosphate monobasic; b) about 8.1 mM sodium phosphate dibasic; c) about 2.7 mM potassium chloride; d) about 172 mM sodium chloride; and e) about 0.001% poloxamer 188.

[0421] In some aspects, the compositions described herein may further comprise one or more agents (e.g., liposomes or cationic lipids) that facilitate entry of nucleic acids or any vectors described herein into mammalian cells. In some aspects, natural and / or synthetic polymers may be used to formulate any of the vectors described herein. Non-limiting examples of polymers that may be included in any of the compositions described herein may include, but are not limited to, DYNAMIC (Arrowhead Research Corp., Pasadena, Calif.), formulations from Mirus Bio (Madison, Wis.) and Roche Madison (Madison, Wis.), PhaseRX polymer formulations such as, but not limited to, SMARTT POLYMER (PhaseRX, Seattle, Wash.), DMRI / DOPE, poloxamer, and Adjuvants, chitosan, cyclodextrins from Calando Pharmaceuticals (Pasadena, Calif.), dendrimers and poly(lactic-co-glycolic acid) (PLGA) polymers, RONDEL™ (RNAi / oligonucleotide nanoparticle delivery) polymers (Arrowhead Research Corporation, Pasadena, Calif.), and pH-responsive co-block polymers such as, but not limited to, those produced by PhaseRX (Seattle, Wash.). pH-responsive co-block polymers such as, but not limited to, those produced by PhaseRX (Seattle, Wash.). Many of these polymers have demonstrated efficacy in delivering oligonucleotides to mammalian cells in vivo (see, e.g., deFougerolles, Human Gene Ther. 19: 125-132, 2008; Rozema et al., Proc. Natl. Acad. Sci. USA 104: 12982-12887, 2007; Rozema et al., Proc. Natl. Acad. Sci. USA 104: 12982-12887, 2007; Hu-Lieskovan et al., Cancer Res. 65: 8984-8982, 2005; Heidel et al., Proc. Natl. Acad. Sci. USA 104: 5715-5721, 2007). Any composition described herein can be, for example, a pharmaceutical composition.

[0422] In some aspects, the composition comprises a pharmaceutically acceptable carrier (e.g., phosphate buffered saline, saline or bacteriostatic water). When formulated, the solution will be administered in a manner compatible with the dosage formulation and in a therapeutically effective amount. The formulation is easily administered in a variety of dosage forms such as injectable solutions, injectable gels, drug release capsules, etc.

[0423] The compositions provided herein can be formulated, for example, to be compatible with their intended route of administration.A non-limiting example of an intended route of administration is topical administration (eg, intracochlear administration).

[0424] Also provided herein is a medicine box comprising any composition described herein. In some aspects, the medicine box may include a solid composition (e.g., a lyophilized composition comprising at least two different carriers described herein) and a liquid for solubilizing the lyophilized composition. In some aspects, the medicine box may include a pre-loaded syringe comprising any composition described herein.

[0425] In some aspects, the kit may include a composition pre-loaded in a device. In some aspects, the device is a microcatheter. In some aspects, the microcatheter is shaped so that it can enter the middle ear cavity through the external auditory canal and contact the end of the microcatheter with the RWM. In some aspects, the distal end of the microcatheter is composed of at least one microneedle with a diameter between 10 microns and 1,000 microns.

[0426] In some aspects, the kit can include a device. In some aspects, the device is a device provided herein. In some aspects, the device is Figure 2-Figure 5 In some aspects, the device comprises a needle comprising a curved portion and an angled tip.

[0427] In some aspects, the kit includes a vial containing any composition described herein (eg, formulated as an aqueous composition, eg, an aqueous pharmaceutical composition). In some aspects, the vial is a single-use vial or a multiple-use vial.

[0428] In some aspects, the vial is a single-use vial. In some aspects, the single-use vial contains a composition having a concentration suitable for intracochlear administration (target concentration). In some aspects, the target concentration is about 4.5E11-9E13 vg / mL. In some aspects, the target concentration is about 1E13 total vg / mL.

[0429] In some aspects, the kit includes a second vial containing a diluent. In some aspects, the second vial is a single-use vial or a multiple-use vial. In some aspects, the diluent includes one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients of the composition. In some aspects, the concentration of one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients of the composition is equivalent to the concentration of one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients contained in the composition. In some aspects, the diluent includes a) about 1.5mM potassium dihydrogen phosphate; b) about 8.1mM sodium dihydrogen phosphate; c) about 2.7mM potassium chloride; d) about 172mM sodium chloride; and e) about 0.001% poloxamer 188. In some aspects, the diluent is used to prepare the concentration of the composition to be administered to a subject in need.

[0430] In some aspects, the medicine box may include instructions for carrying out any method described herein. The drug form suitable for injection includes sterile aqueous solution or dispersion and sterile powder for temporary preparation of sterile injectable solution or dispersion. Dispersion can also be prepared in glycerol, liquid polyethylene glycol and mixture thereof and in oil. Under general storage and use conditions, these preparations contain preservatives to prevent microbial growth. In many cases, the form is sterile and is a fluid that reaches a degree of ease of injection. It must be stable under manufacturing and storage conditions and must protect it from the contamination of microorganisms such as bacteria and fungi. The carrier can be a solvent or a dispersion medium, which contains, for example, water, ethanol, polyols (for example, glycerol, propylene glycol and liquid polyethylene glycol, etc.), suitable mixtures and / or vegetable oils. Suitable fluidity can be maintained, for example, by using a coating (such as lecithin), by maintaining the desired particle size in the case of a dispersion and by using a surfactant. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0431] For the administration of injectable aqueous solutions, for example, the solution may be appropriately buffered if necessary, and the liquid diluent may first be made isotonic with enough saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this regard, the sterile aqueous medium that can be adopted will be known to those skilled in the art. For example, a dose may be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous injection or injected at the infusion site of suggestion (see, for example, "Remington's Pharmaceutical Sciences'" 15th edition, pages 1035-1038 and 1570-1580). Depending on the condition of the host, some changes will inevitably occur in the dosage. In any case, the person responsible for administration will determine the appropriate dosage of the individual host.

[0432] Sterile injectable solutions are prepared by incorporating the required amount of active rAAV in an appropriate solvent along with the various other ingredients listed herein, as desired, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle containing a basic dispersion medium and the required other ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying techniques and freeze drying techniques, thereby producing a powder of the active ingredient plus any additional desired ingredients from a previously sterile-filtered solution thereof.

[0433] The rAAV compositions disclosed herein may also be formulated as neutral or salt forms. Pharmaceutically acceptable salts include acid addition salts (formed by free amino groups of proteins) and are formed by inorganic acids (such as, for example, hydrochloric acid or phosphoric acid) or organic acids (such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.). Salts formed with free carboxyl groups may also be derived from inorganic bases, such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide or ferric hydroxide, and organic bases, such as isopropylamine, trimethylamine, histidine, procaine, etc. When formulated, the solution will be administered in a manner compatible with the dosage formulation and in a therapeutically effective amount. The preparation is easily administered in a variety of dosage forms such as injectable solutions, drug release capsules, etc.

[0434] Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc. can be used to introduce the compositions of the present disclosure into suitable host cells. In particular, the transgene delivered by the rAAV vector can be formulated for delivery encapsulated in lipid particles, liposomes, vesicles, nanospheres or nanoparticles, etc.

[0435] Such preparations may preferably be used to introduce pharmaceutically acceptable preparations of nucleic acids or rAAV constructs disclosed herein. The formation and use of liposomes are generally known to those skilled in the art. Recently, liposomes with improved serum stability and circulation half-life have been developed (U.S. Patent No. 5,741,516). In addition, various methods of liposomes and liposome-like preparations as potential drug carriers have been described (U.S. Patent Nos. 5,567,434; 5,552,157; ​​5,565,213; 5,738,868 and 5,795,587).

[0436] In addition to the delivery methods described above, the following technologies are also contemplated as alternative methods for delivering rAAV compositions to a host. Ultrasound introduction (i.e., ultrasound) has been used and described in U.S. Pat. No. 5,656,016 as a device for enhancing the rate and efficacy of drug penetration into and through the circulatory system. Other drug delivery alternatives contemplated are intraosseous injection (U.S. Pat. No. 5,779,708), microchip devices (U.S. Pat. No. 5,797,898), ophthalmic preparations (Bourlais et al., 1998), transdermal matrix (U.S. Pat. Nos. 5,770,219 and 5,783,208), and feedback-controlled delivery (U.S. Pat. No. 5,697,899).

[0437] The administration of the subject composition can be carried out in any convenient manner, including by aerosol inhalation, injection, ingestion, infusion, implantation or transplantation. Compositions as described herein can be administered to a subject via an artery, subcutaneously, intradermally, intrasegmentally, intramedullary, intramuscularly, by intravenous (iv) injection or intraperitoneal administration. In one aspect, nucleic acid compositions of the present disclosure are administered to a subject by intradermal or subcutaneous injection. In one aspect, nucleic acid compositions of the present disclosure are administered by intravenous injection.

[0438] Device and surgical method

[0439] Provided herein are technologies (e.g., systems, methods, devices, etc.) that can be used in some aspects to treat deafness and other hearing-related diseases, disorders, and illnesses. Examples of such technologies are also included in, for example, WO2017223193 and WO2019084145, each of which is incorporated herein by reference in its entirety. In one aspect, the present disclosure provides a therapeutic delivery system for treating deafness and other hearing-related diseases, disorders, and illnesses. In one aspect, a therapeutic delivery system is provided, comprising i) a medical device capable of producing one or more incisions in the round window membrane of the inner ear of a human subject in need, and ii) an effective dose of a therapeutic composition comprising one or more adeno-associated virus (AAV) vectors, wherein one or more AAV vectors are capable of constituting full-length auditory polypeptide messenger RNA in target cells of the inner ear. In some aspects of the components for performing a surgical method, the method comprises the following steps: administering an effective dose of a therapeutic composition of the present disclosure to a human subject in need of the cochlea, wherein the therapeutic composition can be administered by using a medical device comprising: a) a component for producing one or more incisions in the round window membrane; and b) an effective dose of a therapeutic composition.

[0440] Provided herein is a surgical method for treating hearing loss. In one aspect, the method comprises the following steps: introducing the first incision into the cochlea of ​​a human subject at the first incision point; and applying an effective dose of a therapeutic composition as provided herein (e.g., any composition described herein) in the cochlea. In one aspect, a therapeutic composition (e.g., any composition described herein) is applied to a subject at the first incision point. In one aspect, a therapeutic composition is applied to or through the first incision of a subject. In one aspect, a therapeutic composition is applied to or through the oval window membrane of the cochlea of ​​a subject. In one aspect, a therapeutic composition is applied to or through the oval window membrane of the cochlea of ​​a subject. In one aspect, a therapeutic composition is applied to or through the round window membrane of the cochlea of ​​a subject.

[0441] In some aspects, the compositions disclosed herein can be applied to a subject by a surgical procedure. In some aspects, application (e.g., via a surgical procedure) includes injecting the compositions disclosed herein into the inner ear via a delivery device as described herein. In some aspects, the surgical procedures disclosed herein include: performing a trans-canal myringotomy; performing a laser-assisted micro-stapediotomy; and injecting the compositions disclosed herein into the inner ear via a delivery device as described herein.

[0442] In some aspects, the surgical procedure comprises: performing a transcanal myringotomy; performing a laser-assisted microstapedostomy; injecting a composition disclosed herein into the inner ear via a delivery device as described herein; applying a sealant around the round window and / or oval window of the subject; and lowering the subject's tympanic membrane ear canal flap to an anatomical position.

[0443] In some aspects, the surgical procedure includes: performing a transcanal myringotomy; preparing a round window in a subject; performing a laser-assisted microstapedostomy; preparing a delivery device as described herein and a composition disclosed herein for delivery to the inner ear; injecting a composition disclosed herein into the inner ear via the delivery device; applying a sealant around the round window and / or oval window of the subject; and lowering the tympanic membrane ear canal flap of the subject to the anatomical position.

[0444] In some aspects, performing the laser-assisted microstapedostomy comprises using a KTP otologic laser and / or a CO2 otologic laser.

[0445] In some embodiments, the composition comprises one or more AAV vectors. In some aspects, when more than one AAV vector is included in the composition, the AAV vectors are different. In some aspects, the AAV vector comprises an OTOF coding region, for example, as described herein. In some aspects, the composition comprises rAAV particles containing the AAV vectors described herein. In some aspects, the rAAV particles are encapsidated by Anc80 capsids. In some aspects, the Anc80 capsid comprises a polypeptide of SEQ ID NO: 109.

[0446] For example, in one aspect, a therapeutic composition is administered using a medical device capable of creating multiple incisions in a round window membrane. In one aspect, the medical device comprises a plurality of microneedles. In one aspect, the medical device comprises a plurality of microneedles comprising a generally circular first aspect, wherein each microneedle has a diameter of at least about 10 microns. In one aspect, the medical device comprises a base and / or a reservoir capable of accommodating a therapeutic composition. In one aspect, the medical device comprises a plurality of hollow microneedles, each of which individually comprises an inner cavity capable of transferring a therapeutic composition. In one aspect, the medical device comprises a member for generating at least a partial vacuum.

[0447] For another example, the compositions disclosed herein are administered using a device and / or system specifically designed for the intracochlear route of administration. In some aspects, design elements of the devices described herein may include: maintaining sterility of the injection fluid; minimizing the introduction of air bubbles into the inner ear; the ability to precisely deliver small volumes at a controlled rate; delivery by a surgeon through the external auditory canal; minimizing damage to the round window membrane (RWM) or the inner ear (e.g., cochlear structures outside the RWM); and / or minimizing injection fluid leaking back through the RWM.

[0448] The devices, systems and methods provided herein also describe the potential for delivering compositions safely and effectively to the inner ear for treating diseases and conditions (including but not limited to, for example, hearing impairment as described herein) that will benefit from the delivery of compositions disclosed herein to the inner ear. For another example, by placing a vent in the stapes footplate and injecting through the RWM, the compositions disclosed herein are dispersed throughout the cochlea in a manner with minimal dilution at the site of action. The device described in the development allows surgical application procedures to be performed through the external auditory canal of the person. After a certain amount of fluid is infused into the perilymph of the cochlea, the described device can be taken out from the ear. In a subject, the device can be advanced through the external auditory canal under the control of an operating microscope or together with an endoscope.

[0449] Exemplary apparatus for use with any of the methods disclosed herein are described in Figure 2-Figure 5 middle. Figure 2 An exemplary device 10 for delivering fluid to the inner ear is shown. The device 10 includes a convex handle 12 and a distal handle adhesive 14 (e.g., epoxy, such as loctite 4014) coupled to a telescopic hypotube needle support 24. The convex handle 12 (or handle portion) may include convex features and / or grooves to enhance grip. The convex handle 12 (or handle portion) may be about 5 mm to about 15 mm thick, or about 5 mm to about 12 mm thick, or about 6 mm to about 10 mm thick, or about 6 mm to about 9 mm thick, or about 7 mm to about 8 mm thick. The convex handle 12 (or handle portion) may be hollow so that fluid can pass through the device 10 during use. The device 10 may also include a proximal handle adhesive 16 at the proximal end 18 of the convex handle 12, a stopper 28 ( Figure 3 The needle subassembly 26 (shown in Figure 3 ) and strain relief feature 22. The strain relief feature 22 may be made of Santoprene material, Pebax material, polyurethane material, silicone material, nylon material and / or thermoplastic elastomer. The telescopic hypotube needle support 24 surrounds and supports the curved needle 38 ( Figure 3 ).

[0450] Still refer to Figure 2 The stopper 28 may be made of a thermoplastic material or a plastic polymer (such as a UV-cured polymer) and other suitable materials, and may be used to prevent the curved needle 38 from being inserted too deeply into the ear canal (e.g., preventing the curved needle 38 from being inserted into the side wall or other inner ear structures). The device 10 may also include a tapered portion 23 disposed between the flange handle 12 and a distal handle adhesive 14 coupled to the retractable hypotube needle support 24. The flange handle 12 (or handle portion) may include a tapered portion 23 at the distal end of the handle portion 12. The device 10 may also include a conduit 36 ​​that is fluidically connected to the proximal end 16 of the device 10 and serves as a fluid inlet line to connect the device to an upstream component (e.g., a pump, a syringe, and / or an upstream component that may be coupled to a control system and / or a power source (not shown) in some embodiments). In some aspects, the curved needle 38 ( Figure 3 2, through the telescopic hypotube needle support 24, through the tapered portion 23, through the knurled handle 12, through the strain relief feature 22, and directly fluidly connected to the conduit 36. In other aspects, the curved needle 38 is fluidly connected to the hollow interior of the knurled handle (e.g., via the telescopic hypotube needle support 24), which in turn is fluidly connected to the conduit 36 ​​at the proximal end 16. In aspects where the curved needle 38 does not extend all the way through the interior of the device 10, the contact area between the interface components (e.g., between the overlapping nested hypotubes 42), tolerances, and / or sealants must be sufficient to prevent the therapeutic fluid from leaking from the device 10 (which operates at relatively low pressures (e.g., about 1 Pascal to about 50 Pa, or about 2 Pa to about 20 Pa, or about 3 Pa to about 10 Pa)).

[0451] Figure 3 1 shows a side view of a curved needle subassembly 26 according to aspects of the disclosed aspects of the present invention. The curved needle subassembly 26 includes a needle 38 having a curved portion 32. The curved needle subassembly 26 may also include a stopper 28 coupled to the curved portion 32. The curved portion 32 includes an angled tip 34 at the distal end 20 of the device 10 for puncturing an eardrum (e.g., RWM). The needle 38, curved portion 32, and angled tip 34 are hollow so that fluid can flow therethrough. The angle 46 (e.g., Figure 5) may vary. The geometry of the stopper 28 may be cylindrical, disc-shaped, annular, dome-shaped, and / or other suitable shapes. The stopper 28 may be molded onto the curved portion 32. For example, the stopper 28 may be positioned concentrically around the curved portion 32 using an adhesive or a compression fitting. Examples of adhesives include UV-cured adhesives (such as Dymax 203A-CTH-FT), elastomeric adhesives, thermosetting adhesives (such as epoxy resins or polyurethanes), or emulsion adhesives (such as polyvinyl acetate). The stopper 28 is assembled concentrically around the curved portion 32 so that the angled tip 34 is inserted into the ear at a desired insertion depth. The curved needle 38 may be formed from a straight needle using incremental forming and other suitable techniques.

[0452] Figure 4 A perspective view of an exemplary device 10 for delivering fluid to the inner ear is shown. The length of the conduit 36 ​​may be approximately 1300 mm ( Figure 4 The length of the strain relief feature 22 may be from about 25 mm to about 30 mm ( Figure 4 The handle 12 may be about 155.4 mm in length ( Figure 4 The telescopic hypotube needle support 24 may have two or more nested hypotubes, for example, three nested hypotubes 42A, 42B, and 42C, or four nested hypotubes 42A, 42B, 42C, and 42D. The total length of the hypotubes 42A, 42B, 42C and the tip assembly 26 ( Figure 4 The dimension 17) in the telescopic hypotube needle support 24 can be about 25 mm to about 45 mm, or about 30 mm to about 40 mm, or about 35 mm. In addition, the telescopic hypotube needle support 24 can have a length of about 36 mm, or about 25 mm to about 45 mm, or about 30 mm to about 40 mm. The three nested hypotubes 42A, 42B and 42C can each have a length of 3.5 mm, 8.0 mm and 19.8 mm (plus or minus about 20%), respectively. The innermost nested hypotube (or narrowest portion) of the telescopic hypotube needle support 24 can be concentrically arranged around the needle 38.

[0453] Figure 5 1 shows a perspective view of a curved needle subassembly 26 coupled to the distal end 20 of the device 10 in accordance with aspects of the disclosed aspects of the present invention. Figure 5As shown in , the curved needle subassembly 26 may include a needle 38 coupled to the curved portion 32. In other aspects, the curved needle 38 may be a single needle (e.g., a straight needle that is then bent so that it includes the desired angle 46). The needle 38 may be a 33 gauge needle, or may include a gauge of about 32 to about 34, or about 31 to 35. At finer gauges, care must be taken to ensure that the tubing 36 is not bent or damaged. The needle 38 may be connected to the handle 12 so that the needle 38 is safely and accurately placed in the inner ear. As shown in FIG. Figure 5 As shown in FIG. , the curved needle subassembly 26 may also include a stop 28 disposed around the curved portion 32 . Figure 5 The curved portion 32 is also shown to include an angled tip 34 for piercing the eardrum (e.g., RWM). The stopper 28 may have a height 48 of about 0.5 mm, or about 0.4 mm to about 0.6 mm, or about 0.3 mm to about 0.7 mm. The curved portion 32 may have a length 52 of about 1.45 mm, or about 1.35 mm to about 1.55 mm, or about 1.2 mm to about 1.7 mm. In other aspects, the curved portion 32 may have a length greater than 2.0 mm, such that the distance between the distal end of the stopper 28 and the distal end of the angled tip 34 is about 0.5 mm to about 1.7 mm, or about 0.6 mm to about 1.5 mm, or about 0.7 mm to about 1.3 mm, or about 0.8 mm to about 1.2 mm. Figure 5 The display stop 28 can have a cylindrical, disc-shaped and / or dome-shaped geometry. One of ordinary skill in the art will appreciate that other geometries can be used.

[0454] The present disclosure is further described in detail by reference to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise stated. Therefore, the present disclosure should never be construed as being limited to the following examples, but rather should be construed as covering any and all variations that become apparent due to the teachings provided herein.

[0455] Other assays, including those described in the Examples section herein and those known in the art, can also be used to evaluate the auditory polypeptide nucleic acids and nucleic acid constructs of the present disclosure.

[0456] Without further description, it is believed that one of ordinary skill in the art can use the foregoing description and the following illustrative examples to prepare and utilize the compounds of the present disclosure and practice the claimed methods. The following working examples particularly point out various aspects of the present disclosure and should not be construed as limiting the remainder of the disclosure in any way.

[0457] Example

[0458] Example 1: Adeno-associated virus (AAV) trans-splicing strategy

[0459] Two different rAAV vectors can be used to reconstitute an active otoferlin gene (e.g., a full-length otoferlin gene) in cells after intermolecular concatenation and trans-splicing. See, e.g., Yan et al., Proc. Natl. Acad. Sci. USA 97:12; 6716-6721, 2000, which is incorporated herein in its entirety.

[0460] In some aspects, two different rAAV vectors will be used. In some aspects, the first rAAV vector comprises a first expression cassette comprising a promoter (e.g., any promoter described herein), a first coding sequence encoding an N-terminal portion of an otoferlin protein located 3' to the promoter (e.g., any size of a portion of an otoferlin protein described herein and / or any N-terminal portion of an otoferlin protein described herein), and a splice donor signal sequence located at the 3' end of the first coding sequence.

[0461] In some aspects, the second rAAV vector comprises a second expression cassette comprising a splice acceptor signal sequence, a second coding sequence encoding a C-terminal portion of otoferlin (i.e., the entire portion of otoferlin not contained in the N-terminal portion) located 3' to the splice acceptor signal sequence (e.g., any size of a portion of otoferlin described herein and / or any C-terminal portion of otoferlin described herein), and a polyadenylation sequence (e.g., any polyadenylation sequence described herein) located 3' to the second coding sequence.

[0462] In some aspects, the first rAAV vector genome comprises a first expression cassette comprising a promoter (e.g., any promoter described herein), a first coding sequence encoding an N-terminal portion of an otoferlin protein located 3' to the promoter (e.g., any size of a portion of an otoferlin protein described herein and / or any N-terminal portion of an otoferlin protein described herein), and a splice donor signal sequence located at the 3' end of the first coding sequence.

[0463] In some aspects, the second rAAV vector genome comprises a second expression cassette comprising a splice acceptor signal sequence, a second coding sequence encoding a C-terminal portion of otoferlin (i.e., the entire portion of otoferlin not contained in the N-terminal portion) located 3' to the splice acceptor signal sequence (e.g., any size of a portion of otoferlin described herein and / or any C-terminal portion of otoferlin described herein), and a polyadenylation sequence (e.g., any polyadenylation sequence described herein) located 3' to the second coding sequence.

[0464] In some aspects, each coding portion is at least 30 amino acid residues in length (e.g., at least 50 amino acids, at least 75 amino acids, or at least 100 amino acids in length), the amino acid sequence of each coding portion does not overlap with the sequence of other coding portions, and no single vector of the two different rAAV vectors encodes active otoferlin (e.g., full-length otoferlin). When the two coding sequences of the two rAAV vectors are expressed in a mammalian cell (e.g., any mammalian cell described herein), splicing occurs between the splice donor signal sequence and the splice acceptor signal sequence, thereby forming a recombinant mRNA encoding an active otoferlin (e.g., full-length otoferlin).

[0465] In any of these embodiments of the methods, the amino acid sequence of each coding portion does not overlap with the sequence of any other coding portion, and no single vector encodes an active otoferlin (eg, full-length otoferlin).

[0466] The two different rAAV vectors each comprise a coding sequence encoding a different portion of otoferlin, and each coding portion can be at least 30 amino acids (e.g., between about 30 amino acids to about 1600 amino acids, or any other subrange of this range described herein).

[0467] In some aspects, the two different vectors each comprise a coding sequence encoding a different portion of otoferlin, each coding portion can encode up to 80% of the amino acid sequence of SEQ ID NO: 5 (e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, or up to 70% of SEQ ID NO: 5), such that each coding portion is non-overlapping. In some aspects, the two different vectors each comprise a coding sequence encoding a different portion of otoferlin, each coding portion encodes up to 80% of the amino acid sequence of SEQ ID NO: 5 (e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, or up to 70% of SEQ ID NO: 5), such that each coding portion is non-overlapping.

[0468] Each of the two rAAV vectors may further comprise an inverted terminal repeat (ITR) to allow head-to-tail recombination. The ITR will then be removed via splicing. For example, the ITR may be a palindromic double DITR as described in Yan et al., Proc. Natl. Acad. Sci. USA 97(12): 6716-6721, 2000, which is incorporated herein in its entirety. For example, the ITR may be an AAV serotype 2 ITR as described in Gosh et al., Mol. Ther. 16: 124-130, 2008, and Gosh et al., Human Gene Ther. 22: 77-83, 2011. Non-limiting examples of splice acceptor and / or donor signal sequences are known in the art. See, for example, Reich et al., Human Gene Ther. 14(1):37-44, 2003, and Lai et al. (2005) Nat. Biotechnol. 23(11):1435-1439, 2005, 2005. The splice donor and acceptor signal sequences can be any endogenous intronic splicing signals of a gene (eg, the otoferlin gene).

[0469] For example, a splice donor signal sequence can be:

[0470] 5'-GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCA ATAGA AACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTT CT-3' (SEQ ID NO: 64) and the splice acceptor signal can be:

[0471] 5′-ATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTT TCTCTC CACAG-3′ (SEQ ID NO: 110) (see, e.g., Trapani et al., EMBO Mol. Med. 6(2): 194-211, 2014).

[0472] In some aspects, the splice donor sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 90%, or 100% identical to SEQ ID NO: 102. In some aspects, the splice donor sequence has the sequence of SEQ ID NO: 102.

[0473] In some aspects, the splice acceptor sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 90%, or 100% identical to SEQ ID NO: 106. In some aspects, the splice acceptor sequence has the sequence of SEQ ID NO: 106.

[0474] Methods for assessing splicing and splicing efficiency are known in the art (see, e.g., Lai et al., Nat. Biotechnol. 23(11): 1435-1439, 2005).

[0475] Example 2: Trans-splicing strategy using a hybrid vector with a highly recombinogenic exogenous gene region of alkaline phosphatase (AP)

[0476] Two different nucleic acid vectors (e.g., AAV vectors) can also be used in any of the methods described herein to reconstitute an active otoferlin gene (e.g., a full-length otoferlin gene) in a cell after intermolecular i) concatemerization, ii) recombination, iii) trans-splicing, iv) concatemerization and trans-splicing, or v) recombination and trans-splicing. This strategy is a hybrid strategy because it will include concatemerization, homologous recombination, and / or trans-splicing. See, e.g., Gosh et al., Mol. Ther. 16: 124-130, 2008; Gosh et al., Human Gene Ther. 22: 77-83, 2011; and Duan et al., Mol. Ther. 4: 383-391, 2001, each of which is incorporated herein in its entirety.

[0477] Recombination can occur with highly recombinogenic DNA sequences that will allow for coding sequence-independent recombination. A non-limiting example of a recombinogenic sequence is the alkaline phosphatase (AP) gene. For example, the recombinogenic sequence can be the middle third of the human placental AP complementary DNA, which is 872 bp in length (see, e.g., Gosh et al., 2008). Two different nucleic acid vectors will contain a recombinogenic sequence (e.g., any of the recombinogenic sequences described herein).

[0478] Since the hybrid vector will be constructed based on the trans-splicing vector as described in Example 7, the active otoferlin gene (e.g., full-length otoferlin gene) can be reconstructed using ITR-mediated recombination and trans-splicing or recombinogenic sequence-mediated (e.g., AP gene-mediated) recombination and trans-splicing. After trans-splicing, the active otoferlin gene (e.g., full-length otoferlin gene) will be reconstructed in the genomic DNA of a mammalian cell (e.g., any mammalian cell described herein).

[0479] In some aspects, the first rAAV vector may comprise a first expression cassette comprising a promoter (e.g., any promoter described herein), a first coding sequence encoding an N-terminal portion of an otoferlin protein located 3' to the promoter (e.g., any size of a portion of an otoferlin protein described herein and / or any N-terminal portion of an otoferlin protein described herein), a splice donor signal sequence located at the 3' end of the first coding sequence, and a first recombinogenic sequence (e.g., an alkaline phosphatase recombinogenic sequence) located 3' to the splice donor signal sequence.

[0480] In some aspects, the second rAAV vector may comprise a second expression cassette comprising a second recombinogenic sequence (e.g., an alkaline phosphatase recombinogenic sequence), a splice acceptor signal sequence located 3' to the second recombinogenic sequence, a second coding sequence encoding a C-terminal portion of an otoferlin located 3' to the splice acceptor signal sequence (e.g., any size of a portion of an otoferlin described herein and / or any C-terminal portion of an otoferlin described herein), and a polyadenylation sequence located 3' to the second coding sequence (e.g., any polyadenylation sequence described herein).

[0481] In some aspects, the first rAAV vector genome may comprise a first expression cassette comprising a promoter (e.g., any promoter described herein), a first coding sequence encoding an N-terminal portion of an otoferlin protein located 3' to the promoter (e.g., any size of a portion of an otoferlin protein described herein and / or any N-terminal portion of an otoferlin protein described herein), a splice donor signal sequence located at the 3' end of the first coding sequence, and a first recombinogenic sequence sequence (e.g., an alkaline phosphatase recombinogenic sequence) located 3' to the splice donor signal sequence.

[0482] In some aspects, the second rAAV vector genome may comprise a second expression cassette comprising a second recombinogenic sequence (e.g., an alkaline phosphatase recombinogenic sequence), a splice acceptor signal sequence located 3' to the second recombinogenic sequence, a second coding sequence encoding a C-terminal portion of an otoferlin located 3' to the splice acceptor signal sequence (e.g., any size of a portion of an otoferlin described herein and / or any C-terminal portion of an otoferlin described herein), and a polyadenylation sequence located 3' to the second coding sequence (e.g., any polyadenylation sequence described herein).

[0483] In some aspects, each coding portion is at least 30 amino acid residues in length (e.g., at least 50 amino acids, at least 75 amino acids, or at least 100 amino acids in length), the amino acid sequences of each coding portion do not overlap, and no single vector encodes an active otoferlin (e.g., full-length otoferlin) in two different vectors. When introduced into a mammalian cell (e.g., any mammalian cell described herein), splicing occurs between the splice donor signal sequence and the splice acceptor signal sequence, thereby forming an RNA acid encoding an active otoferlin (e.g., full-length otoferlin).

[0484] Based on the strategies provided above, one skilled in the art will understand how to develop strategies using four, five, or six vectors.

[0485] The coding sequences provided in the two nucleic acid vectors (e.g., the two sequences, will not overlap. The two different vectors can each contain a coding sequence encoding a different portion of the otoferlin protein, each coding portion being, for example, at least 30 amino acids (e.g., about 30 amino acids to about 1600 amino acids, or any other subrange of this range described herein).

[0486] In some aspects, two different rAAV vectors each comprise a coding sequence encoding a different portion of otoferlin, each coding portion encoding up to 80% of SEQ ID NO: 5 (e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, up to 70% of SEQ ID NO: 5), such that each coding portion is non-overlapping. In some aspects, two different rAAV vectors each comprise a coding sequence encoding a different portion of otoferlin, each coding portion encoding up to 80% of SEQ ID NO: 5 (e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, or up to 70% of SEQ ID NO: 5), such that each coding portion is non-overlapping.

[0487] As described in Example 7, each of the two rAAV vectors may further comprise an inverted terminal repeat sequence (ITR) to allow head-to-tail recombination. The ITR will then be removed via splicing. Examples of ITRs and splice acceptor and / or donor signal sequences are known in the art and have been described in Example 7.

[0488] Example 3: Trans-splicing strategy using hybrid vectors with highly recombinogenic foreign gene regions (AK) of F1 phage

[0489] Two different rAAV vectors can also be used in any of the methods described herein to reconstitute an active otoferlin gene (e.g., a full-length otoferlin gene) in a cell following intermolecular i) concatemerization, ii) recombination, iii) trans-splicing, iv) concatemerization and trans-splicing, or v) recombination and trans-splicing. This strategy is a hybrid strategy because it will include concatemerization, homologous recombination, and / or trans-splicing. See, e.g., Trapani et al., EMBO Mol. Med. 6(2): 194-211, 2014, which is incorporated herein in its entirety.

[0490] As used herein, the F1 phage recombination region (AK) will be used to allow coding sequence-independent recombination. The F1 phage recombination region can be a 77 bp recombination region from the F1 phage genome, as described in Trapani et al. (2014) EMBO Mol. Med. 6 (2): 194-211, 2014. Two different rAAV vectors will contain the F1 phage recombination region. Since the hybrid vector will be constructed based on the trans-splicing vector as described in Example 7, the rAAV vector encoding active otoferlin (e.g., full-length stereocilin) ​​can be generated using ITR-mediated recombination and trans-splicing or F1 phage recombination region-induced recombination and trans-splicing. After trans-splicing, nucleic acid encoding active otoferlin (e.g., full-length otoferlin) will be generated in mammalian cells (e.g., any mammalian cell described herein).

[0491] In some aspects, two rAAV vectors will be used. In some aspects, the first rAAV vector comprises a first expression cassette comprising a promoter (e.g., any promoter described herein), a first coding sequence encoding an N-terminal portion of an otoferlin protein located 3' to the promoter (e.g., any size of a portion of an otoferlin protein described herein and / or any N-terminal portion of an otoferlin protein described herein), a splice donor signal sequence located at the 3' end of the first coding sequence, and an F1 phage recombination sequence located 3' to the splice donor signal sequence.

[0492] In some aspects, the second rAAV vector comprises a second expression cassette comprising an F1 phage induced recombination region, a splice acceptor signal sequence located 3' to the F1 phage induced recombination region, a second coding sequence encoding a C-terminal portion of an otoferlin protein located 3' to the splice acceptor signal sequence (e.g., any size of a portion of an otoferlin protein described herein and / or any C-terminal portion of an otoferlin protein described herein), and a polyadenylation sequence located 3' to the second coding sequence (e.g., any polyadenylation sequence described herein).

[0493] The first rAAV vector genome comprises a first expression cassette comprising a promoter (e.g., any promoter described herein), a first coding sequence encoding an N-terminal portion of an otoferlin protein (e.g., any size of a portion of an otoferlin protein described herein and / or any N-terminal portion of an otoferlin protein described herein) located 3' to the promoter, a splice donor signal sequence located at the 3' end of the first coding sequence, and an F1 phage recombination-inducing sequence located 3' to the splice donor signal sequence.

[0494] In some aspects, the second rAAV vector genome comprises a second expression cassette comprising an F1 phage causative recombination region, a splice acceptor signal sequence located 3' to the F1 phage causative recombination region, a second coding sequence encoding a C-terminal portion of an otoferlin protein located 3' to the splice acceptor signal sequence (e.g., any size of a portion of an otoferlin protein described herein and / or any C-terminal portion of an otoferlin protein described herein), and a polyadenylation sequence located 3' to the second coding sequence (e.g., any polyadenylation sequence described herein).

[0495] In some aspects, each coding portion is at least 30 amino acid residues in length (e.g., at least 50 amino acids, at least 75 amino acids, or at least 100 amino acids in length), the amino acid sequence of each coding portion does not overlap, and no single vector encodes an active otoferlin (e.g., full-length otoferlin) in two different rAAV vectors. When the rAAV vector is introduced into a mammalian cell (e.g., any mammalian cell described herein), splicing occurs between the splice donor signal sequence and the splice acceptor signal sequence, thereby forming a recombinant nucleic acid encoding an active otoferlin (e.g., full-length otoferlin).

[0496] The coding sequences provided by each of the two rAAV vectors will not overlap. The two different rAAV vectors each contain a coding sequence encoding a different portion of otoferlin, each coding portion being at least 30 amino acids (e.g., about 30 amino acids to about 1600 amino acids, or any sub-range of this range described herein).

[0497] In some aspects, two different rAAV vectors each comprise a coding sequence encoding a different portion of otoferlin, each coding portion encoding at least one exon and at least one intron of SEQ ID NO: 12 (e.g., at least two exons and at least one intron, at least two exons and at least two introns, at least three exons and at least one intron, at least three exons and at least two introns, or at least three exons and at least three introns). In some aspects, two different rAAV vectors each comprise a coding sequence encoding a different portion of otoferlin, each coding portion encoding up to 80% of SEQ ID NO: 5 (e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, or up to 70% of SEQ ID NO: 5), such that each coding portion is non-overlapping. In some aspects, two different rAAV vectors each contain a coding sequence encoding a different portion of otoferlin, each coding portion encoding up to 80% of SEQ ID NO:5 (e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60% or up to 70% of SEQ ID NO:5), such that each coding portion is non-overlapping.

[0498] As described in Example 7, at least two nucleic acid vectors may each further comprise an inverted terminal repeat (ITR) to allow head-to-tail recombination. The ITR will then be removed via splicing. Examples of ITRs and splice acceptors and / or donor signals are known in the art and have been described in Example 7.

[0499] Example 4: In vitro expression of full-length human otoferlin using two vectors

[0500] As in other dual vector approaches, two transgenes, each containing a portion of a full-length transcript, are packaged in separate vectors and provided together to contact a target, e.g., a target cell population in a subject in need thereof. This embodiment provides a set of vectors that are generated to each contain a nucleic acid sequence containing a portion of the coding sequence of the human otoferlin (OTOF) gene or OTOF cDNA.

[0501] AAVAnc80-hOTOF consists of two recombinant vectors (AAVAnc80-5'hOTOF and AAVAnc80-3'hOTOF), which contain single-stranded DNA genomes of 4452 and 3905 nucleotides (excluding ITRs), respectively. Figure 1 ). The single-stranded DNA genome is encapsidated by the AAV Anc80 (also known as Anc80L65; Zinn 2015) capsid.

[0502] The upstream DNA genome (AAVAnc80-5'hOTOF) contains a eukaryotic expression cassette encoding the following promoter and regulatory sequences: cytomegalovirus (CMV) early enhancer element (SEQ ID NO: 98); chicken beta actin (CBA) gene sequence located between the 5' flanking region and the proximal region of the second exon (SEQ ID NO: 99); and a 3' splice sequence derived from the rabbit beta globin (RBG) gene (SEQ ID NO: 100). This is generally referred to as the CAG promoter (Miyazaki 1989; Niwa 1991; Orbán 2009). This hybrid regulatory element is followed by: human OTOF (hOTOF) coding sequence, exons 1 to 21 (inclusive) (SEQ ID NO: 101); a synthetic splice donor (SD) that promotes trans-splicing (Trapani 2014) (SEQ ID NO: 102); and 77 base pairs (bp) of the AK recombination sequence (Trapani 2014; Trapani 2015) (SEQ ID NO: 103). The full-length AAVAnc80-5' hOTOF sequence has the sequence of SEQ ID NO: 96.

[0503] The downstream DNA genome (AAVAnc80-3'hOTOF) contains a eukaryotic expression cassette encoding the following: the same 77-bp AK recombination sequence (Trapani 2014; Trapani 2015) (SEQ ID NO: 103); a synthetic splice acceptor (SA) that promotes trans-splicing (Trapani 2014) (SEQ ID NO: 106); the human OTOF (hOTOF) coding sequence, exons 22 to 45 (inclusive) and exon 47, excluding non-coding exon 46 (SEQ ID NO: 107); and a bovine growth hormone (bGH) polyadenylation (pA) signal (SEQ ID NO: 108). Each expression cassette is flanked by AAV2 inverted terminal repeats (ITRs) (SEQ ID NOs: 97 and 104, respectively). The full-length AAVAnc80-3'hOTOF sequence has the sequence of SEQ ID NO: 105.

[0504] The target cells need to receive copies of both the upstream and downstream transgenes, and based on the dual vector design, these transgenes recombine at the DNA level and lead to the production of full-length mRNA transcripts (McClements 2017), specifically human OTOF based on isoform 5, according to NCBI accession number NM_001287489.1 (128...6121).

[0505] In some aspects, when each of the upstream and downstream vectors is administered to a subject in need thereof, the construct is concatenated within a given cell. In some aspects, the concatenated full-length OTOF is expressed and produces functional otoferlin.

[0506] In some aspects, when each of the upstream and downstream vectors is administered to a subject in need thereof, the constructs are recombined within a given cell. In some aspects, the recombinant full-length OTOF is expressed and functional otoferlin is produced.

[0507] These vector pairs are used to treat human subjects suffering from or susceptible to hearing loss. A composition comprising two vectors of the dual AAV vector system, AAVAnc80.AKhOTOF5 and AAVAnc80.AKhOTOF3, is introduced into at least one cochlea of ​​a human subject. Hearing function is tested in the human subject at 15, 30, 45, 60, and 90 days after administration and compared to the functional hearing of the human subject before receiving treatment or a human subject who has not received treatment.

[0508] AAVAnc80-5'hOTOF The AAVAnc80-5'hOTOF construct comprises two ITRs (SEQ ID NOs: 97 and 104), a CAG promoter (identified by SEQ ID NOs: 98, 99 and 100, comprising a CMV early enhancer element (SEQ ID NO: 98), a chicken β-actin gene sequence (SEQ ID NO: 99) and a chimeric intron comprising a 3' splice sequence from a rabbit β-globin gene (SEQ ID NO: 100)), a 5'OTOF coding region (SEQ ID NO: 101), a SD intron sequence (SEQ ID NO: 102) and an AK recombination sequence (SEQ ID NO: 103). The full length AAVAnc80-5'hOTOF is represented by SEQ ID NO: 96.

[0509] Table 1. AAVAnc80-5'hOTOF

[0510]

[0511]

[0512]

[0513]

[0514]

[0515]

[0516] AAVAnc80-3'hnOTOF The AAVAnc80-3'hOTOF construct contains two ITRs (SEQ ID NOs: 97 and 104), an AK recombination sequence (SEQ ID NO: 103), an SA intron sequence (SEQ ID NO: 106), a 3'OTOF coding region (SEQ ID NO: 107) and a bgH polyA sequence (SEQ ID NO: 108). The full length AAVAnc80-3'hOTOF is represented by SEQ ID NO: 105.

[0517] Table 2. AAVAnc80-3'hOTOF

[0518]

[0519]

[0520]

[0521]

[0522]

[0523] Table 3. Anc80L65

[0524]

[0525]

[0526] Example 5: In vivo expression of full-length human otoferlin using two vectors

[0527] Wild type or Otof - / - Mice (p23±2 days) were administered vehicle or the AAVAnc80-hOTOF dual hybrid vector described in Example 4 via intracochlear injection. Otoferlin expression in inner hair cells was examined 1 month after administration ( Figure 6A-6C ). Only in Otof cells treated with AAVAnc80-hOTOF double hybrid vector - / - Strong expression of full-length human otoferlin was observed in inner hair cells but not in other cochlear cells in mice ( Figure 6C ).

[0528] Nonhuman primates (NHPs) were administered via intracochlear injection with vehicle or the flag-tagged AAVAnc80-hOTOF dual-hybrid vector described in Example 4. Otoferlin expression in inner hair cells was examined 1 month after administration ( Figure 7A-7B Otoferlin-Flag was detected only in inner hair cells but not in other cochlear nerve regions or supporting cell regions. Figure 7B ).

[0529] Next, the Otof was evaluated by administration of vehicle or the AAVAnc80-hOTOF dual hybrid vector described in Example 4. - / - Auditory function of mice. At 15, 30, 45 and 60 days after administration ( Fig. 8A ) or 1, 2, 3, 4.5 or 6 months ( Figure 8B ) to assess auditory brainstem response (ABR). - / - Mice had no measurable auditory brainstem responses ( Figure 8A-B ). Approximately 70% of Otof cells were administered with the AAVAnc80-hOTOF double hybrid vector. - / - Mice showed recovery of auditory brainstem responses by day 15 ( Fig. 8A At least 80% of Otof- / - treated with 5x dose of AAVAnc80-otoferlin double hybrid vector recovered auditory brainstem responses for at least 6 months ( Figure 8B ). The extent of recovery of hearing function depends on the dose administered.

[0530] Example 6: In vivo biodistribution of full-length human otoferlin using two vectors

[0531] Nonhuman primates received bilateral intracochlear administration of vehicle or the flag-tagged AAVAnc80-hOTOF double hybrid vector described in Example 4 or spiked with a positive control (OTOF-transduced HEK293FT cell lysate added to NHP tissue lysate), and the biodistribution of otoferrin in the mandibular lymph nodes, liver, and spleen was assessed 1 month after administration ( Figure 9A-9C ). By RT-qPCR, only liver and spleen were positive for human otoferlin-Flag mRNA expression and only in some animals ( Figure 9A-9C Human otoferlin-Flag protein was not detected in liver or spleen by Western blotting ( Figure 9D-9E ).

[0532] Example 7: In vivo cochlear hair cell survival and function following administration of full-length human otoferlin using two vectors

[0533] Quantification of cochlear hair cell survival to assess the role of nonhuman primates (NHPs) ( Figure 10A-10C ) or Otof - / - Mouse ( Figure 10D-10F ) Local tolerability of intracochlear administration of vehicle or flag-tagged AAVAnc80-hOTOF dual hybrid vectors as described in Example 4. AAVAnc80-Otof was well tolerated systemically and locally, and no adverse effects were observed in clinical pathology, ear pathology, systemic histopathology, and / or hearing function ( Figures 10A-10F ).

[0534] Auditory and cochlear function were evaluated before and 6 months after intracochlear administration of vehicle or the flag-tagged AAVAnc80-hOTOF dual-hybrid vector described in Example 4 in nonhuman primates (NHPs). Figure 11A-11B Auditory brainstem response (ABR) was used to measure auditory function, and distortion product otoacoustic emissions (DPOAE) was used to measure cochlear function. No effect of otoferlin expression or dose on within-ear shifts (pre-administration vs. post-administration) of ABR or DPOAE thresholds was observed.

[0535] Other aspects

[0536] It is to be understood that the words which have been used are words of description rather than limitation and that changes may be made within the scope of the appended claims without departing from the true scope and spirit of the disclosure in its broader aspects.

[0537] While the present disclosure has been described at some length and with a certain particularity with respect to several described aspects, it is not intended that the present disclosure should be limited to any such details or aspects or any particular aspect, but rather should be construed as referring to the appended claims in order to provide the broadest possible interpretation of such claims in light of the prior art and thereby effectively encompass the intended scope of the present disclosure.

[0538] It should be understood that although the disclosure has been described in conjunction with its detailed description, the foregoing description is intended to illustrate and not limit the scope of the disclosure, which is defined by the scope of the appended claims. Other aspects, advantages and modifications are within the scope of the following claims.

[0539] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, the present specification (including definitions) shall prevail. In addition, section headings, materials, methods, and examples are illustrative only and are not intended to be limiting.

Claims

1. A composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg) comprising a first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome comprising a second expression cassette comprising a nucleic acid sequence comprising a 3' portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition comprises about 4.1E10-4.1E12 total vg or about 8.1E10-8.1E12 total vg.

2. The composition of claim 1, wherein the composition comprises about 4.1E10-4.1E12 total vg / cochlea or about 8.1E10-8.1E12 total vg / cochlea.

3. The composition of claim 1 or 2, wherein the composition comprises about 4.1E10-4.1E12 total vg / cochlea total vg / cochlea.

4. The composition of any of the preceding claims, wherein the composition comprises about 4.1E11 total vg / cochlea.

5. The composition of claim 1 or 2, wherein the composition comprises about 8.1E10-8.1E12 total vg / cochlea.

6. The composition of any one of claims 1, 2 or 5, wherein the composition comprises about 8.1E11 total vg / cochlea.

7. The composition of any of the preceding claims, wherein the concentration of the composition comprises about 4.5E11-4.5E13 total vg / mL or about 9E11-9E13 total vg / mL.

8. The composition of any one of claims 1 to 4, wherein the concentration of the composition comprises about 4.5E11-4.5E13 total vg / mL.

9. The composition of any one of claims 1 to 4 or 8, wherein the concentration of the composition comprises about 4.5E12 total vg / mL.

10. The composition of any one of claims 1 to 2 or 5 to 7, wherein the concentration of the composition comprises about 9E11-9E13 total vg / mL.

11. The composition of any one of claims 1 to 2, 5 to 7 or 10, wherein the concentration of the composition comprises about 9E12 total vg / mL.

12. The composition of any of the preceding claims, wherein the composition comprises the first rAAV vector genome and the second rAAV vector genome in a ratio of about 1:

1.

13. The composition of any one of claims 1 to 4 or 7 to 9, wherein the composition comprises about 4.1E11 total vg.

14. The composition of any one of claims 1, 2, 5-7, or 10-12, wherein the composition comprises about 8.1E11 total vg.

15. A composition comprising: (a) a first rAAV vector genome comprising a first expression cassette comprising a promoter, a first coding sequence encoding an N-terminal portion of otoferlin located 3' to the promoter, and a splice donor signal sequence located 3' to the first coding sequence; and (b) a second rAAV vector genome comprising a second expression cassette comprising a splice acceptor signal sequence, a second coding sequence encoding a C-terminal portion of otoferlin located 3' to the splice acceptor signal sequence, and a polyadenylation sequence located 3' to the second coding sequence; wherein the composition is formulated for intracochlear administration.

16. The composition of claim 15, wherein the composition comprises one or more pharmaceutically acceptable carriers, diluents or excipients.

17. The composition of claim 15 or 16, wherein the composition is formulated to comprise synthetic perilymph.

18. The composition of any one of claims 15 to 17, further comprising one or more buffers and one or more surfactants.

19. The composition of claim 18, wherein the buffer is selected from the group consisting of potassium dihydrogen phosphate, sodium dihydrogen phosphate, potassium chloride, sodium chloride, Tris HCl, Tris base, histidine, boric acid, citric acid, glycine, HEPES, and MOPS.

20. The composition of claim 18 or 19, wherein the surfactant is selected from the group consisting of poloxamer 188, labasol, Tween, ethanol, Pluronic F68 and polyethylene glycol.

21. The composition of any one of claims 15 to 20, further comprising potassium dihydrogen phosphate, disodium hydrogen phosphate, potassium chloride, sodium chloride and poloxamer 188.

22. The composition of any one of claims 15 to 21, wherein the formulation comprises: a) about 1.35 mM to 1.65 mM potassium dihydrogen phosphate; b) about 7.29 mM to 8.91 mM sodium phosphate dibasic; c) about 2.43 mM to 2.97 mM potassium chloride; d) about 154.8 mM to 189.2 mM sodium chloride; and e) about 0.0001% to 0.01% poloxamer 188.

23. A composition as described in any one of claims 15 to 22, wherein the formulation comprises: a) about 1.5 mM potassium dihydrogen phosphate; b) about 8.1 mM sodium phosphate dibasic; c) about 2.7 mM potassium chloride; d) about 172 mM sodium chloride; and e) about 0.001% Poloxamer 188.

24. The composition of any one of claims 15 to 23, wherein the composition comprises about 4.1E10-4.1E12 total vg / cochlea or about 8.1E10-8.1E12 total vg / cochlea.

25. The composition of any one of claims 15 to 24, wherein the composition comprises about 4.1E11 total vg / cochlea.

26. The composition of any one of claims 15 to 24, wherein the composition comprises about 8.1E11 total vg / cochlea.

27. The composition of any one of claims 15 to 25, wherein the concentration of the composition comprises about 4.5E12 total vg / mL.

28. The composition of any one of claims 15 to 24 or 26, wherein the concentration of the composition comprises about 9E12 total vg / mL.

29. The composition of any one of claims 15 to 28, wherein the composition comprises the first rAAV vector genome and the second rAAV vector genome in a ratio of about 1:

1.

30. A composition as described in any of the preceding claims, wherein the nucleic acid sequence comprising the 5′ portion of the otoferlin gene is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

101.

31. A composition as described in any of the preceding claims, wherein the nucleic acid sequence comprising the 3′ portion of the otoferlin gene is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

107.

32. A composition as claimed in any one of the preceding claims, wherein the promoter is selected from a constitutive promoter, an inducible promoter or a tissue-specific promoter.

33. The composition of claim 32, wherein the promoter is a constitutive promoter.

34. A composition as described in claim 33, wherein the constitutive promoter is selected from the group consisting of CAG, CBA or CMV promoters.

35. The composition of claim 34, wherein the constitutive promoter is a CAG promoter.

36. The composition of any of the preceding claims, wherein the first rAAV vector comprises a splice donor site and a recombination sequence.

37. The composition of any of the preceding claims, wherein the second rAAV vector comprises a splice acceptor site, a recombination sequence, and a polyadenylation sequence.

38. The composition of claim 36, wherein the splice donor site has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

102.

39. A composition as described in claim 37, wherein the splice acceptor site has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

106.

40. A composition as described in any of claims 36 to 39, wherein the recombinant sequence has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

103.

41. The composition of any one of claims 36 to 40, wherein the polyadenylation sequence is selected from bovine growth hormone, human growth hormone, mouse-β-globin, mouse-α-globin, polyoma virus, SV40, or a synthetic polyadenylation sequence.

42. The composition of claim 41, wherein the polyadenylation is a bovine growth hormone polyadenylation sequence.

43. A composition as described in any one of claims 36 to 42, wherein the polyadenylation sequence has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

108.

44. The composition of any of the preceding claims, wherein the ITR is selected from any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43, or Anc80 ITRs.

45. The composition of claim 44, wherein the ITR is an AAV2 ITR.

46. ​​A composition as described in any of the preceding claims, wherein the first expression cassette has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

96.

47. A composition as described in any of the preceding claims, wherein the second expression cassette has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

105.

48. The composition of any of the preceding claims, wherein the first rAAV vector and the second rAAV vector are each encapsidated by an AAV capsid.

49. The composition of claim 48, wherein the AAV capsid encapsulating the first rAAV vector is a serotype selected from any one of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43, or Anc80.

50. The composition of claim 48, wherein the AAV capsid encapsulating the second rAAV vector is a serotype selected from any one of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43, or Anc80.

51. The composition of claim 49 or 50, wherein the first rAAV vector is encapsidated by an Anc80 capsid and the second rAAV vector is encapsidated by an Anc80 capsid.

52. The composition of any one of claims 49 to 51, wherein the Anc80 capsid comprises the polypeptide sequence of SEQ ID NO:

109.

53. The composition of any one of claims 1 to 14 or 30 to 52, wherein the composition is formulated for intracochlear administration.

54. A composition as described in any one of claims 1 to 14 or 30 to 53, wherein the composition comprises one or more pharmaceutically acceptable carriers, diluents or excipients.

55. The composition of any one of claims 1 to 14 or 30 to 54, wherein the composition is formulated to comprise synthetic perilymph.

56. The composition of any one of claims 1 to 14 or 30 to 55, further comprising one or more buffers and one or more surfactants.

57. The composition of claim 56, wherein the buffer is selected from the group consisting of potassium dihydrogen phosphate, sodium dihydrogen phosphate, potassium chloride, sodium chloride, Tris HCl, Tris base, histidine, boric acid, citric acid, glycine, HEPES, and MOPS.

58. The composition of claim 56, wherein the surfactant is selected from the group consisting of poloxamer 188, labasol, Tween, ethanol, Pluronic F68, and polyethylene glycol.

59. The composition of any one of claims 1 to 14 or 30 to 58, further comprising monopotassium phosphate, disodium hydrogen phosphate, potassium chloride, sodium chloride and poloxamer 188.

60. The composition of any one of claims 53 to 59, wherein the formulation comprises: a) about 1.35 mM to 1.65 mM potassium dihydrogen phosphate; b) about 7.29 mM to 8.91 mM sodium phosphate dibasic; c) about 2.43 mM to 2.97 mM potassium chloride; d) about 154.8 mM to 189.2 mM sodium chloride; and e) about 0.0001% to 0.01% poloxamer 188.

61. A composition as described in any one of claims 53 to 60, wherein the formulation comprises: a) about 1.5 mM potassium dihydrogen phosphate; b) about 8.1 mM sodium phosphate dibasic; c) about 2.7 mM potassium chloride; d) about 172 mM sodium chloride; and e) about 0.001% Poloxamer 188.

62. A method for treating hearing loss in a subject having a defective otoferlin gene, comprising administering a composition as described in any of the preceding claims into the cochlea of ​​the subject, wherein the first rAAV vector and the second rAAV vector are capable of constituting a polypeptide messenger RNA encoding full-length human otoferlin in the subject.

63. The method of claim 62, further comprising, prior to the administering step, determining that the subject has a defective otoferlin gene.

64. The method of claim 63, wherein the defective otoferlin gene comprises a mutation that results in reduced expression and / or activity of the otoferlin protein encoded by the gene.

65. The method of any one of claims 62 to 64, wherein the method is used to reduce or prevent secondary degeneration of one or more cochlear structures.

66. A method for expressing recombinant full-length otoferlin in mammalian cells, comprising administering to the mammalian cells a composition as described in any one of claims 1 to 61, wherein the first rAAV vector and the second rAAV vector are capable of constituting a polypeptide messenger RNA encoding full-length human otoferlin in the mammalian cells.

67. The method of claim 66, wherein the mammalian cell is a cochlear cell.

68. The method of claim 67, wherein the mammalian cell is an inner ear hair cell.

69. The method of claim 62, wherein the subject is a mammal.

70. The method of claim 62, wherein the subject is a human.

71. The method of any one of claims 62 to 70, wherein the composition is administered as a single dose.

72. The method of any one of claims 62 to 70, wherein the composition is administered in multiple doses.

73. The method of claim 72, wherein the composition is administered in 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses.

74. The method of any one of claims 62 to 71, wherein a single dose comprises about 0.01 mL - 0.2 mL.

75. The method of claim 74, wherein a single dose comprises about 0.09 mL.

76. The method of any one of claims 62 to 75, wherein the composition is administered to the round window membrane as an injection.

77. The method of claim 76, wherein the composition is administered as a single injection.

78. The method of claim 76, wherein the composition is administered as multiple injections.

79. The method of claim 78, wherein the composition is administered in 2, 3, 4, 5, 6, 7, 8, 9 or 10 injections.

80. The method of any one of claims 62 to 79, wherein the composition is administered using a medical device.

81. The method of claim 80, wherein the device is a device as shown in Figures 2-5.

82. The method of claim 80, wherein the device is a microcatheter.

83. The method of any one of claims 62 to 82, wherein the composition is delivered at a controlled flow rate.

84. The method of any one of claims 62 to 83, wherein the subject is between 2 and 17 years old.

85. The method of any one of claims 62 to 84, wherein administration of the composition improves the subject's auditory brainstem response (ABR) threshold response, age-appropriate behavioral audiometry, tympanometric measurement, and / or word / sentence recognition testing.

86. A kit comprising the composition of any one of claims 1 to 61.

87. The kit of claim 86, further comprising a pre-loaded syringe containing the composition.

88. The kit of claim 86, further comprising a vial containing the composition.

89. A composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg) comprising a first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome comprising a second expression cassette comprising a nucleic acid sequence comprising a 3' portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition comprises about 4.1E10-8.1E12 total vg.

90. The composition of claim 89, wherein the composition comprises about 4.1E10-4.1E12 total vg.

91. The composition of claim 89 or 90, wherein the composition comprises about 4.1E11 total vg.

92. The composition of claim 89 or 90, wherein the composition comprises about 4.1E10-4.1E12 total vg / cochlea.

93. The composition of any one of claims 89 to 92, wherein the composition comprises about 4.1E11 total vg / cochlea.

94. The composition of any one of claims 89 to 93, wherein the concentration of the composition comprises about 4.5E11-4.5E13 total vg / mL.

95. The composition of any one of claims 89 to 94, wherein the concentration of the composition comprises about 4.5E12 total vg / mL.

96. The composition of claim 89, wherein the composition comprises about 8.1E10-8.1E12 total vg.

97. The composition of claim 89 or 96, wherein the composition comprises about 8.1E11 total vg.

98. The composition of claim 89 or 96, wherein the composition comprises about 8.1E10-8.1E12 total vg / cochlea.

99. The composition of any one of claims 89 or 96 to 98, wherein the composition comprises about 8.1E11 total vg / cochlea.

100. The composition of any one of claims 89 or 96 to 99, wherein the concentration of the composition comprises about 9E11-9E13 total vg / mL.

101. The composition of any one of claims 89 or 96 to 100, wherein the concentration of the composition comprises about 9E12 total vg / mL.

102. The composition of any one of claims 89 to 101, wherein the composition comprises the first rAAV vector genome and the second rAAV vector genome in a ratio of about 1:

1.

103. A composition comprising: a) a first recombinant adeno-associated virus (rAAV) vector genome (vg) comprising a first expression cassette comprising a promoter operably linked to a nucleic acid sequence comprising the 5′ portion of the otoferlin gene, wherein the expression cassette is flanked by inverted terminal repeat sequences (ITRs); and b) a second rAAV vector genome comprising a second expression cassette comprising a nucleic acid sequence comprising a 3' portion of the otoferlin gene, wherein the expression cassette is flanked by ITRs; wherein the composition is formulated for intracochlear administration.

104. The composition of claim 103, wherein the composition comprises one or more pharmaceutically acceptable carriers, diluents or excipients.

105. The composition of claim 103 or 104, wherein the composition is formulated to comprise synthetic perilymph.

106. The composition of any one of claims 103 to 105, further comprising one or more buffers and one or more surfactants.

107. The composition of claim 106, wherein the buffer is selected from the group consisting of potassium dihydrogen phosphate, sodium dihydrogen phosphate, potassium chloride, sodium chloride, Tris HCl, Tris base, histidine, boric acid, citric acid, glycine, HEPES, and MOPS.

108. The composition of claim 106 or 107, wherein the surfactant is selected from the group consisting of poloxamer 188, labasol, Tween, ethanol, Pluronic F68, and polyethylene glycol.

109. The composition of any one of claims 103 to 108, further comprising potassium dihydrogen phosphate, disodium hydrogen phosphate, potassium chloride, sodium chloride, and poloxamer 188.

110. The composition of any one of claims 103 to 109, wherein the formulation comprises: a) about 1.35 mM to 1.65 mM potassium dihydrogen phosphate; b) about 7.29 mM to 8.91 mM sodium phosphate dibasic; c) about 2.43 mM to 2.97 mM potassium chloride; d) about 154.8 mM to 189.2 mM sodium chloride; and e) about 0.0001% to 0.01% poloxamer 188.

111. The composition of any one of claims 103 to 110, wherein the formulation comprises: a) about 1.5 mM potassium dihydrogen phosphate; b) about 8.1 mM sodium phosphate dibasic; c) about 2.7 mM potassium chloride; d) about 172 mM sodium chloride; and e) about 0.001% Poloxamer 188.

112. The composition of any one of claims 103 to 111, wherein the composition comprises about 4.1E10-8.1E12 total vg / cochlea.

113. The composition of any one of claims 103 to 112, wherein the composition comprises about 4.1E10-4.1E12 total vg / cochlea or about 8.1E10-8.1E12 total vg / cochlea.

114. The composition of any one of claims 103 to 113, wherein the composition comprises about 4.1E11 total vg / cochlea.

115. The composition of any one of claims 103 to 113, wherein the composition comprises about 8.1E11 total vg / cochlea.

116. The composition of any one of claims 103 to 115, wherein the concentration of the composition comprises about 4.5E11-9E13 total vg / mL.

117. The composition of any one of claims 103-114 or 116, wherein the concentration of the composition comprises about 4.5E12 total vg / mL.

118. The composition of any one of claims 103-113, 115 or 116, wherein the concentration of the composition comprises about 9E12 total vg / mL.

119. The composition of any one of claims 103 to 118, wherein the composition comprises the first rAAV vector genome and the second rAAV vector genome in a ratio of about 1:

1.

120. The composition of any one of claims 89 to 119, wherein the nucleic acid sequence comprising the 5′ portion of the otoferlin gene is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

101.

121. A composition as described in any of claims 89 to 120, wherein the nucleic acid sequence comprising the 3′ portion of the otoferlin gene is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

107.

122. A composition as described in any one in claims 89 to 121, wherein the promoter is selected from a constitutive promoter, an inducible promoter or a tissue-specific promoter.

123. The composition of claim 122, wherein the promoter is a constitutive promoter.

124. A composition as described in claim 123, wherein the constitutive promoter is selected from CAG, CBA or CMV promoter.

125. A composition as described in claim 124, wherein the constitutive promoter is a CAG promoter.

126. The composition of any one of claims 89 to 125, wherein the first rAAV vector comprises a splice donor site and a recombination sequence.

127. The composition of any one of claims 89 to 126, wherein the second rAAV vector comprises a splice acceptor site, a recombination sequence, and a polyadenylation sequence.

128. The composition of claim 126, wherein the splice donor site has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

102.

129. A composition as described in claim 127, wherein the splice acceptor site has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

106.

130. A composition as described in any of claims 126 to 129, wherein the recombinant sequence has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

103.

131. The composition of any one of claims 126 to 130, wherein the polyadenylation sequence is selected from bovine growth hormone, human growth hormone, mouse-β-globin, mouse-α-globin, polyoma virus, SV40, or a synthetic polyadenylation sequence.

132. The composition of claim 131, wherein the polyadenylation is a bovine growth hormone polyadenylation sequence.

133. A composition as described in any of claims 126 to 132, wherein the polyadenylation sequence has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

108.

134. The composition of any one of claims 89 to 133, wherein the ITR is selected from any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43, or Anc80 ITRs.

135. The composition of claim 134, wherein the ITR is an AAV2 ITR.

136. A composition as described in any of claims 89 to 135, wherein the first expression cassette has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

96.

137. A composition as described in any of claims 89 to 136, wherein the second expression cassette has a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

105.

138. The composition of any one of claims 89 to 137, wherein the first rAAV vector and the second rAAV vector are each encapsidated by an AAV capsid.

139. The composition of claim 138, wherein the AAV capsid encapsulating the first rAAV vector is a serotype selected from any one of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43, or Anc80.

140. The composition of claim 138, wherein the AAV capsid encapsulating the second rAAV vector is a serotype selected from any one of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh39, AAVrh43, or Anc80.

141. The composition of claim 139 or 140, wherein the first rAAV vector is encapsidated by an Anc80 capsid and the second rAAV vector is encapsidated by an Anc80 capsid.

142. The composition of any one of claims 139 to 141, wherein the Anc80 capsid comprises the polypeptide sequence of SEQ ID NO:

109.

143. The composition of any one of claims 89 to 102 or 120 to 142, wherein the composition is formulated for intracochlear administration.

144. A composition as described in any one of claims 89 to 102 or 120 to 143, wherein the composition comprises one or more pharmaceutically acceptable carriers, diluents or excipients.

145. The composition of any one of claims 89 to 102 or 120 to 144, wherein the composition is formulated to comprise synthetic perilymph.

146. The composition of any one of claims 89 to 102 or 120 to 145, further comprising one or more buffers and one or more surfactants.

147. The composition of claim 146, wherein the buffer is selected from potassium dihydrogen phosphate, sodium dihydrogen phosphate, potassium chloride, sodium chloride, TrisHCl, Tris base, histidine, boric acid, citric acid, glycine, HEPES, and MOPS.

148. The composition of claim 146, wherein the surfactant is selected from the group consisting of poloxamer 188, labasol, Tween, ethanol, Pluronic F68, and polyethylene glycol.

149. The composition of any one of claims 89 to 102 or 143 to 148, further comprising monopotassium phosphate, disodium hydrogen phosphate, potassium chloride, sodium chloride, and poloxamer 188.

150. The composition of any one of claims 143 to 149, wherein the formulation comprises: a) about 1.35 mM to 1.65 mM potassium dihydrogen phosphate; b) about 7.29 mM to 8.91 mM sodium phosphate dibasic; c) about 2.43 mM to 2.97 mM potassium chloride; d) about 154.8 mM to 189.2 mM sodium chloride; and e) about 0.0001% to 0.01% poloxamer 188.

151. The composition of any one of claims 143 to 150, wherein the formulation comprises: a) about 1.5 mM potassium dihydrogen phosphate; b) about 8.1 mM sodium phosphate dibasic; c) about 2.7 mM potassium chloride; d) about 172 mM sodium chloride; and e) about 0.001% Poloxamer 188.

152. A composition as described in any one of claims 103 to 119 or 143 to 151, wherein the formulation is a sterile suspension.

153. The composition of any one of claims 103 to 119 or 143 to 152, wherein the formulation comprises sterile water.

154. The composition of any one of claims 103-119 or 143-153, wherein the volume of the formulation is about 0.01 mL to 0.2 mL.

155. The composition of any one of claims 103-119 or 143-154, wherein the volume of the formulation is about 0.09 mL.

156. A method for treating hearing loss in a subject having a defective otoferlin gene, comprising administering to the cochlea of ​​the subject a composition as described in any one of claims 89 to 155, wherein the first rAAV vector and the second rAAV vector are capable of constituting a polypeptide messenger RNA encoding full-length human otoferlin in the subject.

157. The method of claim 156, wherein the defective otoferlin gene comprises a mutation resulting in reduced expression and / or activity of the otoferlin protein encoded by the gene.

158. The method of claim 156 or 157, further comprising determining, prior to the administering step, that the subject has a defective otoferlin gene.

159. A method for treating hearing loss in a subject identified as having a biallelic otoferlin gene mutation, comprising administering a composition as described in any one of claims 89 to 155, wherein the first rAAV vector and the second rAAV vector are capable of constituting a polypeptide messenger RNA encoding full-length human otoferlin in the subject.

160. The method of claim 159, further comprising, prior to the administering step, determining that the subject has a biallelic otoferlin gene mutation.

161. The method of any one of claims 156 to 160, wherein the subject has clinical manifestations of bilateral profound sensorineural hearing loss.

162. The method of claim 161, wherein the subject has the clinical manifestation of bilateral profound sensorineural hearing loss when afebrile.

163. The method of any one of claims 156 to 162, wherein the method is used to reduce or prevent secondary degeneration of one or more cochlear structures.

164. The method of any one of claims 156 to 163, wherein the subject has preserved distortion product otoacoustic emissions (DPOAEs).

165. A method for expressing recombinant full-length otoferlin in mammalian cells, comprising administering to the mammalian cells a composition as described in any one of claims 89 to 155, wherein the first rAAV vector and the second rAAV vector are capable of constituting a polypeptide messenger RNA encoding full-length human otoferlin in the mammalian cells.

166. The method of claim 165, wherein the mammalian cell is a cochlear cell.

167. The method of claim 166, wherein the mammalian cell is an inner ear hair cell.

168. The method of claim 156 or 159, wherein the subject is a mammal.

169. The method of claim 156 or 159, wherein the subject is a human.

170. The method of any one of claims 156 to 169, wherein the composition is administered as a single dose.

171. The method of any one of claims 156 to 169, wherein the composition is administered in multiple doses.

172. The method of claim 171, wherein the composition is administered in 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses.

173. The method of any one of claims 156 to 172, wherein a single dose comprises about 0.01 mL - 0.2 mL.

174. The method of claim 173, wherein a single dose comprises about 0.09 mL.

175. The method of any one of claims 156 to 174, wherein the composition is administered to the round window membrane as an injection.

176. The method of claim 175, wherein the composition is administered as a single injection.

177. The method of claim 175, wherein the composition is administered as multiple injections.

178. The method of claim 177, wherein the composition is administered in 2, 3, 4, 5, 6, 7, 8, 9 or 10 injections.

179. The method of any one of claims 156 to 178, wherein the composition is administered using a medical device.

180. The method of claim 179, wherein the composition is preloaded in the device.

181. The method of claim 179 or 180, wherein the device is a device as shown in Figures 2-5.

182. The method of claim 179 or 180, wherein the device is a microcatheter.

183. The method of claim 182, wherein the microcatheter is shaped so that it can enter the middle ear cavity through the external auditory canal and bring the tip of the microcatheter into contact with the round window membrane (RWM).

184. The method of claim 182 or 183, wherein the distal end of the microcatheter comprises at least one microneedle having a diameter between 10 microns and 1,000 microns.

185. The method of claim 184, wherein the at least one microneedle comprises a curved portion and an angled tip.

186. The method of any one of claims 156 to 185, wherein the composition is delivered at a controlled flow rate.

187. The method of any one of claims 156 to 186, wherein the subject is between 2 and 17 years old.

188. The method of any one of claims 156 to 187, wherein administration of the composition improves the subject's auditory brainstem response (ABR) threshold response, age-appropriate behavioral audiometry, tympanometric measurement, and / or word / sentence recognition test.

189. A kit comprising the composition of any one of claims 89 to 155.

190. The kit of claim 189, wherein the composition is preloaded in the device.

191. The kit of claim 190, wherein the device is a microcatheter.

192. The kit of claim 191, wherein the microcatheter is shaped so as to enter the middle ear cavity through the external auditory canal and to bring the distal end of the microcatheter into contact with the round window membrane (RWM).

193. A drug box as described in claims 191 or 192, wherein the distal end of the microcatheter is composed of at least one microneedle having a diameter between 10 microns and 1,000 microns.

194. The kit of claim 189, further comprising a device.

195. The kit of claim 194, wherein the device is a device as described in any one of Figures 2-5.

196. The kit of claim 194 or 195, wherein the device comprises a needle comprising a curved portion and an angled tip.

197. The kit of any one of claims 194 to 196, further comprising a vial containing the composition.

198. The kit of claim 197, wherein the vial is a single-use vial.

199. The kit of claim 197 or 198, further comprising a second vial comprising a diluent.

Images