Antibacterial peptide Hcattacin1 gene dsRNA for preventing and treating hyphantria cunea and application thereof
By designing the Hcattacin1 gene dsRNA and combining it with Serratia marcescens treatment, the environmental problems caused by chemical control were solved, achieving the biological control effect of the fall webworm and providing a new control strategy.
Patent Information
- Application Number
- CN202510048732.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-13
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2045-01-13
AI Technical Summary
Existing chemical control methods are effective against the fall webworm, but they cause environmental problems, necessitating the exploration of new biological control strategies. RNA interference technology can control the fall webworm by silencing insect antimicrobial peptide genes.
We designed and synthesized dsRNA of the Hcattacin1 gene of the fall webworm, treated the fall webworm with Serratia marcescens, and silenced the Hcattacin1 gene using RNAi technology to enhance the fall webworm's sensitivity to Serratia marcescens and improve the control effect.
Significant gene silencing and enhanced susceptibility to Serratia marcescens were achieved in the American white moth, improving control efficacy and providing a theoretical basis for biological control.
Smart Images

Figure CN119876141B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to an antimicrobial peptide Hcattacin1 gene dsRNA for controlling the fall webworm and its application. Background Technology
[0002] The fall webworm (Hyphantria cunea (Drury)) (Lepidoptera:Erebidae) is native to North America and has been found in more than 30 countries worldwide, making it a significant forest pest globally (Ge et al. 2019). The fall webworm damages plants in its larval stage. First and second instar larvae live in groups on the undersides of leaves, feeding on the leaf tissue, leaving only the veins. During feeding, they spin silk to protect themselves. Third instar larvae become more efficient at feeding, biting holes through the leaves. By the fourth instar, their activity increases, and they begin to disperse into small groups to feed on the leaves. The fifth instar enters a voracious feeding phase, consuming leaves down to the midrib and petiole. Sixth and seventh instar larvae completely defoliate leaves, except for the midrib (Wang Wei 2020; Liu Xiaoxia 2020). The fall webworm has over 600 host plant species, including various trees, fruit trees, shrubs, herbs, and crops (Edosa et al. 2019). Due to its complex host plants, large feeding capacity, and strong reproductive and dispersal abilities, the fall webworm's invasion has severely impacted many aspects of China's ecological environment, landscape, agriculture, and forestry, causing enormous losses (Zhao Tiezhen 2005). Chemical control is an important means of controlling the fall webworm, as it is fast-acting and effective, providing immediate control in cases of large affected areas, high infestations, and severe damage. However, the long-term and extensive use of chemical insecticides has brought many adverse effects. Therefore, it is imperative to explore new biological control methods and new strategies for controlling the fall webworm.
[0003] RNA interference (RNAi) refers to the phenomenon in eukaryotes where double-stranded RNA (dsRNA) induces highly efficient and specific degradation of homologous mRNA, thereby silencing the expression of target genes (Zamore et al. 2000). Currently, gene silencing induced by dsRNA has been confirmed in numerous studies involving various insect classes, including Hemiptera, Neuroptera, Diptera, Coleoptera, Lepidoptera, and Hymenoptera (Dietzl et al. 2007; Schlüns and Crozier 2007; Konopova and Jindra 2008; Sattar and Thompson 2016; Chaitanya et al. 2017). RNAi has been widely applied in research on gene function exploration and the development of novel biopesticides. It is considered a promising method for pest control by using dsRNA to silence the expression of important genes in insects, thereby causing defects or obstacles in corresponding physiological activities, growth, development, and behavior, ultimately leading to insect death (Zhang Jianzhen et al., 2021; Gao Liwen et al., 2022). Insects frequently come into contact with various pathogens and possess self-protective immune responses to resist pathogen infection, playing a crucial role in their survival. Among these, antimicrobial peptides play an important role in the insect immune system. Insect antimicrobial peptides are a class of small-molecule basic polypeptides induced in insects. They are important effector molecules of insect innate immunity, characterized by low resistance to drug formation, broad-spectrum antibacterial activity, small molecular weight, and cytotoxic effects against viruses, bacteria, fungi, and cancer cells (Zhao Zihan et al., 2021). Silencing this gene can reduce the fall webworm's ability to resist pathogenic microorganisms, ultimately leading to its death. Therefore, it is hoped that dsRNA can be designed to target the antimicrobial peptide gene for the control of fall webworm through RNA interference technology. Summary of the Invention
[0004] The purpose of this invention is to provide the application of dsRNA of the Hcattacin1 gene in the control of the fall webworm (H. fall webworm). The Hcattacin1 gene was first cloned by the applicant. Based on this gene, dsRNA was designed and introduced into the fall webworm, which can effectively control the fall webworm.
[0005] Specifically, this invention proposes a dsRNA of the antimicrobial peptide Hcattacin1 gene for controlling the fall webworm, the nucleotide sequence of which is shown in SEQ ID NO: 1; the dsRNA is amplified by PCR using the Hcattacin1 plasmid of the fall webworm as a template, with upstream primer dsHcattacin1F and downstream primer dsHcattacin1R, wherein,
[0006] The upstream primer dsHcattacin1F is:
[0007] The downstream primer dsHcattacin1R is:
[0008] This invention also provides an application of the above-described antimicrobial peptide Hcattacin1 gene in the control of the American white moth.
[0009] The present invention also provides a dsRNA for controlling the fall webworm, wherein the dsRNA is the dsRNA of the antimicrobial peptide Hcattacin1 gene, and the nucleotide sequence targeted by the synthesized dsHcattacin1 is shown in SEQ ID NO: 1.
[0010] A DNA encoding the target of any of the dsRNAs described above.
[0011] A recombinant expression vector that expresses any of the dsRNAs described above.
[0012] A host bacterium that is transformed into the recombinant expression vector described above.
[0013] This invention also discloses a method for controlling the fall webworm, which involves treating the fall webworm with any of the dsRNAs described above in combination with Serratia marcescens. Specifically, the fall webworm can be treated with dsRNA first, followed by Serratia marcescens treatment, or both dsRNA and Serratia marcescens can be used simultaneously.
[0014] Furthermore, the dsRNA concentration is 1 μg / μL, and the 9.5 × 10 9 CFU / mL Serratia marcescens.
[0015] Furthermore, after treating the fall webworm with the aforementioned dsRNA concentration for 48 hours, the fall webworm was then treated with Serratia marcescens.
[0016] Furthermore, the treatment method involves feeding the animal with a bacterial solution of Serratia marcescens.
[0017] Beneficial effects:
[0018] This invention designs dsRNA based on the Hcattacin1 gene and establishes an Hcattacin1 RNA interference system for the fall webworm (Spodoptera litura) using an injection method. The results show that the injection method achieves a significant gene silencing effect in the fall webworm, providing a theoretical basis for the application of Hcattacin1 RNAi technology. Simultaneously, by using the HT115 strain to construct a dsRNA expression system, the interference cost is reduced. This invention successfully interferes with the expression of the Hcattacin1 gene using this system and found that the fall webworm with a silenced Hcattacin1 gene is significantly more sensitive to Serratia marcescens SM1 strain. Experiments show that the simultaneous use of Hcattacin1 dsRNA and SM1 significantly increases the mortality rate of the fall webworm, indicating that it can enhance the control effect of biocontrol bacteria. These findings provide a theoretical basis for the application of Hcattacin1 dsRNA in the control of the fall webworm. Attached Figure Description
[0019] Figure 1 The expression level of Hcattacin1 after treatment of the fall webworm with Serratia marcescens;
[0020] Figure 2 The relative expression level of the target gene 48 hours after dsRNA injection. Note: Different lowercase letters indicate significant differences between treatments.
[0021] Figure 3 Survival analysis was performed 48 hours after dsRNA treatment. In Figure A, the survival analysis plot is shown. Note: ns indicates that the difference between survival curves is not significant, "*" indicates that the P value is less than 0.05, "**" indicates that the P value is less than 0.005, and "***" indicates that the P value is less than 0.0001. Figure B shows the mortality rate at 24, 60, and 96 hours. Note: Different lowercase letters indicate significant differences between treatments. Detailed Implementation
[0022] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.
[0023] Experimental materials and methods involved in the embodiments:
[0024] (1) Test insects: American white moth larvae were collected from Xuzhou, Jiangsu Province. In the laboratory, they were raised in a transparent plastic box (20cm×14cm×10cm) in a constant temperature incubator with an ambient temperature of 26±1℃ and a light condition of 16h light: 8h darkness, and were fed with fresh mulberry leaves.
[0025] (2) Culture of Serratia marcescens SM1
[0026] Culture medium: Bacterial basal medium (g / L): peptone 10g, beef extract 20g, NaCl 2g, K2HPO4 2g, agar 18g, pH 7.2~7.4.
[0027] Bacterial seed culture medium (g / L): peptone 10g, yeast extract 20g, NaCl 2g, K2HPO4 2g.
[0028] Bacterial fermentation medium (g / L): peptone 10g, soybean oil 30g, NaCl 2g, K2HPO4 2g.
[0029] The isolated *Serratia marcescens* strain SM1 was transferred to bacterial basal medium and cultured in the dark at 27°C for 24 h. Single colonies were obtained after streaking isolation. Each colony was then placed in a sterilized 250 mL Erlenmeyer flask containing 50 mL of seed culture medium and cultured for 12 h at 30°C and 200 rpm for seed culture. 70 mL of the seed culture was then added to 250 mL of fermentation medium and cultured in a shaking incubator at 30°C and 200 rpm for 36 h. The cultured culture was then used.
[0030] (3) Determination of the concentration of Serratia marcescens SM1 fermentation broth
[0031] Within a certain range, as the number of cells in the fermentation broth of *Serratia marcescens* SM1 increases, its OD... 600 The value also increases.
[0032] The present invention will be further described in detail below with reference to specific embodiments. The embodiments will help to understand the present invention, but the scope of protection of the present invention is not limited to the following embodiments.
[0033] Example 1: Cloning of the Hcattacin1 gene
[0034] (1) Primer design: Primers were designed using Primer 5 software based on the Hcattacin1 sequence obtained from the transcriptome data.
[0035] Hcattacin1F: ATGTACGCAGTCAGTTTACTTGC;
[0036] Hcattacin1R:TTAAGGAAAGGATCTGCTGAAC.
[0037] (2) cDNA amplification and TA cloning:
[0038] Total RNA was extracted from the American white moth using the Trizol method.
[0039] Using total RNA as a template, cDNA was synthesized by reverse transcription according to the instructions of the Novizan HiScript II Q RT SuperMix for qPCR (+gDNAwiper) kit. The reverse transcription system is shown in Table 1.
[0040] Table 1 Reverse Transcription System
[0041]
[0042]
[0043] Using cDNA as a template, amplification was performed using primers Hcattacin1F and Hcattacin1R. The PCR amplification reaction system is shown in Table 2. The PCR amplification reaction conditions were: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 52℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; and a final extension at 72℃ for 10 min. The PCR amplification products were detected by 1% agarose gel electrophoresis and photographed using a gel imaging system. Correctly identified PCR products were purified and recovered using a gel extraction kit. TA cloning conditions are shown in Table 3. The gel-extracted products were ligated with pCE3 at room temperature for 5 min. The ligation product was then transformed into Escherichia coli DH5α competent cells. The transformation of the ligation product was as follows:
[0044] (1) Take E. coli DH5α competent cells out of the -80℃ freezer and dissolve them in ice water;
[0045] (2) Add 10 μL of the ligation product to 100 μL of E.coli DH5α competent cells using a pipette and incubate on ice for 30 min.
[0046] (3) Heat shock in a 42℃ water bath for 45 seconds, and immediately place it in ice water for 2 minutes after taking it out;
[0047] (4) Add SOC or LB liquid culture medium and incubate at 37°C and 200 rpm for 1 h with shaking.
[0048] (5) Spread 200 μL of bacterial culture on LB solid medium containing Amp penicillin (final concentration 50 μg / mL) and incubate upside down overnight in an incubator at 37°C.
[0049] The transformation products were cultured in LB (Amp+) solid medium for 12–16 h. Positive clones were selected, and after identification by bacterial PCR, the recombinant plasmid containing the correct insert fragment was named pCE3-Hcattacin1 and sent to the company for sequencing.
[0050] Table 2 PCR reaction system
[0051] template cDNA 1μL Primer Hcattacin1F 1μL Primer Hcattacin1R 1μL <![CDATA[ddH2O]]> 9.5μL Composite Taq 12.5μL
[0052] Table 3 TA Cloning System
[0053]
[0054]
[0055] Example 2: Induction of Hcattacin1 expression in *Serratia marcescens* SM1 by *Serratia marcescens*.
[0056] Fourth-instar larvae of similar developmental stages were selected for the experiment. Equal weights of fresh mulberry leaves were placed in a 1×10⁻⁶ pyrene bath. 7 and 1×10 8 Soak larvae in CFU / mL SM1 medium for 10-15 seconds. Use water-soaked mulberry leaves as a control group. After drying, place each larva in a separate rearing box, with 20 larvae in each box. The rearing temperature was 26℃. All larvae were treated in triplicate. Samples were collected at 12, 24, 36, and 48 hours and stored at -80℃ for later use.
[0057] like Figure 1 As shown, quantitative real-time fluorescence experiments revealed that Hcattacin1 expression in both treatment groups exhibited a gradual upward trend, reaching its peak at 36 h and decreasing at 48 h. In the low-concentration treatment group, Hcattacin1 was significantly upregulated at 24, 36, and 48 h, while in the high-concentration treatment group, Hcattacin1 was significantly upregulated at 12, 24, and 36 h.
[0058] Example 3: Synthesis and Induced Expression of dsRNA of the Hcattacin1 Gene in the American White Moth
[0059] (1) Primer design for the dsRNA of the Hcattacin1 gene of the American white moth.
[0060] Based on the cloned Hcattacin1 sequence, potential RNAi target sites were predicted using online software, and primers were designed using Primer 5 software.
[0061] dsHcattacin1F:
[0062] dsHcattacin1R:
[0063] Enzyme cleavage sites SmaⅠ and SacⅠ were introduced upstream and downstream (bold letters indicate cleavage sites, italic letters indicate protective bases). Primers for dsGFP were designed as follows:
[0064] dsGFPF:
[0065] dsGFPR:
[0066] Enzyme cleavage sites SacI and HindIII were introduced upstream and downstream. All primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0067] (2) Construction of dsRNA expression vector.
[0068] Using the correctly sequenced full-length Hcattacin1 plasmid pCE3-Hcattacin1 as a template, PCR amplification was performed using the designed upstream and downstream primers dsHcattacin1F and dsHcattacin1R for dsRNA synthesis. The PCR amplification conditions were: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; and a final extension at 72℃ for 10 min. The PCR products were detected by 1% agarose gel electrophoresis and photographed using a gel imaging system. Correctly identified PCR products were purified and recovered using a gel extraction kit.
[0069] Using an existing GFP plasmid as a template, a 500bp fragment was cloned. The target fragment was then digested with enzymes and ligated into the L4440 vector, successfully constructing the L4440-dsHcattacin1 and L4440-dsGFP recombinant plasmids.
[0070] Specifically, taking L4440-dsHcattacin1 as an example, the above PCR product was double-digested with SmaⅠ and SacⅠ, and the target fragment was recovered; simultaneously, the expression vector L4440 was double-digested with these two enzymes, and the target vector was recovered. The double digestion system is shown in Table 4. The target fragment and the target vector were ligated at 16℃ for 16 h using T4 DNA ligase. The ligation product was transformed into E. coli DH5α competent cells and cultured in LB (Amp+) solid medium for 12 h. Positive clones were selected and identified by enzyme digestion. The recombinant plasmid containing the correct inserted fragment was named L4440-dsHcattacin1 and sent to the company for sequencing.
[0071] Table 4 Double enzyme digestion system
[0072]
[0073] (3) Induction and extraction of dsRNA.
[0074] Expression of dsRNA was induced in HT115 strain containing the recombinant plasmids L4440-dsHcattacin1 and L4440-dsGFP, respectively. The target bands were 287 bp and 500 bp, consistent with the expected sizes of dsHcattacin1 and dsGFP, indicating successful construction of the interference vector.
[0075] Taking L4440-dsHcattacin1 as an example, the correctly sequenced L4440-dsHcattacin1 recombinant plasmid was transformed into HT115(DE3) competent cells and plated on a substrate containing ampicillin (50 μg / mL). -1 ) and tetracycline (12.5 μg·mL -1 Incubate overnight at 37°C on LB solid medium containing double antibiotics, inverted. Pick single colonies and inoculate them into a medium containing ampicillin (50 μg / mL). -1 ) and tetracycline (12.5 μg·mL -1 In LB liquid medium containing double antibiotics, at 37°C and 180 rpm -1 Shaking culture until bacterial OD 600 At approximately 0.5-0.6, add IPTG (final concentration 0.8 mM) and continue incubation at 37°C and 180 rpm. -1 Continue shaking and culturing for 3 hours, then extract dsRNA using Novizan's RNA isolater total RNA extraction reagent. Quantify using Eppendorf BioSpectrometer Basic to achieve a final concentration of 1 μg / μL. Store at -80°C for later use.
[0076] Example 4: Detection of Hcattacin1 expression level after RNAi.
[0077] Healthy fourth-instar fall webworm larvae of similar condition were selected as experimental materials. Transparent plastic boxes (20cm×14cm×10cm) were used as rearing containers, with 20 fall webworm larvae placed in each box. The rearing environment temperature was 26℃. The dsHcattacin1 (1μg / μL) treatment group was designated as the experimental group, the dsGFP (1μg / μL) treatment group as the control group, and the water treatment group as the blank control group. 1μL of the reagent was injected into each larva. Three replicates were set up. The fall webworm larvae were reared in an environment at 26±1℃, and samples were collected every 24 hours. Samples were collected at 24h, 48h, and 72h after treatment and stored at -80℃.
[0078] Quantitative real-time PCR (RT-qPCR) was performed on the gene to examine changes in gene expression levels at different time points. The primers for RT-qPCR are as follows (RPS16 and RPL13 are internal reference genes):
[0079] q-Hcattacin1 F: AGGGATTCGGATTGGCTTTAG
[0080] q-Hcattacin1 R: GTCCTGCACCTGTCAGTTT
[0081] q-RPS16 F:GTGGTCATGTTGCACAGGTT
[0082] q-RPS16 R: CTGGACCACCGAACTTCTTG
[0083] q-RPL13 F:GTTAGCTACACAGCTCCGTGG
[0084] q-RPL13 R:GCAGCAGTTGGGGCTTTAGT;
[0085] The reaction system for real-time PCR is as follows:
[0086]
[0087] Reaction procedure:
[0088] 95℃ for 30 seconds
[0089] {95℃ 5s, 60℃ 34s} 30 cycles
[0090] {95℃15s, 60℃1min, 95℃15s}
[0091] The experiment was designed with three biological replicates. After obtaining the Ct values of the target gene and the internal reference gene, 2... -ΔΔt The relative expression levels of target gene mRNA were calculated. Significant difference analysis was performed on the obtained data using InStat software.
[0092] To detect the changes in the expression level of the target gene Hcattacin1 at different time intervals after Hcattacin1 dsRNA injection, real-time quantitative PCR was performed on cDNA samples from the control and treatment groups of *Moth simonii*. The results showed that at 24h, 48h, and 72h after dsRNA injection, the relative expression levels of Hcattacin1 in the treatment group were 0.31, 0.30, and 0.67, respectively, significantly lower than those in the control group. Figure 2 ).
[0093] Example 5: Changes in the sensitivity of the fall webworm to Serratia marcescens SM1 after RNAi
[0094] Healthy fourth-instar fall webworm larvae of similar condition were used as experimental materials. The dsHcattacin1 (1 μg / μL) treatment group was designated as the experimental group, the dsGFP (1 μg / μL) treatment group as the control group, and the water treatment group as the blank control group. Each larva was injected with 1 μL of the reagent and reared normally for 48 hours before subsequent experiments. Equal weights of fresh mulberry leaves were mixed with water and 9.5 × 10⁻⁶ ppm of the reagent. 9 The larvae were soaked in CFU / mL SM1 bacterial solution for 10-15 seconds, air-dried, and then fed to each group of fall webworm larvae. Transparent plastic boxes (20cm×14cm×10cm) were used as rearing containers, with 20 fall webworm larvae in each box. The rearing environment temperature was 26℃. Three replicate experiments were set up. Observations were conducted every 6 hours, and the number of dead fall webworm larvae in each group was recorded.
[0095] Survival curves clearly show no difference between the CK and dsGFP groups, and no significant difference between the CK-SM1 and dsGFP-SM1 groups. However, there is a significant difference in survival curves between the dsHcattacin1-SM1 and dsHcattacin1 groups, with a significantly higher mortality rate. Figure 3 ).
[0096] In summary, this patent is the first to synthesize dsRNA of Hcattacin1 from the fall webworm using bacterial dsRNA propagation technology, establishing an Hcattacin1 RNA interference system for the fall webworm and achieving a significant gene silencing effect, providing technical support for the application of Hcattacin1 RNAi technology. This system successfully interfered with the expression of the antimicrobial peptide Hcattacin1 gene, and it was found that the fall webworm with a silenced Hcattacin1 gene showed significantly increased sensitivity to Serratia marcescens SM1 strain. Experiments showed that the simultaneous use of Hcattacin1 dsRNA and SM1 significantly increased the mortality rate of the fall webworm, indicating that it can enhance the control effect of biocontrol bacteria. These findings provide a theoretical basis for the application of Hcattacin1 dsRNA in the control of the fall webworm. This invention lays the theoretical foundation for the development of animal-safe immunosuppressants and provides a new theory for the biological control of pests, ultimately offering new strategies and approaches for pest control in my country's green agricultural production and sustainable development.
[0097] This invention provides a control strategy and method for the fall webworm. Many methods and approaches exist to achieve this solution; the above description is merely a preferred embodiment of the invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.
Claims
1. A dsRNA of an antibacterial peptide Hcattacinl gene for controlling Hyphantria cunea, characterized by, The nucleotide sequence of the Hcattacin1 gene is shown in SEQ ID NO: 1; the dsRNA was amplified by PCR using the Hcattacin1 plasmid from the fall webworm as a template, with upstream primer dsHcattacin1F and downstream primer dsHcattacin1R, wherein, The upstream primer dsHcattacin1F is: CGAGCTC CTTGCAGCTATGGTATTATTGG; the downstream primer dsHcattacin1R is: TCCCCGGG GATGCCGTGTTCATCTTATTG.
2. The application of the dsRNA of the antimicrobial peptide Hcattacin1 gene as described in claim 1 in the control of the American white moth.
3. A recombinant expression vector, characterized in that, It expresses the dsRNA as described in any one of claims 1-2.
4. A host bacterium, characterized in that, It transforms the recombinant expression vector described in claim 3.
5. A method for controlling the fall webworm, characterized in that, Treat the American white moth with the dsRNA as described in any one of claims 1-2 in combination with Serratia marcescens.
6. The method as described in claim 5, characterized in that, The concentration of dsRNA was 1 μg / μL, and the concentration of Serratia marcescens was 9.5 × 10⁹ CFU / mL.
7. The method as described in any one of claims 5-6, characterized in that, First, treat the fall webworm with the aforementioned dsRNA concentration for 48 hours, then treat the fall webworm with Serratia marcescens.
8. The method as described in claim 7, characterized in that, The treatment method involves feeding the animal with a bacterial solution of Serratia marcescens.
Citation Information
Patent Citations
Oftermicin1 gene of odontotermes formosanus antibacterial peptide and application thereof
CN116024220A
SK gene and dsRNA for regulating and controlling growth and development of fall webworm and prevention and control pesticide thereof
CN118345082A