Application of MrDRRP gene in regulation and control of drought resistance of hairy roots of medicago ruthenica

Abstract

The invention discloses application of an MrDRRP gene in regulating and controlling drought resistance of hairy roots of medicago ruthenica, and belongs to the technical field of biology. According to the invention, a disease-resistant related gene, named as MrDRRP, derived from medicago ruthenica is utilized, the medicago ruthenica is transformed through an agrobacterium rhizogenes mediated transgenic technology, the MrDRRP transgenic hairy roots of the medicago ruthenica are obtained, and drought stress experiments prove that the drought tolerance of the obtained hairy roots of the medicago ruthenica is remarkably enhanced, and the length and fresh weight of the hairy roots are remarkably improved. Therefore, the method is provided for cultivating the drought-resistant medicago ruthenica, the drought resistance of the medicago ruthenica is enhanced, the planting range of the medicago ruthenica is widened, and the method has good application value.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of MrDRRP gene in regulating drought resistance of Medicago truncatula hairy roots. Background Art

[0002] Medicago ruthenica, also known as flower alfalfa, wild alfalfa, net-fruit fenugreek, etc., belongs to the genus Medicago of the Leguminosae family. This plant is mainly distributed in the high mountains, typical grasslands and desert grassland areas in northern China. With its excellent cold and drought resistance, Medicago ruthenica can thrive in cold and arid environments, showing great potential to become a high-quality forage resource. Researchers have found that Medicago ruthenica is the only species in the genus Alfalfa that can survive in harsh environments such as cold, drought and petrification. In terms of adaptability and tolerance, Medicago ruthenica has obvious advantages over alfalfa, which makes its ability to survive in harsh environments particularly outstanding.

[0003] Meadow lily exhibits strong stress resistance, but the exploration of its resistance mechanism has mostly remained at the cytological and eco-physiological levels. Historical studies have shown that the research focus of Meadow lily has been on its ecological characteristics, geographical distribution range, planting technology, genetic diversity, and distant hybridization breeding with alfalfa. Despite this, environmental fluctuations pose multiple pressures on the normal growth and development of plants, and drought is particularly critical, which has a profound impact on the survival, growth and even distribution of plants. In view of the increasing frequency and intensity of drought, it has become particularly important to further deepen the research on Meadow lily at the molecular level based on existing morphological and physiological studies. This includes discovering its drought-resistant related genes and exploring the mechanisms behind them, which has great scientific and practical value for understanding and improving the drought tolerance of plants.

[0004] Since Agrobacterium rhizogenes can induce some plants to grow hairy roots, and the Ri plasmid it carries can trigger the formation of hairy roots in damaged parts of plants and promote the production of a large number of secondary metabolites, there are currently some technologies that use Agrobacterium rhizogenes to genetically transform Medicago truncatula. However, these methods generally have low transformation efficiency and unsatisfactory results, which limits the possibility of in-depth exploration of the genetic functions of Medicago truncatula.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The purpose of the present invention is to provide an application of the MrDRRP gene in regulating the drought resistance of the hairy roots of Medicago truncatula. The transgenic plants obtained by transforming Medicago truncatula plants using the overexpression vector constructed by the present invention can significantly improve the drought resistance of the hairy roots of Medicago truncatula, which is of great significance for the research on the functional genes of Medicago truncatula.

[0007] The present invention is achieved in that:

[0008] In a first aspect, the present invention provides a protein MrDRRP that can improve the drought resistance of plants. The amino acid sequence of the protein MrDRRP is shown in SEQ ID NO.1.

[0009] In a second aspect, the present invention provides a biomaterial related to the above-mentioned protein MrDRRP, which comprises any one of the following (1)-(4):

[0010] (1) a nucleic acid molecule encoding the above protein MrDRRP;

[0011] (2) an expression cassette containing the above nucleic acid molecule;

[0012] (3) a recombinant vector containing the above-mentioned nucleic acid molecule or expression cassette;

[0013] (4) A recombinant microorganism containing the above nucleic acid molecule, expression cassette or recombinant vector.

[0014] In a third aspect, the present invention provides the use of the above-mentioned protein MrDRRP or biological material in improving the drought resistance of plants, and the use includes overexpressing the protein MrDRRP in plants.

[0015] In a fourth aspect, the present invention provides a method for improving the drought resistance of Medicago truncatula hairy roots, comprising:

[0016] A rhizogenes Agrobacterium bacterial film carrying the coding gene of the above-mentioned protein MrDRRP is prepared, and the Agrobacterium is transfected into Medicago truncatula seedlings, which are subjected to rooting treatment. After rooting, drought phenotype identification is performed to obtain transgenic plants with improved drought resistance of hairy roots compared with normal Medicago truncatula.

[0017] The present invention has the following beneficial effects:

[0018] (1) The present invention provides for the first time an endogenous gene in Medicago truncatula, which can enhance the drought tolerance of Medicago truncatula and increase the root length and fresh weight of the hairy roots of Medicago truncatula under drought conditions.

[0019] (2) The present invention transforms Medicago truncatula seedlings through Agrobacterium rhizogenes-mediated transgenic technology to obtain Medicago truncatula hairy roots with MrDRRP gene. Drought stress experiments show that the drought tolerance of the obtained Medicago truncatula hairy roots is significantly enhanced, and the root length and fresh weight of the hairy roots are significantly increased. The present invention provides a method for cultivating drought-resistant Medicago truncatula, enhances the drought tolerance of Medicago truncatula, broadens the planting range of Medicago truncatula, and has good application value.

[0020] (3) The transformation method of the present invention can be used as a biotechnology method to study the function of drought-resistant genes in Medicago truncatula, and may be extended to other fields including the study of stress resistance mechanisms, laying a foundation for the verification of gene functions and genetic breeding of Medicago truncatula. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0022] Figure 1 This is the positive identification result of MrDRRP overexpression in Example 2;

[0023] Figure 2 The expression level of MrDRRP overexpressed in the roots of Medicago truncatula in Example 2 was determined;

[0024] Figure 3 This is the overall level GFP fluorescence observation diagram of the empty vector, overexpression and wild-type Medicago truncatula in Example 3;

[0025] Figure 4 The GFP fluorescence images at the cellular level of the empty vector, overexpression and wild-type Medicago truncatula in Example 4 are shown;

[0026] Figure 5 This is a root length morphology diagram of the Medicago truncatula seedlings treated on 1 / 2B5 and 300 mM Mannitol medium for 10 days in Example 5; Figure 5 (A) is the root length morphology of Medicago truncatula seedlings treated on 1 / 2B5 medium for 10 days; Figure 5 (B) is the root length morphology of the Medicago truncatula seedlings treated on 300 mM Mannitol medium for 10 days;

[0027] Figure 6 The statistical analysis of root length and fresh weight of the Medicago truncatula seedlings treated on 1 / 2B5 and 300 mM Mannitol medium for 10 days in Example 6; Figure 6(A) Statistical analysis of root length of A. truncatula seedlings treated on 1 / 2B5 and 300 mM Mannitol medium for 10 days; Figure 6 (B) Statistical analysis of the fresh weight of A. truncatula seedlings treated on 1 / 2B5 and 300 mM Mannitol medium for 10 days. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0029] In the preliminary study of the present invention, it was found that the MrDRRP gene may be involved in the regulation of drought resistance of Medicago truncatula. On this basis, the present invention constructed an expression vector capable of overexpressing the MrDRRP gene and transferred it into Agrobacterium, and obtained the hairy root material overexpressing MrDRRP by the Agrobacterium-mediated method. The results showed that the drought resistance of the hairy roots overexpressing the MrDRRP gene was improved. That is, a new use of the Medicago truncatula MrDRRP protein and its encoding gene in improving the drought resistance of Medicago truncatula was obtained.

[0030] The amino acid sequence of the MrDRRP protein is shown in SEQ ID NO. 1. In some embodiments, in order to facilitate purification of the MrDRRP protein, a conventional purification tag may be connected to the amino terminus or carboxyl terminus of the protein with the amino acid sequence shown in SEQ ID NO. 1.

[0031] Accordingly, the present invention also provides biological materials related to the above protein MrDRRP, which include: nucleic acid molecules encoding the above protein MrDRRP.

[0032] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA, or RNA, such as mRNA or hnRNA.

[0033] In some embodiments, the nucleic acid molecule is a cDNA molecule or a DNA molecule as shown in SEQ ID NO.2; or a cDNA molecule or a genomic DNA molecule that has more than 75% identity with the nucleotide sequence as shown in SEQ ID NO.2 and encodes the protein MrDRRP.

[0034] Those skilled in the art can easily mutate the nucleotide sequence encoding the MrDRRP protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides with 75% or higher identity to the nucleotide sequence encoding the MrDRRP protein are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the MrDRRP protein and have the same function.

[0035] The above-mentioned biological material includes an expression cassette containing the above-mentioned nucleic acid molecule, and the expression cassette is a DNA capable of expressing MrDRRP protein in a host cell, which includes but is not limited to a promoter and a terminator, and may also include an enhancer. The above-mentioned promoter, terminator, enhancer and other elements can be selected according to actual needs, and the present invention does not limit this.

[0036] Recombinant vectors containing the above-mentioned nucleic acid molecules or expression cassettes can be constructed using existing expression vectors; the expression vectors include but are not limited to: single-stranded, double-stranded or partially double-stranded nucleic acid molecules; nucleic acid molecules containing one or more free ends, no free ends (e.g., circular); nucleic acid molecules containing DNA, RNA or both; and other polynucleotide types known in the art.

[0037] Among the most commonly used vector types are "plasmids," which refer to circular double-stranded DNA loops into which additional DNA segments can be inserted, for example, by standard molecular cloning techniques. Recombinant expression vectors can comprise a form suitable for expressing nucleic acids in a host cell, which means that the recombinant expression vector includes one or more regulatory elements, which can be selected based on the host cell used for expression and to which the nucleic acid sequence to be expressed can be operably linked.

[0038] In addition, the above biological materials also include: recombinant microorganisms containing the above nucleic acid molecules, expression cassettes or recombinant vectors. The microorganisms can be bacteria or fungi, such as Escherichia coli, yeast and Agrobacterium. The specific selection can be made according to actual needs, and the present invention does not limit this.

[0039] Based on the above-mentioned MrDRRP protein or the above-mentioned biological material, the present invention also provides the application of the above-mentioned MrDRRP protein or the above-mentioned biological material in improving the drought resistance of plants, specifically: a DNA molecule encoding the protein MrDRRP is introduced into a plant through a recombinant vector containing a DNA molecule encoding the protein MrDRRP to obtain transgenic hairy roots. Under drought stress, the root length and fresh weight of the transgenic hairy roots are higher than those of the empty vector hairy roots, thereby proving that the MrDRRP protein and its encoding gene MrDRRP are related to plant drought resistance and can significantly improve the drought resistance of plants.

[0040] Therefore, the present invention also provides a method for improving the drought resistance of Medicago truncatula hairy roots, the steps are as follows:

[0041] S1. Preparation of Agrobacterium rhizogenes biofilm carrying target gene;

[0042] S2. Preparation of Medicago truncatula seedlings;

[0043] S3. Transfecting Agrobacterium into Medicago truncatula to treat the seedlings for rooting;

[0044] S4. Identify drought phenotypes after rooting.

[0045] Among them, the method for preparing Medicago truncatula seedlings is as follows: after grinding and breaking the hard particles of Medicago truncatula seeds, disinfecting them with 20% sodium hypochlorite and then spreading them on water agar medium, wrapping the medium with tin foil and placing it upright in a refrigerator at 4°C for vernalization for 2-3 days, and then culturing it in a walk-in incubator with a temperature of 22°C and a lighting condition of 16h light / 8h dark. The culturing time is 1-2 days, and the preparation of Medicago truncatula seedlings is completed when the hypocotyl grows to about 1 cm.

[0046] The components of the water agar culture medium in the present invention are: 8g agar and 1L distilled water.

[0047] The rooting treatment includes two steps: cutting the roots of the Medicago truncatula and infection. The rooting method of the Medicago truncatula is to quickly cut off the root tip 1-3 mm above the root tip with a scalpel; the infection method is to scratch the cut end of the Medicago truncatula through the Agrobacterium rhizogenes bacterial film and dip a small amount of Agrobacterium, then place it in FA culture medium, seal it with sealing film, and place it in a walk-in incubator with a temperature of 22°C and a light condition of 16h light / 8h dark. The rooting process is completed after 7-8 days of culture.

[0048] Compared with other alfalfa such as alfalfa, the rooting time of Medicago truncatula is relatively late, and the nutrient requirement of the culture medium is relatively high. It is found in the experiment that Medicago truncatula can only root on FA culture medium, and Medicago truncatula is very wild, the rooting efficiency is lower than that of alfalfa, and it is easy to be contaminated if not handled properly. In order to achieve a better rooting effect, the present invention designs the following culture medium for Medicago truncatula:

[0049] The components of the FA medium adopted in the present invention are 20mL of macroelements (6.16gMgSO4·7H2O, 4.76gKH2PO4, 10.72g Na2HPO4·7H2O, 2.00g NH4NO3 dissolved in 1L of distilled water); 1mL of trace elements (10mg MnCl2, 10mg CuSO4, 10mg ZnCl2, 10mg H3BO3, 10mg Na2MoO4 dissolved in 100mL of distilled water); 1mL of CaCl2 (13.23gCaCl2·2H2O dissolved in 100mL of distilled water); 1mL of ferric citrate (0.05g ferric citrate dissolved in 100mL of distilled water), 1mL of 1mM AIB, ferric citrate and AIB are filtered and sterilized, and pH is adjusted to 6.5, and 8g of plant agar.

[0050] The method for drought phenotype identification after rooting is as follows: when the root length reaches 5-6 cm, select the empty load and MrDRRP gene overexpressing plants with the same root length and growth momentum and transfer them to 1 / 2B5 medium and 300mM Mannitol medium for drought phenotype identification.

[0051] Among them, the components of 1 / 2B5 culture medium are: 1.6g B5 culture medium, 10g sucrose, 10g agar, 1L distilled water, adjust the pH to 5.8, and add 400mg / L Cef and Tim each.

[0052] 300 mM Mannitol medium is composed of the following ingredients: 1.6 g B5 medium, 10 g sucrose, 54.651 g mannitol, 10 g agar, 1 L distilled water to adjust the pH to 5.8, and 400 mg / L Cef and Tim each.

[0053] The above-mentioned method for transformation of Medicago truncatula hairy roots can obtain transgenic hairy roots about two weeks after the seedlings are cut and infected. This method has the characteristics of high efficiency, high transformation rate and low time consumption, and can effectively promote the research on Medicago truncatula functional genes.

[0054] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0055] The methods for obtaining the target gene and constructing the vector involved in the embodiments of the present invention are as follows:

[0056] According to the transcriptome sequencing results of the Biomarker Cloud Platform, the expression levels of differentially expressed genes were statistically analyzed using Excel software to screen out drought-resistant differentially expressed genes.

[0057] 1.TOPO cloning

[0058] The CDS sequence of MrDRRP was extracted using the transcriptome sequencing results of alfalfa, and the cDNA of Medicago truncatula root was used as a template for candidate gene cloning. The complete CDS sequences of 12 candidate genes were cloned using Cloning Kits (Invitrogen, K2400-20) and Phusion high-fidelity enzyme (Thermo Fisher Scientific, F530-S). Primers for gene amplification were designed using DNAMAN software. The primer information was MrDRRP-F: CACCATGGGTGTTTTTAATTTTGAGG-SEQ ID NO.3; MrDRRP-R: GTTGTAGTCAGGATTAGCCAAAC-SEQ ID NO.4. The recognition site "CACC" of the PENTR / D-TOPO entry vector was introduced at the 5' end upstream of the primer. The gene cloning reaction system was as follows: 1 μL 10 μM Forward Prime, 1 μL 10 μM Reverse Primer, 10 μL 5× Phusion HF Buffer, 4 μL 2.5 mM dNTP, 0.5 μL Phusion DNA Polymerase, 1 μL cDNA, and ddH2O was added to make up to 50 μL. The reaction procedure was as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 57°C for 30 s, extension at 72°C for 15 s / kb, for a total of 35 cycles; further extension at 72°C for 5 min; and termination at 4°C.

[0059] 2.TOPO connection

[0060] Prepare an agarose gel with a concentration of 1.5%, and dot the amplified target gene into the gel hole in turn. Perform electrophoresis at a constant current of 135mA and a voltage of 135V for 25min. After electrophoresis, use a gel imaging analysis system (FluorChem FC2, Alpha USA) for image scanning and gel cutting and recovery. Cut the expected target band and put it into a 1.5mL EP tube. Use a gel recovery kit (Tiangen Biotech, China) to recover the target band. For specific operation methods, see the instructions. After the PCR product gel recovery is completed, connect it with the PENTR / D-TOPO entry vector. The TOPO connection system is as follows: 4μL PCR product purification, 1μL PENTR / D-TOPO entry vector and 1μL Salt solution; connect at room temperature (25℃) for 30min.

[0061] 3. Heat shock transformation of E. coli

[0062] 1) Take out a centrifuge tube containing 100 μL of E. coli competent cells DH5α (Tiangen Biotech, China) from a -80°C refrigerator and place it in ice. After the competent cells melt, add 3 μL of the ligation product, mix gently, and place on ice for 30 min.

[0063] 2) Heat shock the competent cells with the ligation product at 42°C for 90 seconds, then quickly move to ice for 2 minutes;

[0064] 3) Add 900 μL of sterilized LB liquid medium to the centrifuge tube, mix well, and place in a 37°C shaker at 200 rpm for 1 hour to recover;

[0065] 4) Spread the revived E. coli on LB solid medium containing Kan, and invert the medium in a 37°C incubator for overnight culture.

[0066] 5) The grown single clone was streaked and propagated on LB solid medium containing Kan, and cultured again in a 37°C incubator overnight.

[0067] 4.TOPO vector colony PCR detection

[0068] Use a sterilized white gun tip to dip the colony into the PCR reaction solution, use primers M13-F: CTGTAAAACGACGGCCAG (SEQ ID NO.5) and M13-R: CAGGAAACAGCTATGAC (SEQ ID NO.6) for PCR reaction, use 2×F8FastLong PCR MasterMix (Beijing Aidelai Biotechnology Co., Ltd., PC80) for amplification, the reaction system is as follows: 0.5μL 10μM Forward Primer, 0.5μL 10μM Reverse Primer, 5μL 2×F8FastLong PCR MasterMix, dip the colony DNA with a white gun tip, and fill it up to 10μL with ddH2O. The reaction procedure is as follows: 94℃ pre-denaturation for 5min; 94℃ denaturation for 20s, 57℃ annealing for 15s, 72℃ extension for 10s / kb, a total of 35 cycles; 72℃ extension for 4min; 4℃ termination.

[0069] Three suitable clone colonies detected by PCR were selected, cultured in LB liquid medium containing Kan at 37°C and 240 rpm overnight, and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0070] 5.LR connection

[0071] The monoclones suitable for sequencing were selected and incubated overnight at 37°C and 240 rpm in LB liquid medium containing Kan, and plasmids were extracted using a plasmid extraction kit (Tiangen Biotech, China). The specific operation method is described in the instruction manual. The LR ligation system was prepared as follows: 1 μL (≤150 ng / μL) pMDC83 expression vector, 1 μL (≤100 ng / μL) PENTR / D-TOPO entry vector, 2 μL LR enzyme, and 6 μL ddH2O.

[0072] Using LR II Plus Enayme Mix (Invitrogen, 11791-020) was used to carry out LR ligation reaction between the entry vector plasmid and the pMDC83 expression vector, and the ligation was carried out overnight at 25°C on a PCR instrument.

[0073] After the ligation is completed, add 2 μL of 10×Proteinase K Solution to the reaction tube, mix well and incubate at 37°C for 10 min. Heat-shock the ligation product to transform E. coli DH5α as described above, and then use primers 35s-F: GAGGACCTCGACTCTAGAACTAGT (SEQ ID NO.7) and MrDRRP-R: GTTGTAGTCAGGATTAGCCAAAC (SEQID NO.4) for colony PCR detection. The PCR reaction system and procedure are the same as step 4. Pick 3 clone colonies suitable for PCR detection, shake the colonies and send them to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Shake the clone colonies suitable for sequencing and extract the plasmid.

[0074] 6. Transformation of Agrobacterium

[0075] The expression vector plasmid was heat-shocked to transform Agrobacterium rhizogenes Ar.Qual (Puente Biotechnology), and the specific operation was as follows:

[0076] 1) Take Ar.Qual Agrobacterium rhizogenes competent cells stored at -80℃ and place them at room temperature or in the palm of your hand for a while until they partially melt. When they are in a state of mixing ice and water, insert them into ice;

[0077] 2) Add 2 μL of plasmid DNA to every 100 μL competent medium, quickly and vigorously stir the bottom of the tube to mix well or blow and suck with a gun to mix well, and then place it in ice for 15 minutes, liquid nitrogen for 5 minutes, 37°C water bath for 5 minutes, and ice bath for 5 minutes;

[0078] 3) Take out the tube from the ice bath and bring it to room temperature, add 700 μL of sterilized LB liquid medium, and culture at 28°C with shaking for 2 h;

[0079] 4) Centrifuge at 6000 rpm for 1 min to collect the bacteria, take about 100 μL of the supernatant, blow and resuspend the bacteria, spread it on LB solid medium containing Kan and streptomycin resistance, and place it upside down in a 28°C incubator for 2-3 days;

[0080] 5) The grown single clones were streaked and propagated on LB solid medium containing Kan and streptomycin resistance, and cultured again in a 28°C incubator overnight.

[0081] Primers 35s-F and MrDRRP-R were used for colony PCR detection. The PCR reaction system and procedure were the same as step 4. The appropriate clones detected by PCR were picked and cultured in LB liquid medium containing Kan and streptomycin resistance at 28°C and 200 rpm overnight, and the bacterial solution was mixed with 50% glycerol in a 1:1 ratio and stored at -80°C for subsequent rooting experiments.

[0082] Example 1

[0083] This example is a rooting treatment of the MrDRRP overexpression gene of Medicago truncatula, comprising the following steps:

[0084] Plant material: 'Zhongke No. 1' Medicago truncatula.

[0085] (1) Preparation of Agrobacterium rhizogenes biofilm with target gene

[0086] Take 200 μL of the prepared Agrobacterium rhizogenes culture solution containing empty PMDC83 and target gene MrDRRP and evenly apply it to LB solid culture medium containing corresponding antibiotics, and culture it upside down at 28°C for two days.

[0087] (2) Preparation of Medicago truncatula seedlings

[0088] ① Seed treatment: Grind the Medicago truncatula seeds to remove the hard particles, disinfect the seeds with 20% sodium hypochlorite for 10 minutes, wash them 10 times with sterilized water, clean them thoroughly, and evenly spot them on 8% water agar medium in an ultra-clean workbench.

[0089] ② Seed germination: Wrap the culture medium with tin foil and place it in a refrigerator at 4°C for 3 days for vernalization. Then place it in a walk-in incubator at 22°C and 16h light / 8h dark for 2 days. When the hypocotyl grows to about 1 cm, the preparation of Medicago truncatula seedlings is completed.

[0090] (3) Transfecting Agrobacterium into Medicago truncatula

[0091] ① Root cutting of flat clover: In a clean bench, sterilize tweezers, small scissors and scalpels with an inoculator, and when the temperature returns to normal, use a scalpel to horizontally cut from left to right about 4 cm above the FA square culture medium and remove this part of the culture medium. Then use a scalpel to evenly cut 10 1 cm notches vertically at the cut point. Gently pick up the seedlings with tweezers and quickly cut them 1 mm above the root tip with small scissors to prevent wilting.

[0092] ② Infection: Pick up the Medicago truncatula with tweezers, then scratch the cut end through the Agrobacterium rhizogenes bacterial film and dip a small amount of Agrobacterium. After dipping a small amount of Agrobacterium, insert it into the gap of the FA square culture medium described in ①, wherein the FA culture medium formula includes: 20mL macroelements (6.16g MgSO4·7H2O, 4.76g KH2PO4, 10.72g Na2HPO4·7H2O, 2.00g NH4NO3 dissolved in 1L distilled water); 1mL trace elements (10mg MnCl2, 10mg CuSO4, 10mg ZnCl2, 10mg H3BO3, 10mg Na2MoO4 dissolved in 100mL distilled water); 1mL CaCl2 (13.23g CaCl2·2H2O dissolved in 100mL distilled water); 1mL ferric citrate (0.05g ferric citrate dissolved in 100mL distilled water), 1ML 1Mm AIB, ferric citrate and AIB were sterilized by filtration, the pH was adjusted to 6.5, 8 g of plant agar was added, and sealed with 3M sealing film, and cultured in a walk-in incubator at 22°C and 16 h light / 8 h dark. The transfection and rooting process was completed after 7 days of culture. The cut roots of the seedlings could be clearly seen to swell, and the root length could grow to about 3 cm after 12 days.

[0093] Example 2

[0094] Positive identification and expression level determination of MrDRRP overexpressing Medicago truncatula

[0095] (1) Positive identification of MrDRRP overexpressing Medicago truncatula

[0096] Use tweezers to pick up the seedlings and use small scissors to cut off the root swelling. Put it into a 1.5mL tube filled with steel balls and immediately put it into liquid nitrogen. Use a ball mill to crush the sample. Use Tiangen DNA extraction kit to extract DNA (see the instructions for extraction steps). PCR detection is performed on the phenotyped flat bean plants on 1 / 2B5 and 300mM Mannitol medium. The primers used for PMDC83 empty load are:

[0097] GFP-F:AGTGGAGAGGGTGAAGGTG-SEQ ID NO.8;

[0098] GFP-R:CTTGTCGGCCATGATGTATA-SEQ ID NO.9;

[0099] Amplification was performed, and the amplified band size was 381 bp;

[0100] The primers used for MrDRRP gene were:

[0101] 35sF-L1:GAGGACCTCGACTCTAGAACTAGT-SEQ ID NO.7;

[0102] MrDRRP-R:GTTGTAGTCAGGATTAGCCAAAC-SEQ ID NO.4;

[0103] Amplification was performed and the amplified band size was 477bp. The test results were as follows Figure 1 As shown, the results showed that all the plants were positive.

[0104] (2) Determination of MrDRRP expression in Medicago truncatula

[0105] Grasp the seedlings with tweezers and cut them at the root swelling with small scissors. Put them into a 1.5mL RNase-Free tube filled with sterilized steel balls and immediately put them into liquid nitrogen. Use a ball mill to crush the sample, use the Sikejie RNA extraction kit to extract RNA (see the instructions for the extraction steps), and then use the Tiangen FastKing one-step reverse transcription kit for reverse transcription (see the instructions for the experimental method) to obtain cDNA for qRT-PCR to determine the relative expression of MrDRRP in transgenic Medicago truncatula. qRT-PCR detection was performed on Medicago truncatula plants with phenotypes on 1 / 2B5 and 300mM Mannitol medium. The primers used were:

[0106] QMrDRRP-F:ACCTCCACTGTAGCTCCTG-SEQ ID NO.10;

[0107] QMrDRRP-R:GGTCTCACCATTCTCAACGA-SEQ ID NO.11;

[0108] The reaction was carried out using the Yugong Bio Kit, with the reaction system of 10μM Forward Primer: 0.2μL, 10μM Reverse Primer: 0.2μL, cDNA: 1μL, ddH2O: 3.6μL. The PCR amplification reaction program was: pre-denaturation at 95℃ for 30s, denaturation at 95℃ for 10s, annealing & extension at 55℃ for 30s, and 40 cycles of denaturation to annealing & extension. The test results are as follows Figure 2As shown, the expression level of MrDRRP increased in the overexpression lines, and under drought stress, the expression level of MrDRRP further increased.

[0109] Example 3

[0110] Observation of GFP fluorescence at the whole level of Medicago truncatula

[0111] Use forceps to pick up the seedlings and use small scissors to cut off the root tip at about 1.5 cm, soak in 0.01% Tween 20 and evacuate for 30 minutes, rinse with distilled water twice, then wash with washing buffer (10mM Tris-HCl PH=7.2 and 50mM KCl), and finally rinse with ddH2O 5-6 times. Note that the whole process should be carried out on ice. A research-grade stereo fluorescence microscope was used to observe the overall level of GFP fluorescence in empty PMDC83, overexpressed MrDRRP gene and wild-type WT. The results are shown in Figure 3 As shown, the WT under the control and 300 mM Mannitol treatment had no fluorescence, while the empty vector and MrDRRP gene overexpression plants all showed GFP green fluorescence, indicating that they were all positive plants.

[0112] Example 4

[0113] Observation of GFP fluorescence at the cellular level in Azela truncatula

[0114] Use forceps to pick up the seedlings and use small scissors to cut off the root tip at about 1.5 cm, soak in 0.01% Tween 20 and evacuate for 30 minutes, rinse with distilled water twice, then wash with washing buffer (10mM Tris-HCl pH=7.2 and 50mM KCl), and finally rinse with ddH2O 5-6 times. Note that the whole process should be carried out on ice. Laser confocal microscopy (inverted) was used to observe the GFP fluorescence level of empty PMDC83, overexpressed MrDRRP gene and wild-type WT cells. The results are shown in Figure 4 As shown, the WT under the control and 300 mM Mannitol treatment had no fluorescence, while the empty vector and MrDRRP gene overexpression plants all showed GFP green fluorescence, indicating that they were all positive plants.

[0115] Example 5

[0116] Observation on rooting phenotype of Azela truncatula

[0117] (1) Preparation of 1 / 2B5 and 300 mM Mannitol culture medium

[0118] ①1 / 2B5 medium is composed of the following ingredients: 1 / 2B5 medium 1.6g, sucrose 10g, agar 10g, 1L distilled water, adjust the pH to 5.8, add Cef and Tim 400mg / L each.

[0119] ②300mM Mannitol medium is composed of the following ingredients: 1 / 2B5 medium 1.6g, sucrose 10g, mannitol 54.651g, agar 10g, 1L distilled water to adjust the pH to 5.8, and add Cef and Tim 400mg / L each.

[0120] (2) Transfer the Medicago truncatula seedlings to 1 / 2B5 and 300 mM Mannitol medium

[0121] In the clean bench, tweezers, small scissors and scalpels were sterilized with an inoculator. When the temperature returned to normal, a scalpel was used to cut horizontally from left to right about 4 cm above the 1 / 2B5 and 300mM Mannitol square culture medium and remove this part of the culture medium. Seedlings with the same root length were selected and placed so that the cut roots were on the same horizontal line. Note that each seedling should be covered with a lid to prevent the plant from wilting. Four replicates of PMDC83 and MrDRRP genes were placed without any expression ( Figure 5 A), obvious phenotype will appear after 10 days ( Figure 5 B), it can be seen from the figure that under drought stress, MrDRRP overexpressing Medicago truncatula has better root growth.

[0122] Example 6

[0123] Statistical analysis of root length and fresh weight of Medicago truncatula seedlings after 10 days of treatment

[0124] Use tweezers to pick up the seedlings and use small scissors to cut off the root swelling. Place them on a ten-thousandth scale to weigh the fresh weight of each root. Use Digimier software to calculate the length from the root swelling to the root tip. Then use SPSS software for significance analysis and Origin software for drawing. The results are as follows Figure 6 As shown, the root length and fresh weight of the Medicago truncatula group overexpressing MrDRRP were higher, proving that the MrDRRP gene can regulate the drought resistance of Medicago truncatula hairy roots.

[0125] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A protein MrDRRP that can improve plant drought resistance, characterized in that: The amino acid sequence of the protein MrDRRP is shown in SEQ ID NO.

1.

2. A biological material related to the protein MrDRRP according to claim 1, characterized in that: Including any one of the following (1)-(4): (1) a nucleic acid molecule encoding the protein MrDRRP; (2) an expression cassette containing the nucleic acid molecule; (3) a recombinant vector containing the nucleic acid molecule or expression cassette; (4) A recombinant microorganism containing the nucleic acid molecule, expression cassette or recombinant vector.

3. The biomaterial according to claim 2, characterized in that The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

2.

4. The use of the protein MrDRRP according to claim 1 or the biomaterial according to claim 2 or 3 in improving the drought resistance of plants, characterized in that: The application comprises overexpressing the protein MrDRRP in plants.

5. The use according to claim 4, characterized in that: The plants include Medicago truncatula.

6. A method for improving the drought resistance of Medicago truncatula hairy roots, characterized in that: include: A rhizogenes Agrobacterium bacterial film carrying the coding gene of the protein MrDRRP according to claim 1 is prepared, and the Agrobacterium is transfected into Medicago truncatula seedlings, which are subjected to a rooting treatment, and drought phenotype identification is performed after rooting to obtain transgenic plants with improved drought resistance of hairy roots compared with normal Medicago truncatula.

7. The method according to claim 6, characterized in that The preparation method of the Medicago truncatula seedlings comprises: sterilizing the Medicago truncatula seeds and paving them on a water agar medium, then placing them in a refrigerator for vernalization, and then placing them in an incubator for culturing until the hypocotyl grows to 1 cm; Preferably, the disinfection agent is sodium hypochlorite with a mass concentration of 20%; Preferably, the conditions of the vernalization treatment are: temperature 4°C, time 2-3 days; Preferably, the culture conditions in the incubator are: temperature 22° C., light exposure time 16 h, and culture time 1-2 d.

8. The method according to claim 6, characterized in that The transfection comprises: quickly cutting the root tip 1-3 mm above the root tip, scratching the cut end through the Agrobacterium rhizogenes bacterial film to dip a small amount of Agrobacterium, then placing it in FA culture medium, sealing it with a sealing film and then placing it in an incubator for culture; Preferably, the ingredients of the FA medium are: MgSO4·7H2O, KH2PO4, Na2HPO4·7H2O, NH4NO3, MnCl2, CuSO4, ZnCl2, H3BO3, Na2MoO4, CaCl2, ferric citrate, AIB and agar, pH = 6.5; Preferably, the culture conditions in the incubator are: temperature 22°C, light exposure time 16h, and culture time 7-8d.

9. The method according to claim 6, characterized in that The drought phenotype simply includes: when the root length grows to 5-6 cm, select the empty load and MrDRRP gene overexpressing plants with the same root length and growth momentum and transfer them to 1 / 2B5 medium and 300mMMannitol medium for drought phenotype identification; Preferably, the components of the 1 / 2B5 medium are: B5 medium, sucrose, agar, Cef and Tim, and the pH is adjusted to 5.8; Preferably, the components of the 300 mM Mannitol medium are: B5 medium, sucrose, mannitol, agar, Cef and Tim, and the pH is adjusted to 5.

8.

10. Use of the method for improving the drought resistance of Medicago truncatula hairy roots as described in any one of claims 6 to 9 in cultivating drought-tolerant plants.

Images