Tobacco leaf with high beta-ionone content as well as preparation method and application of tobacco leaf

Abstract

The invention discloses a high-beta-ionone tobacco leaf as well as a preparation method and application thereof. According to the high beta-ionone tobacco leaf overexpression gene NtCCD4a, the nucleotide sequence of the gene NtCCD4a comprises a sequence as shown in SEQ ID NO. 1, and the nucleotide sequence of the gene NtCCD4a comprises a sequence as shown in SEQ ID NO. 2. The content of beta-ionone in the transgenic tobacco leaf obtained by the method is increased by more than 5 times compared with that of a wild tobacco plant, and the transgenic tobacco leaf has a great application prospect in the aspect of cultivating tobacco with high beta-ionone content.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and relates to a tobacco leaf with high beta-ionone content and a preparation method and application thereof. Background Art

[0002] Carotenoids are important precursors for the formation of volatile aroma components in plants and have a significant impact on the appearance and aroma quality of tobacco leaves. During tobacco curing, carotenoids are degraded through biological or non-biological pathways to produce many aroma substances, such as β-ionone, geranyl acetone, linalool and 3-hydroxy-β-dihydrodamascone. Among the aroma components of tobacco, carotenoid cleavage products account for about 16 species, with a contribution rate of up to 85%. The role of carotenoid degradation in the production of tobacco volatile aroma substances has always been a hot topic in the tobacco industry at home and abroad.

[0003] Carotenoid cleavage dioxygenase 4 (CCD4) is a type of non-heme oxygenase with a conserved polypeptide sequence at its C-terminus. Its catalytic activity requires divalent iron ions as a cofactor and is bound to its four histidines. CCD4 enzymes are located in plant chloroplasts and can produce a variety of volatile aroma substances, such as geranylacetone, β-ionone, pseudoionone, and β-damascenone, by cleaving cyclic and chain carotenoids in plants. By studying the expression of CCD4 genes in different species, it was found that it is expressed in different parts of plants, and the expression level is relatively high in parts with high carotenoid content (such as flowers, leaves, and fruits). CCD4 can symmetrically cut β-carotene at the 9,10=9′,10′ double bond position in different plants to produce β-ionone. Studying the substrate and expression mode of CCD4 genes has important biological significance for revealing the mechanism of plant fruit and flower color and volatile substance production.

[0004] The content of β-ionone is one of the important indicators for evaluating the quality of tobacco leaves. Increasing the content of β-ionone in tobacco leaves can improve the quality of tobacco leaves. Therefore, it is urgent to provide a tobacco leaf with high β-ionone content and a preparation method and application thereof. Summary of the invention

[0005] In view of the deficiencies in the prior art and actual needs, the present invention provides a tobacco leaf with high β-ionone content, and a preparation method and application thereof. The β-ionone content in the tobacco leaf obtained by the method of the present invention is more than 5 times higher than that in wild-type tobacco plants, and the method has great application prospects in cultivating tobacco with high β-ionone content.

[0006] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a tobacco leaf with high β-ionone content, wherein the tobacco leaf with high β-ionone content overexpresses the gene NtCCD4a, and the nucleic acid sequence of the gene NtCCD4a includes the sequence shown in SEQ ID NO.1.

[0008] The beta-ionone content in the transgenic tobacco leaves obtained by the invention is more than 5 times higher than that in the leaves of wild-type tobacco plants, and has great application prospects in cultivating tobacco with high beta-ionone content.

[0009] SEQ ID NO.1:

[0010]

[0011] In a second aspect, the present invention provides a method for preparing tobacco leaves high in β-ionone as described in the first aspect, the method comprising: constructing an overexpression vector, transforming with Agrobacterium, and introducing the overexpression vector into tobacco leaves; the overexpression vector contains the gene NtCCD4a, and the nucleic acid sequence of the gene NtCCD4a includes the sequence shown in SEQ ID NO.1.

[0012] Preferably, the construction of the overexpression vector comprises the following steps:

[0013] (a) PCR amplification was performed using TOPO plasmid DNA containing the NtCCD4a gene positive clone as a template;

[0014] (b) recovering the target fragment product and connecting it to the TOPO vector, transforming Escherichia coli after connection, screening positive clones and sequencing;

[0015] (c) pCAMBIA sup1300 was double-digested with PstⅠ / KpnⅠ to obtain the vector fragment, and the target fragment was inserted into pCAMBIAsup1300, transformed into E. coli competent cells, and the plasmid was extracted for PCR detection and restriction enzyme detection.

[0016] Preferably, the PCR amplification reaction system comprises: NtCCD4a gene positive clone TOPO plasmid DNA, dNTPs, primers and high-fidelity DNA polymerase.

[0017] Preferably, the reaction procedure of the PCR amplification includes: 96-98°C (e.g., 96°C, 97°C, 98°C), 20-30s (e.g., 20s, 25s, 30s); 96-98°C (e.g., 96°C, 97°C, 98°C), 5-10s (e.g., 5s, 8s, 10s), 50-55°C (e.g., 50°C, 53°C, 55°C), 30-50s (e.g., 30s, 40s, 50s), 70-72°C (e.g., 70°C, 71°C, 72°C), 30-50s (e.g., 30s, 40s, 50s), 25-30 cycles (e.g., 25 cycles, 28 cycles, 30 cycles); 70-72°C (e.g., 70°C, 71°C, 72°C) extension for 5-10min (e.g., 5min, 8min, 10min).

[0018] Preferably, the Agrobacterium transformation comprises: mixing the Agrobacterium competent cells with the recombinant expression vector, quick freezing with liquid nitrogen for 1-2 min (e.g., 1 min, 2 min), water bathing at 35-37° C. (e.g., 35° C., 37° C.) for 3-5 min (e.g., 3 min, 5 min), ice bathing for 1-2 min (e.g., 1 min, 2 min), adding LB liquid culture medium to the mixture and culturing at 26-28° C. (e.g., 26° C., 27° C.), 200-220 rpm (e.g., 200 rpm, 220 rpm) for 3-4 h (e.g., 3 h, 4 h), spreading on an LB solid culture medium containing kanamycin and rifampicin after culturing, and inverting and culturing at 26-28° C. (e.g., 26° C., 27° C.) for 2-3 days (e.g., 2 days, 3 days).

[0019] Preferably, the step of introducing the overexpression vector into tobacco leaves comprises the following steps:

[0020] (a) picking an Agrobacterium clone containing a target vector, streaking it on an LB plate containing kanamycin and rifampicin, culturing it at 26-28° C. (e.g., 26° C., 27° C.) for 2-3 days (e.g., 2 days, 3 days), scraping the streaked plaque and inoculating it in an MS medium containing spectinomycin and rifampicin, culturing it at 26-28° C. (e.g., 26° C., 27° C.) with shaking at 200-220 rpm (e.g., 200 rpm, 220 rpm), and infecting it when the bacterial solution concentration reaches OD=0.5-0.8 (e.g., OD=0.5, OD=0.8);

[0021] (b) rinsing tobacco leaves with 70%-75% (e.g., 70%, 75%) ethanol for 1-2 minutes (e.g., 1 minute, 2 minutes), discarding the ethanol, mixing the tobacco leaves with 0.1-0.3% (e.g., 0.1%, 0.3%) HgCl2 solution and shaking for 15-30 minutes (e.g., 15 minutes, 20 minutes), discarding the solution, and rinsing the tobacco leaves with sterile water;

[0022] (c) absorbing liquid from the surface of tobacco leaves, cutting into small pieces, placing the cut tobacco leaves into a sterile MS liquid culture medium suspension containing the target vector, leaving it to stand for 15-20 minutes (e.g., 15 minutes, 18 minutes), absorbing excess bacterial liquid from the tobacco leaves, and culturing in the MS culture medium in the dark;

[0023] (d) after dark culture, the tobacco leaves are transferred to a differentiation medium, the incisions are contacted with the differentiation medium, subculture is performed every 2-3 weeks (e.g., 2 weeks, 3 weeks), buds that grow to 3-5 cm (e.g., 3 cm, 5 cm) are cut off, and transferred to a rooting medium, the transgenic plants that have taken root are taken out from the rooting medium, the medium is washed, and the transgenic plants are transplanted into sterilized nutrient soil to obtain transgenic tobacco;

[0024] (e) PCR verification is performed on the transgenic tobacco to identify transgenic positive tobacco.

[0025] Preferably, the MS medium in step (c) contains 6-BA and NAA.

[0026] Preferably, the concentration of 6-BA in the MS medium is 0.01-0.03 mg / L (eg, 0.01 mg / L, 0.02 mg / L, 0.03 mg / L).

[0027] Preferably, the concentration of NAA in the MS medium is 1-3 mg / L (eg, 1 mg / L, 2 mg / L, 3 mg / L).

[0028] Preferably, the temperature of the dark culture is 23°C-27°C (eg, 23°C, 25°C, 27°C), and the time of the dark culture is 2-3 days (eg, 2 days, 3 days).

[0029] Preferably, the differentiation medium in step (d) contains 6-BA, NAA, kanamycin and cephalosporin.

[0030] Preferably, the concentration of 6-BA in the differentiation medium is 0.4-0.6 mg / L (eg, 0.4 mg / L, 0.5 mg / L, 0.6 mg / L).

[0031] Preferably, the concentration of NAA in the differentiation medium is 0.05-0.2 mg / L (eg, 0.05 mg / L, 0.1 mg / L, 0.2 mg / L).

[0032] Preferably, the concentration of kanamycin in the differentiation medium is 50-150 mg / L (eg, 50 mg / L, 100 mg / L, 150 mg / L).

[0033] Preferably, the concentration of cephalosporin in the differentiation medium is 400-600 mg / L (eg, 400 mg / L, 500 mg / L, 600 mg / L).

[0034] In a third aspect, the present invention provides application of the method described in the second aspect in breeding new tobacco varieties.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] The beta-ionone content in the transgenic tobacco leaves obtained by the method of the invention is more than 5 times higher than that in the leaves of wild-type tobacco plants, and has great application prospects in cultivating tobacco with high beta-ionone content. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1This is the electrophoresis diagram of NtCCD4a gene after PCR cloning;

[0038] Figure 2 The phenotype of transgenic plants overexpressing NtCCD4a;

[0039] Figure 3 This is the result graph of the β-ionone content in the middle leaves of the T1 generation of transgenic tobacco lines. DETAILED DESCRIPTION

[0040] To further illustrate the technical means and effects of the present invention, the present invention is further described below in conjunction with the embodiments and drawings. It should be understood that the specific implementation methods described herein are only used to explain the present invention, rather than to limit the present invention.

[0041] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0042] Example 1

[0043] Cloning of tobacco NtCCD4a gene.

[0044] 1. Determine the NtCCD4a gene sequence;

[0045] According to the protein sequence of Arabidopsis AtCCD4a gene, the NCBI database was searched to obtain the sequence of the homologous gene NtCCD4a in tobacco, and the gene cloning primers were designed using this sequence:

[0046] Forward primer: NtCCD4a-F (SEQ ID NO. 2): ATGGATGCCTTCTCTTCCACTTTC;

[0047] Reverse primer NtCCD4a-R (SEQ ID NO. 3): CATGAGTTTCCTAAGATCAGTTTC.

[0048] 2. Extract RNA from tobacco leaf tissue and reverse transcribe it to obtain the first-chain cDNA.

[0049] 3. Using the first-strand cDNA obtained by reverse transcription as a template, PCR amplification was performed with primers NtCCD4a-F / NtCCD4a-R, and the Maker was DL2000. The amplification results are shown in Figure 1 , recover and purify PCR products.

[0050] 4. Connect the purified product to the carrier. The connection system and process are as follows: 4 μL purified product, 1 μL salt solution, 1 μL (Invitrogen) and mix well, incubate in a water bath at 25°C for 30 min; transform the ligated vector into Escherichia coli DH5a by heat shock, add liquid culture medium for shaking culture, and then spread on LB plates containing 100 mg / L kanamycin for overnight culture, pick colonies for bacterial culture, extract plasmids and perform PCR detection, screen positive clones, and sequence positive clones.

[0051] The PCR amplification reaction system used was Phusion high-fidelity amplification enzyme reaction system, with a total volume of 50 μL, including: 200 ng cDNA, 10 μL 5× Phusion HF reaction buffer, 1 μL 10 mM dNTP, 2 U High-Fidelity DNA Polymerase, 1 μL each of 10 μM forward and reverse primers, add water to 50 μL.

[0052] The reaction conditions for PCR amplification are The reaction was carried out on a pro thermal cycler with the following procedure: 98°C, 30s; 98°C, 7s, 55°C, 30s, 72°C, 40s, 35 cycles; and extension at 72°C for 10min.

[0053] Example 2

[0054] Obtaining transgenic plants of tobacco expressing the gene NtCCD4 encoding carotenoid cleavage dioxygenase 4.

[0055] 1. Overexpression vector construction:

[0056] a. The vector was used as the intermediate vector and pCAMBIAsup1300 was used as the expression vector backbone to construct the overexpression vector of NtCCD4a gene. The primers for the construction were:

[0057] NtCCD4a-PstⅠ-F (SEQ ID NO.2): 5'-agaaagcttctgcagATGGATGCCTTCTCTTCCACTTTC-3';

[0058] NtCCD4a-KpnⅠ-R (SEQ ID NO.3): 5'-gctcaccatggtaccCATGAGTTTCCTAAGATCAGTTTC-3';

[0059] The ctgcag in NtCCD4a-PstⅠ-F is the PstⅠ restriction site, and the ggtacc in NtCCD4a-KpnⅠ-R is the KpnⅠ restriction site.

[0060] b. PCR amplification was performed using TOPO plasmid DNA containing the NtCCD4a gene positive clone as a template. The PCR reaction volume was 50 μL, including: 200 ng DNA, 10 μL 5× Phusion HF reaction buffer, 1 μL 10 mM dNTP, 2 U High-Fidelity DNA Polymerase, 10 μM NtCCD4a-PstⅠ-F primer, NtCCD4a-KpnⅠ-R primer 1 μL each, add water to 50 μL. PCR reaction The reaction was carried out on a pro thermal amplification instrument with the following procedure: 98°C, 30 s; 98°C, 7 s, 55°C, 40 s, 72°C, 40 s, 30 cycles; extension at 72°C for 10 min; recovery and purification of PCR products.

[0061] c. Recover the target fragment product and connect it to the TOPO vector: connect it to the TOPO vector through the kit reaction. The connection system and process are as follows: 4μL PCR purified product, 1μL salt solution, 1μL Mix well, and incubate in a water bath at 25°C for 30 minutes. Transform the ligated vector into E. coli by heat shock, add culture medium, shake culture, and then spread on LB plates containing 100 mg / L kanamycin for overnight culture. Screen positive clones and sequence them.

[0062] d. Construction of overexpression vector pCAMBIA sup1300-NtCCD4a: pCAMBIAsup1300 empty vector was used for restriction digestion reaction: PstⅠ / KpnⅠ double restriction digestion of pCAMBIA sup1300 obtained vector fragment, and gel cutting and recovery were performed. The target fragment was inserted into pCAMBIA sup1300 using seamless cloning kit ClonExpress Ultra One Step Cloning Kit. The reaction was as follows: the total reaction volume was 10μL, 4μL of gel cutting and recovery product containing the target fragment, 1μL of pCAMBIA sup1300 (PstⅠ / KpnⅠ double restriction digestion) vector, 1μL of 10× buffer, 1μL of homologous recombination enzyme, 3μL of sterilized double distilled water, mixed, reacted at room temperature for 2h, transformed into Escherichia coli competent cells, added culture medium and shaken culture, and then coated on LB plate containing 100mg / L kanamycin for overnight culture, and the plasmid was extracted for PCR detection and restriction digestion detection to verify whether the overexpression vector containing the target gene fragment was successfully constructed.

[0063] 2. Agrobacterium transformation:

[0064] Take out the Agrobacterium competent cells from the -80℃ refrigerator, place them on ice to thaw, and then add 4μL of the recombinant expression vector pCAMBIA sup1300-NtCCDa; quick freeze in liquid nitrogen for 1min, transfer to a 37℃ water bath for 5min, and then ice bath for 2min, add 1mL LB liquid culture medium to the mixture, and culture at 28℃ and 220rpm for 4h; spread the culture on LB solid culture medium containing 100mg / L kanamycin and 25mg / L rifampicin, and culture inverted at 28℃ for 3 days, and Agrobacterium clones containing the target vector can be seen.

[0065] 3. Introducing overexpression vector into tobacco and cultivating transgenic plants:

[0066] a. Pick the Agrobacterium clone containing the target vector, streak it on an LB plate containing kanamycin and rifampicin, and culture it at 28°C for 3 days; scrape the streaked plaque and inoculate it in MS medium containing spectinomycin and rifampicin, culture it at 28°C with shaking at 220 rpm, and infect when the bacterial solution concentration reaches OD=0.8.

[0067] b. Place tobacco leaves in a 500mL wide-mouth bottle, add an appropriate amount of 75% ethanol, and rinse for 1 minute; discard the ethanol, add 0.1% HgCl2 solution, and shake on a shaker at room temperature for 30 minutes; discard the solution and rinse with sterile water 6 times.

[0068] c. Take out the tobacco leaves, wash off the surface liquid with sterile absorbent paper, cut the sterile leaves into small pieces of 1 cm × 1 cm with scissors, put the cut tobacco leaves into a sterile MS liquid culture medium suspension containing the target carrier, and let it stand for 20 minutes; take out the tobacco leaves, absorb the excess bacterial liquid with sterile filter paper, and culture them in the dark at 25°C in MS culture medium containing 6-BA (0.02 mg / L) and NAA (2 mg / L) for two days; transfer the tobacco leaves to the differentiation culture medium with the incision in contact with the culture medium. The differentiation culture medium is an MS culture medium containing 6-BA (0.5 mg / L), NAA (0.1 mg / L), kanamycin (100 mg / L), and cephalosporin (500 mg / L). Subculture once every 3 weeks, and callus tissue gradually forms at the incision, and finally differentiates and sprouts.

[0069] d. Cut off the buds that grow to 3-5 cm, transfer them to MS medium to induce rooting, take out the rooted transgenic plants from the rooting medium, wash the medium with tap water, and transplant them into sterilized nutrient soil.

[0070] e. The transgenic plants were verified by PCR using NtCCD4 gene specific primers (SEQ ID NO.2-SEQ ID NO.3), and the transgenic positive plants were identified to obtain the T1 generation line OE#NtCCD4a.

[0071] Example 3

[0072] Detection of β-ionone content in transgenic tobacco leaves.

[0073] The transgenic T1 generation strain OE#NtCCD4a obtained in Example 2 and the control tobacco strain YN87 ( Figure 2 ), where YN87 is the control tobacco Yunyan 87, and OE#NtCCD4a is the transgenic tobacco Yunyan 87 overexpressing NtCCD4a. The middle leaves (9-12 leaves) were taken and the β-ionone content was determined by gas chromatography. The results are shown in Figure 3 , YN87 is the control tobacco Yunyan 87, OE#NtCCD4a is the transgenic tobacco Yunyan 87 overexpressing NtCCD4a. Each material has 3 biological replicates, * indicates significant difference from the control at the 0.05 level, and the β-ionone content in the leaves of transgenic tobacco is more than 5 times higher than that of the control. This shows that tobacco with significantly increased β-ionone content in tobacco leaves can be obtained by overexpressing the NtCCD4a gene.

[0074] In summary, the β-ionone content in the transgenic tobacco leaves obtained by the method of the present invention is more than 5 times higher than that in the leaves of wild-type tobacco plants, and has great application prospects in cultivating tobacco with high β-ionone content.

[0075] The applicant declares that the present invention illustrates the detailed method of the present invention through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned detailed method, that is, it does not mean that the present invention must rely on the above-mentioned detailed method to be implemented. Those skilled in the art should understand that any improvement of the present invention, equivalent replacement of various raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A tobacco leaf with high β-ionone content, characterized in that: The high-β-ionone tobacco leaves overexpress the gene NtCCD4a, and the nucleic acid sequence of the gene NtCCD4a includes the sequence shown in SEQ ID NO.

1.

2. A method for preparing the high-β-ionone tobacco leaf of claim 1, characterized in that: The method comprises: constructing an overexpression vector, transforming with Agrobacterium, and introducing the overexpression vector into tobacco leaves; the overexpression vector contains the gene NtCCD4a, and the nucleic acid sequence of the gene NtCCD4a includes the sequence shown in SEQ ID NO.

1.

3. The method according to claim 2, characterized in that The construction of the overexpression vector comprises the following steps: (a) PCR amplification was performed using TOPO plasmid DNA containing the NtCCD4a gene positive clone as a template; (b) recovering the target fragment product and connecting it to the TOPO vector, transforming Escherichia coli after connection, screening positive clones and sequencing; (c) pCAMBIA sup1300 was double-digested with PstⅠ / KpnⅠ to obtain the vector fragment, and the target fragment was inserted into pCAMBIAsup1300, transformed into E. coli competent cells, and the plasmid was extracted for PCR detection and restriction enzyme detection.

4. The method according to claim 3, characterized in that The PCR amplification reaction system comprises: NtCCD4a gene positive clone TOPO plasmid DNA, dNTP, primers and high-fidelity DNA polymerase.

5. The method according to claim 3 or 4, characterized in that: The reaction procedure of the PCR amplification includes: 96-98°C, 20-30s; 96-98°C, 5-10s, 50-55°C, 30-50s, 70-72°C, 30-50s, 25-30 cycles; 70-72°C extension for 5-10min.

6. The method according to any one of claims 2 to 5, characterized in that: The Agrobacterium transformation comprises: mixing Agrobacterium competent cells with a recombinant expression vector, quick freezing with liquid nitrogen for 1-2 minutes, water bathing at 35-37° C. for 3-5 minutes, and ice bathing for 1-2 minutes, adding LB liquid culture medium to the mixture, culturing at 26-28° C. and 200-220 rpm for 3-4 hours, coating on an LB solid culture medium containing kanamycin and rifampicin after culturing, and inverting and culturing at 26-28° C. for 2-3 days.

7. The method according to any one of claims 2 to 6, characterized in that: The step of introducing the overexpression vector into tobacco leaves comprises the following steps: (a) Pick an Agrobacterium clone containing the target vector, streak it on an LB plate containing kanamycin and rifampicin, culture it at 26-28°C for 2-3 days, scrape the streaked plaque and inoculate it in MS medium containing spectinomycin and rifampicin, culture it at 26-28°C with shaking at 200-220 rpm, and infect it when the bacterial solution concentration reaches OD = 0.5-0.8; (b) rinsing the tobacco leaves with 70%-75% ethanol for 1-2 minutes, discarding the ethanol, mixing the tobacco leaves with a 0.1-0.3% HgCl2 solution and shaking for 15-30 minutes, discarding the solution, and rinsing the tobacco leaves with sterile water; (c) absorbing the liquid on the surface of the tobacco leaves, cutting them into small pieces, placing the cut tobacco leaves into a sterile MS liquid culture medium suspension containing the target vector, leaving them to stand for 15-20 minutes, absorbing the excess bacterial liquid on the tobacco leaves, and culturing them in the MS culture medium in the dark; (d) after dark culture, the tobacco leaves are transferred to a differentiation medium, the cuts are brought into contact with the differentiation medium, subculture is performed every 2-3 weeks, buds that grow to 3-5 cm are cut off, and transferred to a rooting medium. After rooting, the transgenic plants are taken out of the rooting medium, the medium is washed, and the transgenic plants are transplanted into sterilized nutrient soil to obtain transgenic tobacco; (e) PCR verification is performed on the transgenic tobacco to identify transgenic positive tobacco.

8. The method according to claim 7, characterized in that The MS medium in step (c) contains 6-BA and NAA; Preferably, the concentration of 6-BA in the MS medium is 0.01-0.03 mg / L; Preferably, the concentration of NAA in the MS medium is 1-3 mg / L; Preferably, the temperature of the dark culture is 23° C.-27° C., and the time of the dark culture is 2-3 days.

9. The method according to claim 7 or 8, characterized in that: The differentiation medium in step (d) contains 6-BA, NAA, kanamycin and cephalosporin; Preferably, the concentration of 6-BA in the differentiation medium is 0.4-0.6 mg / L; Preferably, the concentration of NAA in the differentiation medium is 0.05-0.2 mg / L; Preferably, the concentration of kanamycin in the differentiation medium is 50-150 mg / L; Preferably, the concentration of cephalosporin in the differentiation medium is 400-600 mg / L.

10. Use of the method according to any one of claims 2 to 9 in breeding new tobacco varieties.

Images