Plant susceptibility related TaCNGC13 gene, protein and application of plant susceptibility related TaCNGC13 gene and protein

Abstract

The invention belongs to the technical field of genetic engineering, and discloses a phytosusceptibility-related TaCNGC13 gene, a protein and application of the phytosusceptibility-related TaCNGC13 gene and the protein. The phytosusceptible related TaCNGC13 gene is derived from a wheat variety water source 11, the nucleotide sequence of the gene is shown as SEQ ID NO: 1, and the amino acid sequence of the gene encoding protein is shown as SEQ ID NO: 2. The plant-susceptibility-related TaCNGC13 gene is induced to express by the puccinia striiformis, the expression of the plant-susceptibility-related TaCNGC13 gene in wheat is stably silenced, and the resistance of the obtained transgenic wheat to a plurality of physiological races of the puccinia striiformis is higher than that of wild wheat. The invention provides a novel germplasm material for green control of wheat stripe rust and cultivation of wheat stripe rust resistant varieties.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology and relates to plant disease-related TaCNGC13 Genes, proteins and their applications. Background Art

[0002] Wheat stripe rust is caused by Puccinia striatum, a wheat-specific pathogen ( Puccinia striiformis f. sp. Tritici , Pst), which affects wheat yield. Stripe rust is an obligate nutrient parasite that relies on living cells of wheat for survival and needs to absorb intermediate products to grow and develop. Its summer spores can be spread to leaves under the action of wind. Under suitable temperature and humidity conditions, they can germinate to form bud tubes in 4 to 6 hours, infect wheat and establish a parasitic relationship. After the stripe rust infects the host plant, it absorbs nutrients from the host plant through the haustoria and reproduces. During this process, the host plant shows symptoms such as chlorosis and necrosis, the vitality of the host plant is weakened, and photosynthesis is reduced. At the same time, it is accompanied by a decrease in key crop yield indicators such as the number of tillers, ears and seeds of the host plant, resulting in a reduction in yield.

[0003] Planting disease-resistant varieties is considered the most economical and effective measure to prevent and control stripe rust. However, due to changes in climate and environment, unreasonable human cultivation measures, and mutations in virulent subspecies of wheat stripe rust, disease-resistant varieties may lose their resistance. Host genes that can promote pathogen infection and support affinity interactions in plants are considered to be susceptible genes. Mutations or deletions of susceptible genes will limit the ability of pathogens to infect and cause disease, thereby enhancing the host's disease resistance. During the pathogen invasion period, susceptible genes negatively regulate plant immune responses; after pathogen invasion, susceptible genes promote affinity interactions between hosts and pathogens, including absorbing nutrients from the host to meet the metabolic and structural needs of the pathogens. Plant pathogens use plant susceptible genes to promote infection. Interference and mutation of these susceptible genes will block affinity interactions between hosts and pathogens and enhance disease resistance.

[0004] Therefore, discovering a susceptible gene resource related to wheat stripe rust resistance is of great significance for green disease prevention and control and the breeding of disease-resistant wheat varieties. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a plant disease-related TaCNGC13 Genes, proteins and their applications. Plant disease related TaCNGC13 The gene comes from the wheat variety Shuiyuan 11 ( Triticum aestivum ), the nucleotide sequence of which is shown in SEQ ID NO:1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:2. TaCNGC13 Genes induced by stripe rust are expressed and stably silenced in plants related to disease susceptibility TaCNGC13The gene is expressed in wheat, and the obtained transgenic wheat has higher resistance to multiple physiological species of stripe rust than wild-type wheat. The invention provides a new type of germplasm material for green prevention and control of wheat stripe rust and cultivation of wheat stripe rust resistant varieties.

[0006] In order to achieve the technical purpose of the present invention, on the one hand, the present invention provides a plant disease-related TaCNGC13 Genes, the plant disease related TaCNGC13 The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0007] On the other hand, the present invention provides a plant disease susceptibility-related TaCNGC13 protein, comprising the plant disease susceptibility-related TaCNGC13 Gene encoding; the amino acid sequence of the plant disease susceptibility-related TaCNGC13 protein is shown in SEQ ID NO: 2.

[0008] A person of ordinary skill in the art can obtain a derived amino acid sequence by replacing, deleting and / or adding one or several amino acids to the plant disease susceptibility-related TaCNGC13 protein as shown in SEQ ID NO:2, and the derived amino acid sequence still has the activity of the plant disease susceptibility-related TaCNGC13 protein.

[0009] In order to facilitate the purification of the plant disease-related TaCNGC13 protein, a tag can be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID NO: 2. The tag can be any one of Poly-Arg, Poly-His, FLAG, Strep-tag II, and c-myc.

[0010] On the other hand, the present invention claims protection for plant disease-related TaCNGC13 Application of genes in wheat resistance to stripe rust, the plant is susceptible to the disease TaCNGC13 The nucleotide sequence of the gene is shown in SEQ ID NO: 1. TaCNGC13 The gene expression is induced by stripe rust.

[0011] Specifically, the present invention analyzes TaCNGC13 Gene expression profiles in wheat-rust interaction revealed TaCNGC13 The gene was up-regulated in the early stage of infection after inoculation in both the incompatible and compatible combinations, indicating that TaCNGC13 The gene expression was induced by stripe rust infection.

[0012] Further, silencing the plant disease-related TaCNGC13 Gene silencing sequences improve wheat resistance to stripe rust, wherein the silencing sequences are related to plant susceptibility TaCNGC13 The gene is from nucleotides 109 to 315 from the 5' end.

[0013] Specifically, the present invention is to TaCNGC13 Analysis of the stripe rust resistance of genetically modified wheat revealed that, under the infection of stripe rust fungi CYR31, CYR32, CYR33, and CYR34, a large number of spores were observed on the leaves of all treated Fielder plants, while TaCNGC13 Genetic wheat T3 line TaCNGC13 Stably silenced strains 9 and TaCNGC13 The number of summer spores on the leaves of the stable silenced strain 21 wheat was significantly reduced, and the area of ​​chlorosis and necrosis increased, indicating that the transgenic TaCNGC13 The resistance of genetically modified wheat to stripe rust was significantly improved. TaCNGC13 The relative expression of the gene was always 20%-40% of the control, and the biomass of stripe rust was significantly reduced, indicating that the transgenic TaCNGC13 The genetically modified wheat showed strong resistance to the infection of stripe rust fungi CYR31, CYR32, CYR33 and CYR34.

[0014] In another aspect, the present invention claims a method for breeding wheat varieties resistant to stripe rust, which silences plant disease-related genes in plants. TaCNGC13 Genes, the plant disease related TaCNGC13 The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0015] Furthermore, the method for breeding wheat stripe rust resistant varieties provided by the present invention comprises constructing a silencing vector, transforming the silencing vector into Agrobacterium, and infecting wheat plants with the Agrobacterium carrying the recombinant vector to obtain the wheat stripe rust resistant variety. The silencing vector comprises a silencing sequence and an empty vector, and the silencing sequence is a plant disease-related TaCNGC13 The gene is from nucleotides 109 to 315 from the 5' end, and the empty vector is an RNAi vector.

[0016] Those skilled in the art can easily adopt known methods, such as directed evolution and point mutation, to modify the plant disease susceptibility related genes of the present invention. TaCNGC13 Genes are mutated. Those artificially modified genes have the properties related to plant disease susceptibility isolated by the present invention. TaCNGC13 Nucleotides with 75% or higher nucleotide sequence identity of the gene, as long as they encode plant disease susceptibility-related TaCNGC13 proteins and have the same function, are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.

[0017] The term "identity" as used herein refers to sequence similarity to a naturally occurring nucleic acid sequence. "Identity" includes sequences related to the plant susceptibility of the present invention. TaCNGC13The nucleotide sequence of a gene has a nucleotide sequence with 75% or more, or 85% or more, or 90% or more, or 95% or more identity. Identity can be evaluated with the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0018] The above-mentioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0019] The present invention also provides a plant disease-related TaCNGC13 Recombinant vector, expression cassette or recombinant bacteria of the gene.

[0020] In the present invention, the expression cassette refers to a gene that can express a plant disease-related protein as shown in SEQ ID NO: 1 in a host cell. TaCNGC13 The DNA of the gene may include not only a promoter for initiating transcription of the polynucleotide shown in SEQ ID NO: 1, but also a promoter for terminating the plant disease-related gene shown in SEQ ID NO: 1. TaCNGC13 The terminator of gene transcription. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters; tissue, organ and development-specific promoters and inducible promoters. Suitable transcription terminators include, but are not limited to, Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminators.

[0021] In the present invention, the recombinant vector containing the expression cassette can be constructed with the existing expression vector. The plant expression vector includes vectors that can be used for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1305, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA company), etc. The plant expression vector can also include the 3' end non-translated region of the foreign gene, i.e., include polyadenylic acid signal and any other DNA fragments that participate in mRNA processing or gene expression. The polyadenylic acid signal can guide polyadenylic acid to be added to the 3' end of the mRNA precursor, such as the non-translated region transcribed at the 3' end of Agrobacterium crown gall induction (Ti) plasmid gene (such as nopaline synthase gene Nos), plant gene (such as soybean storage protein gene) all have similar functions. When using the gene construction plant expression vector of the present invention, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The source of the translation control signal and the start codon is extensive and can be natural or synthetic. The translation initiation region can come from a transcription initiation region or a structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic marker genes (such as nptII gene that confers resistance to kanamycin and related antibiotics, bar gene that confers resistance to the herbicide phosphinothricin, hph gene that confers resistance to the antibiotic hygromycin, dhfr gene that confers resistance to methotrexate, EPSPS gene that confers resistance to glyphosate), or chemical resistance marker genes (such as herbicide resistance genes), mannose-6-phosphate isomerase gene that provides the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker genes can be added, and transformed plants can be directly screened by adversity.

[0022] The above-mentioned vector or expression vector can be a plasmid, cosmid, phage or virus vector.

[0023] The microorganisms may be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0024] The above transgenic plant cell lines do not include propagation materials.

[0025] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages: (1) The present invention cloned a plant disease-related gene from the wheat variety Shuiyuan 11 TaCNGC13 A gene, the nucleotide sequence of which is shown in SEQ ID NO: 1, This The amino acid sequence of the gene encoding protein is shown in SEQ ID NO: 2. TaCNGC13 The gene is induced to express by stripe rust. TaCNGC13 Gene expression profiles in wheat-rust interaction revealed TaCNGC13 The gene was up-regulated in the early stage of infection after inoculation in both the incompatible and compatible combinations, indicating that TaCNGC13 The gene expression was induced by stripe rust infection.

[0026] (2) Silencing plant disease susceptibility-related genes TaCNGC13 Genes improve wheat resistance to stripe rust. TaCNGC13 Analysis of the stripe rust resistance of genetically modified wheat revealed that, under the infection of stripe rust fungi CYR31, CYR32, CYR33, and CYR34, a large number of spores were observed on the leaves of all treated Fielder plants, while TaCNGC13 Genetic wheat T3 line TaCNGC13 Stably silenced strains 9 and TaCNGC13 The number of summer spores on the leaves of the stable silenced strain 21 wheat was significantly reduced, and the area of ​​chlorosis and necrosis increased, indicating that the transgenic TaCNGC13 The resistance of genetically modified wheat to stripe rust was significantly improved. TaCNGC13 The relative expression of the gene was always 20%-40% of the control, and the biomass of stripe rust was significantly reduced, indicating that the transgenic TaCNGC13 The genetically modified wheat showed strong resistance to the infection of stripe rust fungi CYR31, CYR32, CYR33 and CYR34. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 for TaCNGC13 Analysis of gene expression profiles in the interaction between wheat and stripe rust. “**” indicates that compared with 0h, p <0.01 level of significance.

[0028] Figure 2 For transfer TaCNGC13 Figure 1 shows the PCR identification results of the T3 generation of genetic wheat lines. Figure 2 A in TaCNGC13 Figure 9 shows the PCR identification results of the stable silenced strain 9; Figure 2 B in TaCNGC13 Figure 3 shows the PCR identification results of the stable silenced strain 21.

[0029] Figure 3 For transfer TaCNGC13Figure 1 shows the results of identification of resistance to stripe rust in genetic wheat T3 generation lines. Figure 3 A in the figure is the phenotype diagram 14 days after inoculation of stripe rust physiological races CYR31, CYR32, CYR33 and CYR34; Figure 3 B is 120h after inoculation of stripe rust physiological races CYR31, CYR32, CYR33 and CYR34 TaCNGC13 Relative expression of genes; Figure 3 C in the figure is the biomass analysis diagram of stripe rust 5 days after inoculation with stripe rust physiological races CYR31, CYR32, CYR33 and CYR34. DETAILED DESCRIPTION

[0030] The technical scheme of the present invention is now described in conjunction with the embodiments, but the present invention is not limited to the following embodiments. The experimental methods and detection methods described in the following embodiments are conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0031] Example 1 This embodiment provides TaCNGC13 Acquisition of gene and protein TaCNGC13.

[0032] Wheat seedlings that had grown normally for 7 days were taken, quickly frozen with liquid nitrogen, and stored at -80°C for later use. The total RNA of wheat leaves was extracted using the polysaccharide and polyphenol plant RNA extraction kit (purchased from Huayueyang Biotechnology Co., Ltd.), and reverse transcriptase XL (AMV) was used for the first-strand cDNA synthesis. The SMART method was used to synthesize cDNA, and the amplification primers were designed ( TaCNGC13 -F: 5'-ATGTCTAATAATCAGAAGTATGGTG-3'; TaCNGC13 -R: 5'-CATGTGGATCTTGGATTGCAGATAC-3'), PCR amplification was performed, and the PCR product was detected by 1.0% agarose gel electrophoresis. A PCR product of 2265 bp was obtained. After sequencing, the PCR product had the nucleotide sequence shown in SEQ ID NO: 1. The PCR product was named TaCNGC13 Gene. TaCNGC13 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO: 2, and is named plant disease susceptibility-related protein TaCNGC13.

[0033] Example 2 This embodiment provides TaCNGC13 Expression profiling of genes in the interaction between wheat and stripe rust.

[0034] Wheat was inoculated with stripe rust at the one-leaf and one-heart stage. The inoculation method was based on the reference "Discovery of a New Normal-Temperature Pathogenic Bacterial Strain of Lovelin 10" (Kang Zhensheng, Li Zhenqi). Wheat water source 11 leaves were inoculated with non-compatible race CYR23 or compatible race CYR31 to form a non-compatible and compatible interactive combination, and sterile water was inoculated as the control group. Samples were taken at 0h, 6h, 12h, 24h, 48h, 72h, 96h, and 120h after inoculation, and the sampling time point of the control group was consistent with that of the treatment group. When sampling, fresh leaves were cut, wrapped in tin-platinum paper, and quickly frozen in liquid nitrogen, and then stored at -80℃ for later use. The Trizol method (TianGen) was used to extract total RNA from wheat leaves, and reverse transcriptase XL (AMV) was used for first-strand cDNA synthesis. The SMART method was used to synthesize cDNA. According to the wheat TaCNGC13 elongation factor gene TaEF Specific reverse transcription-PCR primers were designed based on the sequence of

[0035] Before using the reverse transcription PCR primers, the specificity and amplification efficiency of the amplified product should be tested (≥90%). TaEF It was used as an internal reference gene in RT-PCR analysis. Real-time quantitative PCR amplification was performed using AceQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) and Bio-Rad CFX Manager quantitative PCR instrument (Bio-rad, Hercules, California) with cDNA from each treatment sampling point as template. Each reaction was repeated at least 3 times, and the Ct value of each repeat and its mean and standard deviation were generated by the quantitative PCR instrument by manually adjusting the baseline. Each reaction was repeated 3 times, and the Ct value was averaged. The experimental data were analyzed using the Delta Delta Ct method to determine TaCNGC13 The relative expression of genes is shown in Figure 1 shown.

[0036] The RT-PCR primer sequences are: TaCNGC13 -RT-F: 5'-ACCATCAGATGCGTAACAAATGTAG-3'; TaCNGC13 -RT-R: 5'-GCAGCTGCCTTCTTTCGCCTTTGAT-3'.

[0037] TaEF -RT-F: 5'-TGGTGTCATCAAGCCTGGTATGGT-3'; TaEF-RT-R:5'-ACTCATGGTGCATCTCAACGGACT-3'.

[0038] Depend on Figure 1 It can be seen that after the wheat water source 11 was inoculated with the non-compatible stripe rust race CYR23 or the compatible stripe rust race CYR31, TaCNGC13 The gene was up-regulated in the early stage of infection after inoculation in both the incompatible and compatible combinations, indicating that TaCNGC13 The gene expression was induced by stripe rust infection.

[0039] Example 3 This embodiment provides a TaCNGC13 Application of genetically modified wheat in improving plant resistance to stripe rust.

[0040] 1. Transfer TaCNGC13 Obtaining genetically modified wheat (1) Construction of silencing vector The amplified DNA in Example 1 TaCNGC13 Gene as template, using primer pair TaCNGC13 -414-F (AAAAAAGCAGGCTCCGCGGCCGCCTGATCGTTCATACACCTACTCAAG) and TACNGC13 -414-R (CAAGAAAGCTGGGTCGGCGCGCCCCCCAAAGGTCCAGAAATCCTCAAG), the target fragment was obtained, specifically TaCNGC13 The target fragment is connected to the RNAi vector through LR reaction to obtain the recombinant vector. TaCNGC13 -RNAi. The LR reaction system includes: TaCNGC13 -414 vector 2 μL, RNAi vector 1 μL, LR enzyme 1 μL, water 1 μL, LR reaction was connected at 25 °C for 8 h.

[0041] (2) Transfer TaCNGC13 Acquisition and PCR Verification of Genetically Modified Wheat Recombinant vector TaCNGC13 -RNAi was used to infect wild-type wheat Fielder callus with Agrobacterium tumefaciens to obtain T0 transgenic TaCNGC13 Genetic wheat. Cultivation of T0 generation transgenic TaCNGC13 Genetic wheat until the T3 generation TaCNGC13 Two genetic wheat lines ( TaCNGC13 Stably silenced strains 9 and TaCNGC13 Stably silenced strain 21).

[0042] The T3 transgenic TaCNGC13The genomic DNA of leaves of two transgenic wheat lines and wild-type control wheat (Fielder) was used to design primers F (TTTAGCCCTGCCTTCATACG) and R (CACGCAAGTCCGCATCTTCA) for molecular detection of transgenic T3 plants. Water was used as a blank control, and 10 plants were randomly selected from each line. The test results are shown in Figure 2 shown.

[0043] Depend on Figure 2 It can be seen that T3 generation TaCNGC13 The molecular detection results of genetically modified wheat showed obvious bands in the positive lines, indicating that the T3 generation of transgenic wheat TaCNGC13 Two genetic wheat lines ( TaCNGC13 Stably silenced strains 9 and TaCNGC13 Stable silencing lines 21) were all positive lines.

[0044] 2. Transfer TaCNGC13 Analysis of resistance to stripe rust in genetically modified wheat The wild type wheat Fielder (material from the College of Plant Protection, Northwest Agriculture and Forestry University) and TaCNGC13 Stably silenced strains 9 and TaCNGC13 Stable silenced strain 21 was planted in an incubator at 25 / 23°C (day temperature / night temperature) with a 16-h light / 8-h dark photoperiod. After the second leaf was expanded, it was inoculated with stripe rust physiological races CYR31, CYR32, CYR33, and CYR34, respectively. The inoculation method was based on the reference "Discovery of a New Normal Temperature Pathogenic Strain of Lovelin 10" (Kang Zhensheng, Li Zhenqi). The disease phenotype was observed 14 days after inoculation ( Figure 3 A in the figure), 120h after inoculation, leaves at the inoculation site were taken as samples to extract RNA, and the RT-PCR detection method in Example 2 was used for detection. TaCNGC13 The relative expression of genes ( Figure 3 B in the figure). The stripe rust biomass was detected 5 days after inoculation. The detection method was based on the Stripe Rust Effector PstGSRE1 Disrupts Nuclear Localization of ROS-Promoting Transcription Factor TaLOL2 to Defeat ROS-Induced Defense in Wheat. The results are shown in Figure 2. Figure 3 As shown in C.

[0045] Depend on Figure 3 As shown in A, a large number of spores were observed on the leaves of all treatments of the control Fielder plants under the infection of stripe rust fungi CYR31, CYR32, CYR33, and CYR34, while TaCNGC13 Stably silenced strains 9 andTaCNGC13 The number of summer spores on the leaves of the stable silenced strain 21 wheat was significantly reduced, and the area of ​​chlorosis and necrosis increased, indicating that the transgenic TaCNGC13 The genetically modified wheat has significantly improved resistance to stripe rust. Figure 3 From B, we can see that in the stable silencing wheat material TaCNGC13 The relative expression of the gene is always 20%~40% of the control. Figure 3 The C in the figure shows that the biomass of stripe rust in the stable silenced wheat material was significantly reduced. TaCNGC13 The genetically modified wheat showed strong resistance to the infection of stripe rust fungi CYR31, CYR32, CYR33, and CYR34.

[0046] As described above, the basic principle, main features and advantages of the present invention are well described. The above embodiments and descriptions are only descriptions of the preferred embodiments of the present invention, and the present invention is not limited by the above embodiments. Without departing from the spirit and scope of the present invention, various changes and improvements made by ordinary technicians in this field to the technical solution of the present invention should fall within the protection scope determined by the present invention.

Claims

1. Plant disease related TaCNGC13 A gene characterized by The plant disease related TaCNGC13 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. Plant disease susceptibility-related TaCNGC13 protein, characterized in that: The plant disease-related TaCNGC13 Genetic coding; The amino acid sequence of the plant disease susceptibility-related TaCNGC13 protein is shown in SEQ ID NO:

2.

3. Plant disease related TaCNGC13 The application of the gene in wheat stripe rust resistance is characterized in that: The plant disease related TaCNGC13 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

4. The use according to claim 3, characterized in that: The plant disease related TaCNGC13 The gene expression is induced by stripe rust.

5. The use according to claim 3, characterized in that: Silencing the plant disease-associated TaCNGC13 Genes improve wheat resistance to stripe rust.

6. The use according to claim 3, characterized in that: Silencing the plant disease-associated TaCNGC13 Silencing sequences of genes improves wheat resistance to stripe rust; The silencing sequence is related to plant disease susceptibility TaCNGC13 The gene is from nucleotides 109 to 315 from the 5' end.

7. A method for breeding wheat varieties resistant to stripe rust, characterized in that: Silencing plant disease-associated genes in plants TaCNGC13 Genes, the plant disease related TaCNGC13 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

8. The cultivation method according to claim 7, characterized in that: The method comprises constructing a silencing vector, transforming the silencing vector into Agrobacterium, and infecting wheat plants with the Agrobacterium carrying the recombinant vector to obtain the wheat stripe rust resistant variety.

9. The cultivation method according to claim 8, characterized in that: The silencing vector includes a silencing sequence and an empty vector; The silencing sequence is related to plant disease susceptibility TaCNGC13 The gene is from nucleotides 109 to 315 from the 5' end; The empty vector is an RNAi vector.

Images