Disease-resistant and growth-promoting pseudomonas asian LC40 and application thereof

Abstract

The invention discloses a strain of disease-resistant and growth-promoting pseudomonas avenae LC40 and application thereof, and relates to the technical field of microorganisms, the pseudomonas avenae is specifically pseudomonas avenae LC40, the pseudomonas avenae LC40 is preserved in China General Microbiological Culture Collection Center (CGMCC) on December 2, 2024, and the preservation number is CGMCC No.32869. The invention further discloses a method for preparing the disease-resistant and growth-promoting pseudomonas avenae LC40. The bacterial strain can be used for inhibiting tobacco mosaic virus (TMV), tomato brown fruit ruffle virus (ToBRFV), rice blast germ (Magnaporthe oryzae) and alternaria tenuissima (Alternaria tenuissima), and the bacterial strain can be used for inhibiting the tobacco mosaic virus (TMV), the tomato brown fruit ruffle virus (ToBRFV), the rice blast germ (Magnaporthe oryzae (Magnaporthe oryzae (Magnaporthe oryzae (Magnaporthe oryzae) and the allium tenuissima (Alternaria tenuissima). The Pseudomonas Asian LC40 provided by the invention has phosphorus solubilizing capacity and can secrete auxin compounds IAA, and field test results show that the LC40 strain has the effects of promoting growth and increasing yield of tomatoes. The pseudomonas Asian LC40 strain can effectively prevent and control plant diseases and promote crop growth, so that the yield and quality of crops are improved, and the pseudomonas Asian LC40 strain shows good application prospects of disease prevention and growth promotion.

Description

Technical Field

[0001] The present application belongs to the technical field of biological control of plant diseases, and specifically relates to a strain of Pseudomonas Asiaticus LC40, and its application in biological control of plant diseases and promoting crop growth. Background Art

[0002] Plant virus diseases are known as "plant cancer" and are one of the main threats to the growth of many crops, fruits, vegetables and ornamental plants. Among them, tobacco mosaic virus (TMV) is one of the most destructive plant viruses. Once it infects crops, it will seriously affect the yield and quality of crops, posing a huge threat to agricultural production. Tomato brown rugose fruit virus (ToBRFV) is a member of the genus Tobacco mosaic virus (TMV). Tobamovirus ) is a new species that spreads very quickly. It can survive in host plants and seeds for a long time and spread over long distances through cross-regional transportation, causing serious damage to major tomato producing areas. The study found that the virus infection rate of tomato seeds collected from ToBRFV-infected tomatoes can reach 100%, and the virus has broken through the resistance genes of tomato varieties. Tm - 2 2 ， So far, there have been no reports on research into germplasm materials resistant to ToBRFV.

[0003] Fungal diseases are the most serious diseases in agricultural production. Once they occur, they will seriously threaten the yield and quality of crops. Magnaporthe oryzae ) is one of the most serious diseases in rice production, causing a 10% to 35% reduction in rice production worldwide each year, posing a huge threat to food security. Chives are one of the most widely grown vegetables and condiments in China. In the case of continuous planting and high multiple cropping index, Alternaria tenuissima ( Alternaria tenuissima ) has become a major problem affecting chive production.

[0004] The main prevention and control methods for common plant diseases include breeding disease-resistant varieties, agricultural prevention, biological prevention, physical prevention and chemical prevention. Cultivating disease-resistant plant varieties by introducing disease-resistant genes is considered to be a more effective measure to prevent and control plant diseases, but the cycle of screening and breeding excellent disease-resistant varieties is long and the cost is high. Although chemical prevention methods are efficient and convenient, the large-scale application of chemical pesticides has made problems such as excessive pesticide residues and environmental pollution increasingly prominent. Finding safer and more effective prevention and control methods has become a hot topic in current research.

[0005] Biological control is an environmentally friendly control method that mainly uses microorganisms and their metabolites in the natural environment to control diseases. At present, about 1,000 species of biological control microorganisms have been discovered, mainly including fungi, bacteria and actinomycetes. Among them, Pseudomonas spp. ( Pseudomonas sp.), Bacillus ( Bacillus sp.), Streptomyces ( Streptomyces sp.), Penicillium ( Penicillium sp.) and Trichoderma ( Trichoderma sp.) etc. Pseudomonas bacteria ( Pseudomonas sp.) is widely used because of its strong ecological adaptability and rhizosphere colonization ability, as well as its ability to directly promote plant growth and inhibit plant pathogens. At present, studies have reported the control of plant viral diseases and fungal diseases by biocontrol bacteria. However, most of these studies on the use of biocontrol bacteria to control plant viral diseases focus on TMV, and there are no reports on the use of biocontrol bacteria for the control of ToBRFV. Therefore, it is particularly important to screen biocontrol bacteria that have both broad-spectrum disease resistance and the ability to promote crop growth, especially when facing a virus such as ToBRFV that is highly invasive, spreads quickly, and is difficult to control. This need is even more urgent. Summary of the invention

[0006] To solve the above problems, the present application provides a disease-resistant, growth-promoting and yield-increasing Pseudomonas asiaticus ( Pseudomonas asiatica ) LC40, not only has obvious inhibitory and passivation effects on tobacco mosaic virus (TMV) and tomato brown rugose fruit virus (ToBRFV), but also has a significant inhibitory and passivation effect on rice blast fungus ( Magnaporthe oryzae )、Alternaria tenuifolia( Alternaria tenuissima ) has a significant inhibitory effect and can significantly promote the growth and yield of tomato plants. The strain and its application are achieved through the following technical solutions: On the one hand, the present application provides a strain of Pseudomonas asiatica ( Pseudomonas asiatica ) LC40, Pseudomonas asiaticus LC40 was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on December 2, 2024, with the deposit number CGMCC No.32869, and was classified as Pseudomonas asiaticus Pseudomonas asiatica The storage address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0007] On the other hand, the present application also provides a Pseudomonas asiaticus fermentation broth, which contains the above-mentioned Pseudomonas asiaticus LC40.

[0008] On the other hand, the present application also provides a use of Pseudomonas Asiaticus fermentation broth in inhibiting tobacco mosaic virus, and the Pseudomonas Asiaticus fermentation broth is the above-mentioned Pseudomonas Asiaticus fermentation broth.

[0009] On the other hand, the present application also provides a method for inhibiting rice blast fungus ( Magnaporthe oryzae ) and Alternaria tenuissima ( Alternaria tenuissima ), the Pseudomonas asiaticus fermentation broth is the above-mentioned Pseudomonas asiaticus fermentation broth.

[0010] On the other hand, the present application also provides a crude protein extracted from Pseudomonas asiaticus, wherein the crude protein extracted from Pseudomonas asiaticus comprises the above-mentioned Pseudomonas asiaticus LC40.

[0011] On the other hand, the present application also provides an application of a crude protein extract of Pseudomonas Asiaticus in inhibiting tobacco mosaic virus and tomato brown wrinkled fruit virus. The crude protein extract of Pseudomonas Asiaticus is the above-mentioned crude protein extract of Pseudomonas Asiaticus.

[0012] On the other hand, the present application also provides a use of Pseudomonas Asiaticus in promoting tomato growth and increasing yield, wherein the Pseudomonas Asiaticus is the above-mentioned Pseudomonas Asiaticus LC40.

[0013] Beneficial Effects The Pseudomonas asiatica LC40 strain of the present application was identified as Pseudomonas asiatica ( Pseudomonas asiatica ), is a highly effective disease-resistant and growth-promoting biocontrol bacterium. This strain has a significant passivation effect on TMV and ToBRFV, and has a highly effective preventive effect on TMV; it has a significant inhibitory effect on the growth of rice blast fungus and Alternaria tenuissima hyphae. Pseudomonas asiaticus LC40 strain has the ability to solubilize phosphate and secrete IAA. Field experiment results showed that strain LC40 also has a significant effect on promoting growth and increasing yield of tomatoes. Pseudomonas asiaticus LC40 is easy to culture, easy to preserve, environmentally friendly and safe for humans and animals. It has both growth-promoting and disease-preventing effects and has the potential to be developed into biological fertilizers and biological pesticides.

[0014] The present application provides an application of an Asian Pseudomonas LC40 strain for disease prevention and growth promotion. The LC40 fermentation broth and crude protein have good passivation effects on TMV and ToBRFV, wherein the inhibition rate of the fermentation broth on TMV is 68.40%, and the inhibition rates of the crude protein on TMV and ToBRFV are 76.68% and 70.11%, respectively.

[0015] The Asian Pseudomonas LC40 strain of the present application is effective against rice blast fungus ( Magnaporthe oryzae ) and Alternaria tenuissima ( Alternaria tenuissima) had a significant inhibitory effect on the mycelium growth of both fungi, with the inhibition rates on the mycelium growth of Rice blast fungus and Alternaria tenuissima being 76.07% and 50.98%, respectively.

[0016] The present application also provides the application of Pseudomonas Asiaticus LC40 strain for disease prevention and growth promotion. The field test results show that spraying 150 times diluted fermentation liquid of Pseudomonas Asiaticus LC40 strain can effectively promote the growth of tomato plants and increase yield. The tomato plant height in the field test area of ​​Pseudomonas Asiaticus LC40 strain is 14.7 cm higher than that in the farmer's self-protection control area, with an average increase of 8.79%, and there are more large fruits in the LC40 test area, with the heaviest single fruit reaching 530 g.

[0017] It should be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The above and other objects, features and advantages of the present application will become more apparent by describing in more detail the exemplary embodiments of the present application in conjunction with the accompanying drawings, wherein the same reference numerals generally represent the same components in the exemplary embodiments of the present application.

[0019] Figure 1 This is the colony morphology of the Pseudomonas asiaticus LC40 strain on LB medium in this application.

[0020] Figure 2 The bacterial morphology of Pseudomonas asiaticus LC40 strain under electron microscope in this application.

[0021] Figure 3 This is the phosphate solubilization result of Pseudomonas asiatica LC40 strain in this application.

[0022] Figure 4 The results of the IAA secretion ability test of Pseudomonas asiatica LC40 strain in this application; A: LC40 strain fermentation broth without Salkowski colorimetric solution; B: LC40 strain fermentation broth with Salkowski colorimetric solution added.

[0023] Figure 5 Phylogenetic tree of 16S rRNA of Pseudomonas Asiaticus LC40 strain for this application.

[0024] Figure 6 This application discloses the passivation effect of the fermentation broth of Pseudomonas Asiaticus LC40 strain on TMV.

[0025] Figure 7 This is a diagram showing the passivation effect of crude protein extracted from Pseudomonas Asiaticus LC40 on TMV in this application.

[0026] Figure 8 This application is for the preventive effect of the fermentation broth of Pseudomonas Asiaticus LC40 strain on TMV; A: Comparison of spraying 30% chlorpyrifos wettable powder 1000 times diluted and the control B: Comparison of the group treated with the fermentation liquid of Pseudomonas asiatica LC40 and the control group; C: overhead photos of treatment and control; D: Enlarged image of LB control; E: Enlarged image of the LC40 strain treatment group.

[0027] Fig. 9 This application describes the inactivation effect of crude protein of Pseudomonas Asiaticus LC40 strain on ToBRFV.

[0028] Fig.10 The results show that Pseudomonas Asiaticus LC40 strain inhibits the growth of pathogenic fungi hyphae. Fig.11 This paper presents the statistical results of tomato plant height under different treatments and at different investigation times in the field trial of Pseudomonas Asiaticus LC40 strain.

[0029] Fig.12 This application presents the statistical results of the number of tomato flower stalks under different treatments and at different survey times in the field trial of Pseudomonas Asiaticus LC40 strain.

[0030] Biological Deposit Description Pseudomonas asiatica ( Pseudomonas asiatica ) LC40 was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on December 2, 2024, with the deposit number CGMCC No.32869, and the classification name was Pseudomonas Asiaticus Pseudomonas asiatica The storage address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the status is alive. DETAILED DESCRIPTION

[0031] The embodiments of the present application will be described in more detail below with reference to the accompanying drawings. Although the embodiments of the present application are shown in the accompanying drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described below. On the contrary, the embodiments provided in the text are intended to make the present application more thorough and complete, and to fully convey the scope of the present application to those skilled in the art.

[0032] Previous studies have found that Pseudomonas asiatica ( Pseudomonas asiatica ) has the ability to efficiently remove ammonia nitrogen and can be used for water environment treatment, but there is little research on promoting plant growth and preventing plant viral diseases. This application screened a strain of Pseudomonas Asiaticus ( Pseudomonas asiatica) LC40, which has disease resistance and growth-promoting functions, can provide resources for the development and utilization of microbial preparations and provide new options for the green prevention and control of crop diseases.

[0033] The present application provides a strain of Pseudomonas asiatica ( Pseudomonas asiatica ) LC40 and its application. The bacterium has a significant passivation effect on tobacco mosaic virus and tomato brown wrinkle fruit virus, has a good inhibitory effect on rice blast fungus and Alternaria tenuissima, and can promote the growth of tomato plants and increase yield, thereby reducing the application of chemical pesticides and fertilizers and achieving sustainable agricultural development. It has good application prospects in agricultural production.

[0034] The culture medium preparation method used in the embodiment is as follows: LB medium (1 L): Weigh 10 g of tryptone, 5 g of yeast extract powder, and 10 g of NaCl, add 1 L of ddH2O (add 10 g of agar powder for solid culture medium and nothing for liquid culture medium), then sterilize at 121°C under high pressure for 20 min. After cooling to about 56°C, pour the solid culture medium into a plate for later use.

[0035] VL55 medium (1 L): VL55 medium is mainly used for soil microbial isolation. The (1×) formula is as follows: weigh 1.95 g 2-(N-morpholino)ethanesulfonic acid, 0.024 g MgSO4, 0.033294 g CaCl2, 0.026421 g [(NH4)2HPO4], 1 mL selenite / tungstate solution, and 1 mL trace solution SL10 in advance, then add 800 mL of ddH2O to dissolve, adjust the pH to 7.2 (which is consistent with the pH of the soil) with a mixture of 0.2 mol / L NaOH and 0.1 mol / L KOH, add 15 g agar to make up to 1 L, autoclave at 121 ℃ for 20 min, cool to about 56 ℃, add 10 mL 5% (w / v) xylan solution, 2 mL vitamin solution 1 and 6 mL vitamin solution 2, mix well, and pour into a plate for later use.

[0036] PDA medium (1 L): Weigh 200 g of potatoes and cook until paste-like. Filter with gauze, add 20 g of glucose and 15 g of agar, and make up to 1 L with ddH2O. Autoclave at 121 ℃ for 20 min, cool to about 56 ℃, and pour into a plate for later use.

[0037] NBPIP medium (1 L): weigh 10.0 g glucose, 2.5 g Ca3(PO4), 5.0 g MgCl2, 0.25 g MgSO47H2O, 0.2 g KCl, 0.1 g [(NH4)2SO4], and 15.0 g agar, add ddH2O to make up to 1 L, sterilize at 121 ℃ for 20 min, cool to about 56 ℃, and pour into a plate for later use.

[0038] Glucose peptone water culture medium (1 L): peptone 7 g, glucose 5 g, KH2PO4 5 g, add ddH2O to make up to 1 L, and sterilize at 121 ℃ for 20 min.

[0039] Nitrate reduction reaction medium (1 L): 3 g beef extract, 5 g peptone, 31 g KNO, add ddH2O to make up to 1 L, and sterilize at 121 ℃ for 20 min.

[0040] Tryptic soy broth (TSB) (1 L): Weigh 30 g of TSB dry powder, add ddH2O to make up to 1 L, stir and boil until completely dissolved, and sterilize at 121 ℃ for 20 min.

[0041] Unless otherwise specified, the samples or materials used in the following examples were purchased from the market.

[0042] Example 1 Isolation of Pseudomonas asiatica LC40 strain Source of soil samples: The soil was taken from the cigar tobacco planting base in Mengding Town, Gengma Dai and Wa Autonomous County, Lincang City, Yunnan Province. The rhizosphere soil of diseased plants and their surrounding healthy plants was selected. The roots of the plants were pulled up, and the larger soil blocks were removed and placed in a sterile sampling bag. The soil was brought back to the laboratory and stored in a 4°C refrigerator for later use.

[0043] Take 1 g of rhizosphere soil and part of the fibrous root sample and put it into 10 mL of sterile distilled water, shake and culture at 220 rpm for 30 min, and let it stand at room temperature for 5 min to obtain the stock solution. Pipette 100 μL of the stock solution into 900 μL of sterile water and mix well to obtain 10 -1 Dilution. Use the same dilution method to perform gradient dilution to obtain 10 -3 , 10 -4 , 10 -5 Dilution. Pipette 100 μL of 10 -3 , 10 -4 and 10 -5The dilution was evenly spread on VL55 medium, with 3 plates for each gradient, and placed in an incubator at 28°C for inversion culture for 7-8 days. Single colonies with different morphologies were picked and cultured on new VL55 medium for 5-7 days. After repeated purification 2-3 times, single colonies were picked for fermentation culture. The screening method for antagonistic strains is as follows: (1) Screening of antagonistic bacteria: Bacillus cereus ( Bacillus cereus ) was used as the indicator bacteria to screen the antagonistic bacteria with antibacterial effect. The volume ratio was 1:100. 600 =0.33 (1×10 8 cfu / mL) of Bacillus cereus fermentation liquid and sterilized LB medium were mixed and poured into the plate. 8 spaces were marked on the plate in proportion, and an Oxford cup was placed in each space. 100 μL of the fermentation liquid of the strain to be tested was added to the Oxford cup. After sealing with sealing film, it was placed in a 28 ℃ incubator for 1-2 days. Antagonistic bacteria were screened according to whether the inhibition zone was formed on the plate.

[0044] (2) Purification of antagonistic bacteria: According to the size of the inhibition zone, target bacteria with antibacterial activity are selected and purified by “Z”-shaped streaking culture on LB solid culture medium.

[0045] Results: A total of 95 bacterial strains were isolated from 25 rhizosphere soil samples of cigar tobacco. After screening with Bacillus cereus as the indicator bacteria, the strain with the largest inhibition zone diameter (1.3 cm) was obtained and named LC40.

[0046] Strain preservation: The LC40 strain was inoculated into LB liquid medium and fermented for 12-24 h, then mixed with 50% glycerol at a volume ratio of 1:1 and stored in a -80 ultra-low temperature refrigerator for later use.

[0047] Example 2 Identification of LC40 strain Identification method: The strain was identified through morphological characteristics, physiological and biochemical properties and molecular biology.

[0048] LC40 strain morphological identification The strain LC40 was streaked onto an LB plate and cultured at 28 °C for 24 h before observing the morphology of single colonies. The morphological characteristics of the strain were observed under a transmission electron microscope, and the bacterial staining results were observed under an optical microscope after Gram staining.

[0049] LC40 morphological characteristics: On LB solid medium, the colonies are white with a yellowish tint, round, smooth, with neat edges, moist and shiny, with a special pungent odor, and do not produce pigment (see Figure 1 The bacteria are rod-shaped, with 1 to 3 flagella ( Figure 2 ). Gram stain negative.

[0050] 2. Physiological and biochemical identification of LC strains The physicochemical properties of the LC40 strain were determined by referring to the relevant contents of the determination of physiological and biochemical characteristics in the Bergey's Manual of Bacterial Identification (9th edition).

[0051] Determination of the IAA production capacity of the LC40 strain: After the activated LC40 fermentation broth was inoculated into R2A liquid culture medium containing 200 mg / L L-tryptophan and cultured overnight, 5 mL of the bacterial solution was added into 0.5 mL of Salkowski colorimetric solution (150 mL of H2SO4 was slowly poured into 250 mL of distilled water, stirred and cooled, and then 7.5 mL of 0.5 mol / L FeCl3.6H2O was added and mixed). The culture was shaken for 30 min. If the color of the bacterial solution turns red or pink, it has the ability to secrete IAA (positive), and if it does not change color, it is negative.

[0052] Test of LC40 strain's phosphate solubilizing ability: Take 50 μL of LC40 strain fermentation liquid and inoculate it in the center of NBPIP solid culture medium, place it in a 28 ℃ incubator and culture it for 6 days. After staining with 5% bromophenol blue for 3 min, pour out the staining liquid, rinse with clean water and judge the phosphate solubilizing ability of the strain by observing whether degradation zone is formed around the colony.

[0053] Gelatin liquefaction test: Pipette 10 μL of the overnight cultured LC40 strain fermentation liquid into a gelatin culture medium tube, incubate at 27°C for 5 days, and then place at 4°C for 30 min. If the gel is liquefied when taken out, it is positive; if the gel resolidifies or does not liquefy, it is negative.

[0054] Methyl red test: Inoculate the LC40 strain into 5 mL of glucose-peptone water culture medium and culture overnight. Then drip 2-3 drops of methyl red along the wall of the test tube. If the bacterial solution turns red, it is positive; if there is no color change, it is negative.

[0055] Nitrate reduction reaction: inoculate the LC40 strain into nitrate reduction reaction medium, culture at 37 ℃ 200 rpm for 3 days, add 2 to 3 drops of agent A (8.0 g p-aminobenzenesulfonic acid dissolved in 1000 mL 5 mol / L acetic acid) and agent B (2.5 g α-naphthol dissolved in 1000 mL 5 mol / L acetic acid) and mix well. If red color appears, it is positive, and if there is no color change, it is negative.

[0056] VP test: Take 2 mL of overnight cultured LC40 strain fermentation liquid, 1 mL of 6% α-naphthol and 0.4 mL of 40% KOH, mix and shake for 5 min. If it turns red immediately or within 2 h at room temperature, it is positive; if it does not turn red, it is negative.

[0057] NaCl tolerance test: 100 μL of the fermentation broth of the LC40 strain at the same growth logarithmic phase was added to LB liquid medium with NaCl concentrations of 2%, 4%, and 8%, respectively. After culturing at 28°C and 220 rpm for 24 h, the OD value was measured. 600 Values ​​were used to compare the status of the analyzed strains.

[0058] Acid resistance test: 100 μL of the fermentation broth of the strain LC40 at the same growth logarithmic phase was added to the LB liquid medium at pH = 4, pH = 6, and pH = 7. After culturing at 28 °C and 220 rpm for 24 h, the OD was measured. 600 Values ​​were used to compare the status of the analyzed strains.

[0059] As shown in Table 1, the LC40 strain can dissolve phosphorus ( Figure 3 ), has the ability to secrete IAA ( Figure 4 In addition, the gelatin liquefaction, methyl red reaction, nitrate reduction reaction and VP test were negative, the salt tolerance concentration was 1%-4% (NaCl), and it could be fermented in an acidic environment of pH 5-7.

[0060] Table 1 Morphological characteristics and physiological and biochemical properties of strain LC40 Note: +: positive; -: negative 3. Molecular biological identification of LC40 strain The LC40 strain obtained by screening was reactivated on LB solid medium. The genomic DNA of the bacteria was extracted using a column-type bacterial genomic DNA extraction kit. The 16S rRNA gene of the bacteria was amplified using universal primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGGCTACCTTGTTACGACTT) with the genomic DNA of the strain as a template. The PCR products were detected by 1% agarose gel electrophoresis, and the positive PCR products were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequenced 16S rRNA was compared with the 16S rRNA gene sequences of other strains in the NCBI database, and the corresponding strain sequences were downloaded from the NCBI database. The phylogenetic tree was constructed using FastTree / iqtree / raxml software.

[0061] The 16S rRNA gene sequence of the LC40 strain obtained by sequencing was 1501 bp, and the sequence is shown in SEQ ID NO. 1: The 16S rRNA gene sequence of LC40 strain was compared with the Blast sequence in the NCBI database. P. asiatica strain RYYT (CP127872.1) and P. asiatica The 16S rRNA gene sequence of strain RA-6B (CP128558.1) was the most consistent, reaching 99.80%. At the same time, the phylogenetic tree constructed based on the 16S rRNA gene sequences of different Pseudomonas species showed that the LC40 strain was P. asiatica JP233 (025853855.1), P. asiatica NMI3658 (021283465.2), P. asiatica PIGCA (028752155.1) and others clustered on the same branch ( Figure 5 ).

[0062] In summary, through the morphological characteristics, physiological and biochemical properties and molecular biological identification of strain LC40, it was determined that strain LC40 was a Pseudomonas spp. Pseudomonas ) of Pseudomonas asiatica ( Pseudomonas asiatica ). It was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on December 2, 2024. The deposit address is located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC No.32869.

[0063] Example 3 Inhibitory effect of LC40 strain on TMV and ToBRFV 1. Inactivation of TMV by LC40 fermentation broth Preparation of TMV virus source: Weigh 0.5 g of Nicotiana benthamiana leaves infected with TMV, add 10 mL of sterile phosphate buffer (0.01 mol / L PBS), grind into a homogenate, centrifuge at 6000 rpm at 4 ℃ for 5 min, and then aspirate the supernatant as the inoculum.

[0064] Extraction of crude protein by ammonium sulfate precipitation: LC40 strain was inoculated into 3 mL LB liquid medium, and cultured at 28°C and 220 rpm for 24 h to prepare seed solution. The seed solution was inoculated into a flask containing 300 mL LB liquid medium at an inoculum of 1:100, and cultured at 28°C and 220 rpm for 48 h; centrifuged at 4°C and 10,000 rpm for 15 min, and the supernatant was filtered through a bacterial filter ( d=0.22 μm) to obtain sterile fermentation filtrate. Add solid ammonium sulfate to the sterile fermentation broth to a saturation of 80%, precipitate at 4°C overnight, centrifuge at 10,000 rpm for 20 min, and collect the precipitate. Take 20 mL of 0.02 mol / L PBS buffer to suspend the precipitate and put it into a dialysis bag. Place it in the same concentration of PBS buffer for dialysis and desalination to obtain crude protein. Use sucrose powder to remove excess water in the dialysis bag. The concentrated crude protein is divided into 1.5 mL centrifuge tubes and stored at -80°C for later use.

[0065] Test the inhibitory effect of LC40 strain fermentation broth on TMV: the strain was inoculated into TSB liquid medium at a volume ratio of 1:100 and cultured overnight, and diluted with sterile water to OD 600 The fermentation liquid with a concentration of 1.0 was used as standby. Using the friction inoculation method, the fermentation liquid of LC40 strain was mixed with TMV inoculation buffer in equal volumes, incubated at room temperature for 2 h, and then inoculated into the right half of the heartleaf tobacco leaf; the TSB liquid medium and TMV inoculation buffer were mixed in equal volumes and incubated at room temperature for 2 h, and then inoculated into the left half of the leaf as a control. At the same time, 1000 times of 30% chlorpyrifos wettable powder was mixed with TMV inoculation liquid in equal volumes and incubated at room temperature for 2 h, and friction inoculated into the right half of the heartleaf tobacco leaf as a drug control; the mixture of TSB and TMV inoculation liquid was friction inoculated into the left half of the heartleaf tobacco leaf as a negative control. Each half leaf was inoculated with 100 μL of the mixture, and each treatment was repeated 3 times. 10 min after inoculation, an appropriate amount of clean water was sprayed on the leaf surface to keep the leaves moist. The number of dead spots of heartleaf tobacco was investigated 3 days after inoculation and the inhibition rate was calculated.

[0066] The passivation effect of crude protein of LC40 strain on TMV was tested: the crude protein of LC40 strain diluted to 1 mg / mL was mixed with equal volumes of TMV inoculation solution, incubated at room temperature for 2 h, and inoculated into the right half of the heart leaf tobacco leaf by friction inoculation; the left half leaf was inoculated with PBS and TMV (1:1 volume ratio) incubated at room temperature for 2 h as a control. At the same time, 1000 times of 30% chlorpyrifos wettable powder was mixed with equal volumes of TMV inoculation solution and incubated at room temperature for 2 h, and friction inoculated into the right half of the heart leaf tobacco leaf as a drug control; the mixture of PBS and TMV inoculation solution was friction inoculated into the left half of the heart leaf tobacco leaf as a negative control. 100 μL of the mixture was inoculated on each half leaf, and repeated 3 times. 10 min after inoculation, spray an appropriate amount of clean water on the leaf surface to keep the leaves moist. The number of dead spots was investigated 3 days after inoculation and the inhibition rate was calculated.

[0067] Inhibition rate (%) = (average number of necrotic spots in control group - average number of necrotic spots in treatment group) / average number of necrotic spots in control group × 100%.

[0068] As shown in Table 2, Table 3 and Figure 6 , Figure 7As shown, the average inhibition rates of LC40 fermentation broth and crude protein on TMV were 68.63% and 76.68%, respectively, indicating that LC40 fermentation broth and crude protein both had a passivation effect on TMV, and the effect was better than 30% chlorpyrifos wettable powder.

[0069] Table 2 Inhibitory effect of Pseudomonas asiatica LC40 fermentation broth on TMV Table 3 Inhibitory effect of crude protein extracted from Pseudomonas asiatica LC40 on TMV 2. Preventive effect of LC40 fermentation broth on TMV The preventive effect of LC40 fermentation broth on TMV was determined by the preventive mode: the activated LC40 fermentation broth was inoculated into 20 mL of LB liquid medium for overnight culture, and the fermentation broth was diluted to OD 600 After the value reached 1.0, the leaves of common tobacco K365 at the 3-4 leaf stage were sprayed. Spraying LB liquid medium was used as a negative control, and spraying 1000 times diluted 30% chlorpyrifos wettable powder was used as a positive control. TMV infectious clone (pCB-TMV) transformed into Agrobacterium was inoculated 48 hours after spraying. Each common tobacco K326 was inoculated with OD 600 100 μL of Agrobacterium containing TMV-infectious clones with a TMV value of 0.8 was added. Symptoms were observed 21 days after TMV inoculation.

[0070] The severity classification of TMV disease refers to the national standard GB / T 23222-2008 "Grading and Investigation Methods of Tobacco Pests and Diseases" on "Grading Standards for Tobacco Mosaic Virus (TMV)" (Table 4).

[0071] Table 4 TMV disease severity classification standards Note: The survey is graded based on the plant. Disease index calculation method: Disease index = ∑ (number of diseased plants or leaves at each level × value of the disease level) / (total number of plants or leaves surveyed × highest level value) × 100 Inhibition rate (%) = [(disease index of control group - disease index of treatment group) / disease index of control group] × 100% As shown in Table 5 and Figure 8As shown in the figure, the plants in the LC40 fermentation liquid treatment group grew normally, with no obvious mosaic symptoms and a disease index of 22.22, while the plants in the LB control group were dwarfed, with severe mosaic and deformity symptoms and a disease index of 80. After calculation, the inhibition rate of the LC40 fermentation liquid on TMV was 72.22%, and the inhibition effect on TMV was better than that of 30% chlorpyrifos wettable powder. The above results show that the LC40 fermentation liquid has a significant preventive effect on TMV.

[0072] Table 5 Survey results of TMV disease severity after spraying LC40 fermentation liquid (III) Anti-ToBRFV activity test of crude protein extracted from LC40 strain The above invention uses TMV as the control target, verifies that the fermentation broth and crude protein of Pseudomonas Asiaticus LC40 have a significant passivation effect on TMV, and further verifies the anti-ToBRFV effect of LC40 crude protein.

[0073] The half-leaf dead spot method verifies the passivation effect of crude protein of LC40 strain on ToBRFV: The preparation of the toxin source is the same as (I). After the crude protein of LC40 strain diluted to 1 mg / mL is mixed with equal volumes of ToBRFV inoculation solution, it is incubated at room temperature for 2 hours and inoculated into the right half of the heart leaf tobacco by friction inoculation; the left half leaf is inoculated with PBS and ToBRFV (1:1 volume ratio) incubated at room temperature for 2 hours as a control. At the same time, 1000 times of 30% chlorpyrifos wettable powder was mixed with equal volumes of ToBRFV inoculation solution and incubated at room temperature for 2 hours, and friction inoculated into the right half of the heart leaf tobacco as a drug control; the mixture of PBS and ToBRFV inoculation solution was friction inoculated into the left half of the heart leaf tobacco as a negative control. 100 μL of the mixture was inoculated on each half leaf, and repeated 3 times. 10 minutes after inoculation, spray an appropriate amount of clean water on the leaf surface to keep the leaves moist. Three days after inoculation, the number of dead spots was investigated and the inhibition rate was calculated. The inhibition rate calculation method is the same as in Example 3 (I).

[0074] As shown in Table 6 and Fig. 9 As shown, the inhibition rate of crude protein from LC40 strain on ToBRFV was 70.11%, indicating that it had a good inhibitory effect on ToBRFV.

[0075] Table 6 Inhibitory effect of Pseudomonas asiatica LC40 crude protein on ToBRFV Example 4 Inhibitory effect of LC40 strain on pathogenic fungi Test pathogenic fungi: Banana wilt pathogen Fusarium oxysporum Cuban transformation type 4 physiological subspecies ( Fusarium Oxysporium f. sp. cubensetropical race 4:Foc 4), Rice blast fungus ( Magnaportheoryzae )、Alternaria tenuifolia( Alternaria tenuissima ) and Rhizoctonia solani ( Rhizoctoniasolani ).

[0076] The antagonism experiment was conducted by plate confrontation culture method. The confrontation experiment method is as follows: the pathogenic fungus and LC40 strain were inoculated on PDA and LB plates respectively, and a single LC40 spot was picked and inoculated into LB liquid culture medium, and cultured overnight at 28 ℃ and 220 rpm. When the PDA culture medium cooled to about 45 ℃, OD 600 The fermentation liquid of LC40 strain was added to 0.4, and the mixture was thoroughly mixed and then poured into plates. The plate without LC40 was used as the control, and a pathogenic fungus cake with a diameter of 1 cm was inoculated in the center of the plate. Three replicates were set for each treatment. The plate was inverted and cultured at 28°C until the control grew all over the plate, and the diameter of the pathogenic fungus colony was measured to calculate the growth inhibition rate of the LC40 strain on the pathogenic fungus hyphae.

[0077] Inhibition rate (%) = (colony diameter of control group - colony diameter of treatment group) / colony diameter of control group × 100%.

[0078] From Table 7 and Fig.10 It can be seen that among the four pathogenic fungi, LC40 strain was the most effective against Magnaporthe oryzae ( Magnaportheoryzae )、Alternaria tenuifolia( Alternaria tenuissima ) and Fusarium oxysporum Cuban transformation type 4 physiological subspecies ( Fusarium oxysporium f. sp. cubense tropical race 4:Foc 4) had an inhibitory effect, among which the best inhibitory effect was on rice blast fungus, with an inhibition rate of 76.08%; followed by Alternaria tenuissima, with an inhibition rate of 50.98%; the worst inhibitory effect was on Fusarium oxysporum Cuban transformation type 4 physiological subspecies ( Fusarium oxysporium f. sp. cubense tropical race 4:Foc 4), the inhibition rate was only 34.51%; while for Rhizoctonia solani ( Rhizoctoniasolani ) had no inhibitory effect. This showed that the LC40 strain had an inhibitory effect on some pathogenic fungi.

[0079] Table 7 Inhibition rate of Pseudomonas asiatica LC40 strain against four pathogenic fungi Example 5 Effect of LC40 strain on promoting growth and increasing yield of tomatoes Indoor experiments have shown that the LC40 strain is resistant to TMV and ToBRFV, inhibits the growth of pathogenic fungi such as rice blast fungus and Alternaria tenuissima, and has the ability to dissolve phosphorus and secrete IAA. On this basis, field experiments were conducted to verify the growth-promoting effect of the LC40 strain on the crop tomato. The field experiment was arranged and implemented at the tomato planting base in Jinma Town, Luxi County, Honghe Prefecture, Yunnan Province. The variety planted was "Ruifei", purchased from Syngenta. The test period was from June to November.

[0080] (1) Experimental plot design: The experimental field is divided into three greenhouses with a total area of ​​388.8 m 2 Each greenhouse has an area of ​​129.6 m 2 , divided into three small areas, each with an area of ​​43.2 m 2 Each plot was planted with 4 rows at a row spacing of 1.2 m and 16 plants per row at a plant spacing of 45 cm, for a total of 64 tomato plants. 192 tomato plants were planted in each treatment. The three greenhouses were arranged with the same treatment and control groups, with 3 replicates.

[0081] The microbial agent used in the field test: shake flask fermentation OD 600 =1.0 LC40 strain solution, diluted 150 times with water when used, the concentration of sulfur-loving red oomycete HNI-1 was 2×10 8 cfu / mL, diluted 300 times before use.

[0082] There are three treatments in the experiment, namely the farmer self-defense control area, the LC40 strain fermentation liquid test area, and the sulfur-loving red oomycete HNI-1 test area. The farmer self-defense control area is a conventional treatment; the LC40 strain fermentation liquid test area is based on the conventional treatment, and the LC40 strain fermentation liquid diluted 150 times is sprayed during different growth stages of tomatoes; the sulfur-loving red oomycete HNI-1 test area is based on the conventional treatment, and the sulfur-loving red oomycete HNI-1 is sprayed during the growth period of tomatoes with a 300-fold dilution. The specific implementation method is as follows: Two weeks after sowing tomato seeds, 1 L of 150-fold diluted LC40 fermentation liquid and 300-fold diluted HNI-1 (1×10 8cfu / mL) were sprayed evenly on the corresponding seedbeds. On the day of transplanting, the tomato seedlings in the corresponding treatment area were dipped in 150 times the fermentation liquid of LC40 strain and 300 times the sulfur-loving red oomycete HNI-1 for 5 minutes. In the first month after transplanting, each plot was sprayed with 150 times diluted LC40 strain fermentation liquid or 300 times diluted sulfur-loving red oomycete HNI-1 once every 7 days, and 3 L was sprayed in each plot for a total of 3 times. After that, 150 times diluted LC40 strain fermentation liquid or 300 times diluted sulfur-loving red oomycete HNI-1 was sprayed once every 10 days, and 5 L was sprayed in each plot for a total of 3 times. The plant height of tomatoes was investigated 2 to 6 weeks after transplanting, and the number of flower mosses of tomatoes was investigated 3 to 8 weeks after transplanting. 30 plants were investigated in each treatment. After the tomato fruits matured, tomatoes were picked 3 times and the yield was measured. In each plot, 10 tomato plants were fixedly tested for yield, and 30 plants were tested for each treatment each time. The yield per mu was calculated based on 2,000 plants per mu.

[0083] Tomato yield per mu (kg) = total weight of tomato fruits in 3 surveys (kg) × 2000 plants / 30 plants Increased yield rate per mu (%) = (yield per mu in the experimental area - yield per mu in the farmers’ self-defense area) / yield per mu in the farmers’ self-defense area × 100%.

[0084] Results (1): LC40 strains can promote the growth of tomato plants. Four surveys were conducted on the height of tomatoes after transplanting. The data from the four surveys showed that the height of tomatoes in the LC40 strain fermentation liquid test area was higher than that in the farmer's self-protection control area. It is worth noting that 32 days after transplanting (August 16), the height of tomatoes in the LC40 strain fermentation liquid test area began to be significantly higher than that in the farmer's self-protection control area. The difference in plant height was the largest at 43 days after transplanting (August 27). The tomatoes in the LC40 strain fermentation liquid test area were 14.7 cm taller than those in the farmer's self-protection control area ( Fig.11 ). This shows that the fermentation liquid of LC40 strain has a significant growth-promoting effect on tomato plants.

[0085] Results (2): Treatment with LC40 fermented liquid increased the number of flower stalks and yield of tomatoes. The data from the four flower stalk surveys showed that treatment with LC40 fermented liquid could increase the number of flower stalks of tomatoes. The difference in the number of flower stalks was the largest at 43 days after tomato transplanting (August 27). The average number of flower stalks in the LC40 fermented liquid test area was 1.8 more than that in the farmer self-protection control area (see Fig.12 ). The final yield measurement results showed that the tomato yield in the LC40 fermentation liquid treatment area was significantly higher than that in the control area, with an increase rate of 8.79% (Table 8). In addition, during the field yield measurement, it was found that the number of large fruits in the LC40 fermentation liquid treatment area was relatively large, with the heaviest single fruit reaching 530 g. This increased the yield in the LC40 fermentation liquid test area.

[0086] The above results show that the fermentation broth of LC40 strain has a significant effect on promoting growth and increasing yield of tomatoes.

[0087] Table 8 Statistics of tomato yields in the fermentation liquid of LC40 strain, the sulfur-loving red oomycete test area, and the farmer's self-defense control area The embodiments of the present application have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or improvements to the technology in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

Claims

1. A strain of Pseudomonas asiatica ( Pseudomonas asiatica ) LC40, characterized in that The Pseudomonas asiaticus LC40 was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on December 2, 2024, with the deposit number CGMCC No.32869, and was classified and named Pseudomonas asiaticus Pseudomonas asiatica .

2. A Pseudomonas asiatica fermentation broth, characterized in that: The Pseudomonas asiatica fermentation broth comprises the Pseudomonas asiatica LC40 according to claim 1.

3. An application of Pseudomonas asiatica fermentation liquid in inhibiting tobacco mosaic virus, characterized in that: The Pseudomonas asiaticus fermentation broth is the Pseudomonas asiaticus fermentation broth according to claim 2.

4. A Pseudomonas asiatica fermentation liquid in inhibiting rice blast fungus ( Magnaporthe oryzae ) and Alternaria tenuissima ( Alternaria tenuissima ), characterized in that The Pseudomonas asiatica fermentation broth is the Pseudomonas asiatica fermentation broth described in claim 2.

5. A crude protein extract of Pseudomonas asiatica, characterized in that: The crude protein extract of Pseudomonas asiaticus comprises the Pseudomonas asiaticus LC40 described in claim 1.

6. An application of crude protein extracted from Pseudomonas asiatica in inhibiting tobacco mosaic virus and tomato brown fruit virus, characterized in that: The crude protein extracted from Pseudomonas asiaticus is the crude protein extracted from Pseudomonas asiaticus according to claim 5.

7. An application of Pseudomonas asiatica in promoting tomato growth and increasing yield, characterized in that: The Pseudomonas asiaticus is the Pseudomonas asiaticus LC40 described in claim 1.

Images