Compositions, kits, and methods for detecting polymorphisms in human TPMT and NUDT15 genes

By designing specific primers and probes using ARMS primers and real-time PCR technology, and combining them with UNG enzyme treatment, the problems of long detection time, low sensitivity, and high cost of TPMT and NUDT15 gene polymorphism detection have been solved, achieving rapid, sensitive, and highly specific gene polymorphism detection.

CN119932178BActive Publication Date: 2025-11-14SECOND AFFILIATED HOSPITAL ZHEJIANG UNIV COLLEGE OF MEDICINE +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510275843.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-10
Publication Date
2025-11-14
Estimated Expiration
2045-03-10

AI Technical Summary

Technical Problem

Existing technologies for detecting TPMT and NUDT15 gene polymorphisms suffer from problems such as long detection time, low sensitivity, and high cost.

Method used

This invention provides a composition and kit for detecting polymorphisms in the human TPMT and NUDT15 genes. It employs ARMS primers and real-time PCR technology, designs specific primers and probes, and combines UNG enzyme treatment to prevent contamination, enabling rapid and accurate detection of gene polymorphisms.

Benefits of technology

It enables rapid, sensitive, and highly specific detection of gene polymorphisms, accurately identifying genomic DNA down to 0.5 ng/μL, reducing costs, and is suitable for various sample types and easy to operate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119932178B_ABST
    Figure CN119932178B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of gene detection technology, specifically providing a composition, kit, and method for detecting polymorphisms in the human TPMT and NUDT15 genes. The composition of this invention can detect polymorphisms at the rs1800462 (238G>C), rs1800460 (460G>A), and rs1142345 (719A>G) sites of the TPMT gene, and the rs116855232 (415C>T) site of the NUDT15 gene. The amplification arrest mutation system PCR (ARMS-PCR) detection technology can effectively distinguish between wild-type and mutant genes, offering advantages such as high sensitivity and specificity, applicability to various sample types, and short processing time and ease of operation. Using the composition and method of this invention, genomic DNA concentrations as low as 0.5 ng / μL can be detected.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, specifically relating to compositions, kits and methods for detecting polymorphisms in human TPMT and NUDT15 genes. Background Technology

[0002] Mercaptopurines are common immunomodulators, with 6-thioguanine (6-TG), 6-mercaptopurine (6-MP), and azathioprine (AZA) being the most widely used clinically. Mercaptopurines have good anti-proliferative and immunosuppressive effects, with clear efficacy and widespread clinical use. However, these drugs have a narrow therapeutic window, and their effects vary greatly among individuals, particularly regarding dose-dependent adverse reactions such as hepatotoxicity and bone marrow suppression. Studies have shown that azathioprine administration can cause bone marrow suppression (neutrophil count below 1.5 × 10⁻⁶). 9 The incidence of severe myelosuppression (neutrophil count less than 0.5 × 10⁹ / L) was 3%, and the incidence of severe myelosuppression (neutrophil count less than 0.5 × 10⁹ / L) was 3%. 9 The incidence of myelosuppression ( / L) is 0.9%, and the risk of death from myelosuppression is approximately 1%. These serious adverse reactions are closely related to the complex metabolism of thiopurine drugs and are the biggest obstacle limiting the clinical application of thiopurine drugs.

[0003] The efficacy and adverse reactions of azathioprine are closely related to the enzymes involved in its metabolic pathway, and multiple genes influence the expression of these enzymes. Among them, the genes that have a significant impact on drug metabolism include thiopurine methyltransferase (TPMT) and nucleotide pyrophosphatase (NUDT15). TPMT encodes thiopurine methyltransferase, which can methylate multiple products in the thiopurine metabolic pathway to produce 6-methylthiopurine, reducing the accumulation of the effective metabolite 6-thioguanine nucleotide, thereby reducing the incidence of myelotoxicity. The enzyme encoded by the NUDT15 gene can metabolize the toxic thiopurine metabolite 6-TGN, thereby mitigating toxicity. When TPMT and / or NUDT15 genes are mutated, it leads to the accumulation of 6-T(d)GTP, resulting in increased adverse reactions such as liver damage and myelosuppression. Among these, myelosuppression is not only the most common adverse reaction but also the leading cause of treatment discontinuation in patients.

[0004] Currently, some products exist that can detect the gene polymorphisms of both. For example, Chinese invention patent CN116855600A discloses a method to detect the rs1800460, rs1800462, and rs1142345 sites of the TPMT gene and the rs116855232 site of the NUDT15 gene. However, this method involves a long amplification cycle and requires setting a melting curve program, increasing sample detection time. Furthermore, heterozygous mutant samples are prone to insufficient Tm value discrimination or low template concentration, resulting in peak alignment and inaccurate Tm value determination. Chinese invention patent CN111235264A also discloses a detection method for the aforementioned sites, but it requires eight different fluorescent probes, increasing the cost of product development materials. Therefore, the field needs a product with high sensitivity, good specificity, low cost, and rapid detection that can more comprehensively detect gene polymorphisms related to the metabolism of mercaptopurine drugs. Summary of the Invention

[0005] The purpose of this invention is to overcome the problems of long detection time, low sensitivity, and high cost in the existing technology for TPMT and NUDT15 gene polymorphism detection.

[0006] Therefore, the present invention provides a composition for detecting polymorphisms in the human TPMT gene and NUDT15 gene, the composition comprising:

[0007] (1) Upstream primer for wild-type ARMS of TPMT gene 238 as shown in SEQ ID NO:1, downstream primer for TPMT gene 238 as shown in SEQ ID NO:3, and probe for TPMT gene 238 as shown in SEQ ID NO:4;

[0008] (2) Upstream primer of TPMT gene 238 mutant ARMS as shown in SEQ ID NO:2, downstream primer of TPMT gene 238 as shown in SEQ ID NO:3, and probe of TPMT gene 238 as shown in SEQ ID NO:4;

[0009] (3) Upstream primer for wild-type ARMS of TPMT gene 460 as shown in SEQ ID NO:5, downstream primer for TPMT gene 460 as shown in SEQ ID NO:7, and probe for TPMT gene 460 as shown in SEQ ID NO:8;

[0010] (4) Upstream primer of TPMT gene 460 mutant ARMS as shown in SEQ ID NO:6, downstream primer of TPMT gene 460 common as shown in SEQ ID NO:7, and probe of TPMT gene 460 common as shown in SEQ ID NO:8;

[0011] (5) Upstream primers for wild-type ARMS of TPMT gene 719 as shown in SEQ ID NO:9, downstream primers for TPMT gene 719 as shown in SEQ ID NO:11, and probes for TPMT gene 719 as shown in SEQ ID NO:12;

[0012] (6) Upstream primers for TPMT gene 719 mutant ARMS as shown in SEQ ID NO:10, downstream primers for TPMT gene 719 as shown in SEQ ID NO:11, and probes for TPMT gene 719 as shown in SEQ ID NO:12;

[0013] (7) Upstream primers for wild-type ARMS of NUDT15 gene 415 as shown in SEQ ID NO:13, downstream primers for NUDT15 gene 415 as shown in SEQ ID NO:15, and probes for NUDT15 gene 415 as shown in SEQ ID NO:16;

[0014] (8) The upstream primer of the NUDT15 gene 415 mutant ARMS as shown in SEQ ID NO:14, the downstream primer of the NUDT15 gene 415 as shown in SEQ ID NO:15, and the probe of the NUDT15 gene 415 as shown in SEQ ID NO:16.

[0015] Specifically, the above compositions exist in combination, wherein (1), (4), (5), and (8) form one group; and (2), (3), (6), and (7) form another group, wherein the fluorescent reporter groups of the probes in each group are different from each other.

[0016] Specifically, the fluorescent reporter group of the TPMT gene 238 common probe shown in SEQ ID NO:4 is FAM, and the quencher group is MGB; the fluorescent reporter group of the TPMT gene 460 common probe shown in SEQ ID NO:8 is VIC, and the quencher group is MGB; the fluorescent reporter group of the TPMT gene 719 common probe shown in SEQ ID NO:12 is ROX, and the quencher group is MGB; and the fluorescent reporter group of the NUDT15 gene 415 common probe shown in SEQ ID NO:16 is SX670, and the quencher group is MGB.

[0017] The present invention also provides a kit for detecting polymorphisms in the human TPMT gene and NUDT15 gene, comprising the above-described composition.

[0018] Specifically, in the above composition, (1), (4), (5), and (8) form one group; (2), (3), (6), and (7) form another group; the two groups exist in separate packages.

[0019] Specifically, the amount of primers used in the above composition is 0.2–0.3 μmol / L; the amount of probes used in the composition is 0.1–0.2 μmol / L.

[0020] Specifically, the kit also includes a nucleic acid amplification reaction solution; the components of the nucleic acid amplification reaction solution include tris(hydroxymethyl)aminomethane hydrochloride, magnesium chloride, potassium chloride, dNTP / dUTP, DNA polymerase, and uracil-N-glycosylation enzyme (UNG enzyme).

[0021] Specifically, the kits mentioned above also include negative and positive controls.

[0022] This invention also provides a method for detecting human TPMT and NUDT15 gene polymorphisms for non-disease diagnosis and treatment purposes, based on the above-described composition or kit, specifically comprising the following steps:

[0023] S1. Extract nucleic acid from the sample to be tested;

[0024] S2. Perform quantitative real-time PCR on nucleic acids using the described composition or kit;

[0025] S3. Obtain and analyze the results.

[0026] Specifically, the reaction procedure for the above-mentioned quantitative PCR amplification is as follows: the first stage is UNG enzyme treatment at 50℃ for 2 min; the second stage is pre-denaturation at 95℃ for 30 s; the third stage is denaturation at 95℃ for 10 s; annealing and extension at 56℃ for 30 s, for a total of 45 cycles, and the fluorescence signal is collected at 56℃.

[0027] The composition provided by this invention for detecting polymorphisms of the human TPMT gene and NUDT15 gene can detect polymorphisms at the rs1800462 (238G>C) site, rs1800460 (460G>A) site, rs1142345 (719A>G) site of the TPMT gene and the rs116855232 (415C>T) site of the NUDT15 gene.

[0028] ARMS primers are highly sensitive in distinguishing between wild-type and mutant genes, accurately detecting genomic DNA as low as 0.5 ng / μL. They are effective even for samples with long storage times and very low extraction concentrations. They also exhibit high specificity, showing no non-specific results for genomic DNA concentrations as high as 100 ng / μL. Compared to TaqMan probe typing, ARMS genotyping retains the high sensitivity and specificity of TaqMan while saving costs. ARMS primers are also quick, simple to synthesize, and have low synthesis costs, resulting in better amplification effects.

[0029] The amplification arrest mutant system PCR (ARMS-PCR) detection technology provided by this invention offers rapid detection speed, crisp and highly discriminative fluorescence PCR amplification curves, and eliminates the need for a program that does not collect fluorescence in the first few cycles. It can effectively distinguish between wild-type and mutant genes, is suitable for various sample types, and boasts advantages such as short detection time and ease of operation.

[0030] The present invention will now be described in further detail with reference to the accompanying drawings. Attached Figure Description

[0031] Figure 1 The amplification diagram of TPMT 719 heterozygous and NUDT15415 wild-type EDTA anticoagulated whole blood samples provided by the present invention.

[0032] Figure 2 Amplification images of oral swab samples of wild-type TPMT and NUDT15415 heterozygous TPMT provided by the present invention.

[0033] Figure 3 This is an amplification diagram of the positive control for the composition provided by the present invention.

[0034] Figure 4 Test results of the sensitivity of the composition provided by the present invention. Detailed Implementation

[0035] The technical solutions of the present invention will be clearly and completely described below with reference to embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Although representative embodiments of the present invention have been described in detail, those skilled in the art should understand that various modifications and changes can be made to the present invention without departing from the scope of the present invention. Therefore, the scope of the present invention should not be limited to the embodiments, but should be defined by the appended claims and their equivalents.

[0036] This invention provides a composition for detecting polymorphisms in the human TPMT and NUDT15 genes, the composition comprising:

[0037] (1) Detection of ARMS upstream primers for wild-type TPMT gene 238:

[0038] T238-FW:5'-TGTGTCCCCGGTCTGC-3' (SEQ ID NO.1);

[0039] (2) Detection of ARMS upstream primers for TPMT gene 238 mutant:

[0040] T238-FM: 5'-TGTGTCCCCGGTCTGG-3' (SEQ ID NO. 2);

[0041] (3) Common downstream primers and probes for detecting TPMT gene 238 wild-type and mutant types:

[0042] T238-R:5'-TATGCTTACTCTAATATAACCCTCTAT-3' (SEQ ID NO.3);

[0043] T238-P:5'-ACCTGCATAAAATCATACAT-3' (SEQ ID NO.4);

[0044] (4) Detection of the TPMT gene 460 wild-type ARMS upstream primer:

[0045] T460-FW:5'-GGATTGATGGCAAGTAATGC-3' (SEQ ID NO.5);

[0046] (5) Detection of ARMS upstream primers for the TPMT gene 460 mutant:

[0047] T460-FM:5'-GGATTGATGGCAACGAATGT-3' (SEQ ID NO.6);

[0048] (6) Common downstream primers and probes for detecting TPMT gene 460 wild-type and mutant types:

[0049] T460-R:5'-CTCTTTCTGGTAGGACAAATATTG-3' (SEQ ID NO.7);

[0050] T460-P:5'-CTCTATCCCAAATCATGTCA-3' (SEQ ID NO.8);

[0051] (7) Detection of ARMS upstream primers for TPMT gene wild-type 719:

[0052] T719-FW:5'-TGACTGTCTTTTTGAAAAGTGATA-3' (SEQ ID NO.9);

[0053] (8) Detection of ARMS upstream primers for the 719 mutant TPMT gene:

[0054] T719-FM: 5'-TGACTGTCTTTTTGAAAAGTTCTG-3' (SEQ ID NO. 10);

[0055] (9) Common downstream primers and probes for detecting TPMT gene 719 wild-type and mutant types:

[0056] T719-R:5'-CATTACATTTTCAGGCTTTAG-3' (SEQ ID NO. 11);

[0057] T719-P:5'-TGAGACATAGATAAAATAAAATCACACTG-3' (SEQ ID NO. 12);

[0058] (10) Detection of ARMS upstream primers for NUDT15 gene wild-type 415:

[0059] N415-FW:5'-AGCTCTTCTGGGGACTGC-3' (SEQ ID NO.13);

[0060] (11) Detection of ARMS upstream primers for the NUDT15 gene 415 mutant:

[0061] N415-FM:5'-CAGCTTTTTCTGGGGAATGT-3' (SEQ ID NO.14);

[0062] (12) Common downstream primers and probes for detecting NUDT15 gene wild-type and mutant 415:

[0063] N415-R:5'-ATTTCCTTTGTATCCCACCA-3' (SEQ ID NO.15);

[0064] N415-P: 5'-AAGAACAAGGCTATGATCCA-3' (SEQ ID NO. 16).

[0065] The primers described above were designed for three SNP sites of TPMT and one SNP site of NUDT15. The specific principle of primer and probe usage is as follows: wild-type and mutant ARMS primers and MGB probes were designed for the mutation sites, respectively. Combined with real-time quantitative PCR, genomic DNA extracted from human whole blood or oral swab samples was detected. The signal was collected by a real-time fluorescence PCR instrument, and the ΔCt values ​​of wild-type and mutant were calculated to determine the gene polymorphism of the tested samples.

[0066] Furthermore, among the primers and probes mentioned above, (1), (3), (5), (6), (7), (9), (11), and (12) form one group; and (2), (3), (4), (6), (8), (9), (10), and (12) form another group. By combining wild-type and mutant SNP sites, false negative results caused by missing samples can be effectively avoided.

[0067] Preferably, the fluorescent reporter groups of the four probes in one group are different from each other, and the fluorescent reporter groups of the four probes in another group are also different from each other.

[0068] In one specific implementation, as shown in SEQ ID NO:4, the fluorescent reporter group of the TPMT gene 238 common probe is FAM, and the quencher group is MGB; as shown in SEQ ID NO:8, the fluorescent reporter group of the TPMT gene 460 common probe is VIC, and the quencher group is MGB; as shown in SEQ ID NO:12, the fluorescent reporter group of the TPMT gene 719 common probe is ROX, and the quencher group is MGB; as shown in SEQ ID NO:16, the fluorescent reporter group of the NUDT15 gene 415 common probe is SX670, and the quencher group is MGB. Among these, SX670, as a substitute fluorescent group for CY5, can achieve a several-fold increase in fluorescence intensity.

[0069] The present invention also provides a kit for detecting polymorphisms in the human TPMT gene and NUDT15 gene, comprising the above-described composition. In the above composition, (1), (3), (5), (6), (7), (9), (11), and (12) constitute one group; (2), (3), (4), (6), (8), (9), (10), and (12) constitute another group; the two groups are packaged separately.

[0070] Preferably, the amount of primer used is 0.2–0.3 μmol / L; the amount of probe used is 0.1–0.2 μmol / L.

[0071] Furthermore, the kit also includes a nucleic acid amplification reaction solution; the components of the nucleic acid amplification reaction solution include tris(hydroxymethyl)aminomethane hydrochloride, magnesium chloride, potassium chloride, dNTPs / dUTPs, DNA polymerase, and UNG enzyme. Preferably, it includes 10–100 mmol / L tris(hydroxymethyl)aminomethane hydrochloride solution, 1–5 mmol / L magnesium chloride solution, 10–100 mmol / L potassium chloride solution, 1–5 mmol / L dNTPs / dUTPs, 5–10 U / μL DNA polymerase, and 0.1–2 U / μL UNG enzyme. By setting up an UNG enzyme + dUTP anti-contamination system, the UNG enzyme fully degrades any potential PCR product contamination, eliminating false positive results that may be caused by this, thereby ensuring the specificity and accuracy of the amplification.

[0072] Furthermore, the kit also includes a negative control and a positive control. The positive control contains a plasmid DNA mixture including eight SNP target sequences, as detailed below:

[0073] TPMT gene 238G plasmid sequence (SEQ ID NO:17):

[0074] GCTTTCCTGCATGTTCTTTGAAACCCTATGAACCTGAATTCATATAAATTCCTCTAAATTAAAGAAAATATATGCTTACTCTAATATAACCCTCTATTTAGTCATTTGAAACATAATTTAAGTGTAAATGTATGATTTTATGCAGGTTT GCAGACCGGGGACACAGTGTAGTTGGTGTGGAAATCAGTGAACTTGGGATACAAGAATTTTTTACAGAGCAGAATCTTTCTTACTCAGAAGAACCAATCACCGAAATTCCTGGAACCAAAGTATTTAAGGTTTGTTTTGATTTGGGTAAA

[0075] TPMT gene 238C plasmid sequence (SEQ ID NO:18):

[0076] GCTTTCCTGCATGTTCTTTGAAACCCTATGAACCTGAATTCATATAAATTCCTCTAAATTAAAGAAAATATATGCTTACTCTAATATAACCCTCTATTTAGTCATTTGAAACATAATTTAAGTGTAAATGTATGATTTTATGCAGGTTT CCAGACCGGGGACACAGTGTAGTTGGTGTGGAAATCAGTGAACTTGGGATACAAGAATTTTTTACAGAGCAGAATCTTTCTTACTCAGAAGAACCAATCACCGAAATTCCTGGAACCAAAGTATTTAAGGTTTGTTTTGATTTGGGTAAA

[0077] TPMT gene 460G plasmid sequence (SEQ ID NO:19):

[0078] CCTAATACCTTGACGATTGTTGAAGTACCAGCATGCACCATGGGGGACGCTGCTCATCTTCTTAAAGATTTGATTTTTCTCCCATAAAATGTTTTTTCTCTTTCTGGTAGGACAAATATTGGCAAATTTGACATGATTTGGGATAGAGGAGCATTAGTTGCCATCAATCCAGGTGATCGCAAATGGTAAGTAATTTTTCTTTTTTTGTTTAGCTGTCTTAATTTTTTAGTATACTATACTTTTTCTGGGTTCTAGAAAATCAGCTTAGACTTCTATGAGTTTGAAATAGGTTATTATGTT

[0079] TPMT gene 460A plasmid sequence (SEQ ID NO:20):

[0080] CCTAATACCTTGACGATTGTTGAAGTACCAGCATGCACCATGGGGGACGCTGCTCATCTTCTTAAAGATTTGATTTTTCTCCCATAAAATGTTTTTTCTCTTTCTGGTAGGACAAATATTGGCAAATTTGACATGATTTGGGATAGAGGA A CATTAGTTGCCATCAATCCAGGTGATCGCAAATGGTAAGTAATTTTTCTTTTTTTGTTTAGCTGTCTTAATTTTTTAGTATACTATACTTTTTCTGGGTTCTAGAAAATCAGCTTAGACTTCTATGAGTTTGAAATAGGTTATTATGTT

[0081] TPMT gene 719A plasmid sequence (SEQ ID NO:21):

[0082] AGAATCCCTGATGTCATTCTTCATAGTATTTTAACATGTTACTCTTTCTTGTTTCAGGTAAAATATGCAATATACGTTGTCTTGAGAAGGTTGATGCTTTTGAAGAACGACATAAAAGTTGGGGAATTGACTGTCTTTTTGAAAAGTTAT A TCTACTTACAGAAAAGTAAATGAGACATAGATAAAATAAAATCACACTGACATGTTTTTGAGGAATTGAAAATTATGCTAAAGCCTGAAAATGTAATGGATGAATTTTTAAAATTGTTTATAAATCATATGATAGATCTTTACTAAAAA

[0083] TPMT gene 719G plasmid sequence (SEQ ID NO:22):

[0084] AGAATCCCTGATGTCATTCTTCATAGTATTTTAACATGTTACTCTTTCTTGTTTCAGGTAAAATATGCAATATACGTTGTCTTGAGAAGGTTGATGCTTTTGAAGAACGACATAAAAGTTGGGGAATTGACTGTCTTTTTGAAAAGTTAT G TCTACTTACAGAAAAGTAAATGAGACATAGATAAAATAAAATCACACTGACATGTTTTTGAGGAATTGAAAATTATGCTAAAGCCTGAAAATGTAATGGATGAATTTTTAAAATTGTTTATAAATCATATGATAGATCTTTACTAAAAA

[0085] NUDT15 gene 415C plasmid sequence (SEQ ID NO:23):

[0086] AATTTTTTCTAAATATAGGTTAGCTTACCCAAATAAACACCCTTTGTTTTCTGTTATCTAAATAAATTGATTTAGCATCTTTCTTTTCTAGGTTGGGAGTGGGTTCCTTGGGAAGAACTACCTCCCCTGGACCAGCTTTTCTGGGGACTG CGTTGTTTAAAAGAACAAGGCTATGATCCATTTAAAGAAGATCTGAACCATCTGGTGGGATACAAAGGAAATCATCTCTAGGTGGCCGAGAAGATTTGATTTTCTTTAAAAAGACAAGAATAAGGTCTGGTTAGGGAATGAAAAATGTAT

[0087] NUDT15 gene 415T plasmid sequence (SEQ ID NO:24):

[0088] AATTTTTTCTAAATATAGGTTAGCTTACCCAAATAAACACCCTTTGTTTTCTGTTATCTAAATAAATTGATTTAGCATCTTTCTTTTCTAGGTTGGGAGTGGGTTCCTTGGGAAGAACTACCTCCCCTGGACCAGCTTTTCTGGGGACTG TGTTGTTTAAAAGAACAAGGCTATGATCCATTTAAAGAAGATCTGAACCATCTGGTGGGATACAAAGGAAATCATCTCTAGGTGGCCGAGAAGATTTGATTTTCTTTAAAAAGACAAGAATAAGGTCTGGTTAGGGAATGAAAAATGTAT

[0089] The underlined locations in the sequence are mutation sites.

[0090] Negative control: TE dilution.

[0091] This invention also provides a method for detecting human TPMT and NUDT15 gene polymorphisms for non-disease diagnosis and treatment purposes, based on the above-described composition or kit, specifically comprising the following steps:

[0092] S1. Extract nucleic acid from the sample to be tested;

[0093] Whole blood or oral swabs can be used as samples.

[0094] S2. Perform quantitative real-time PCR on nucleic acids using the described composition or kit;

[0095] The preferred reaction procedure for quantitative real-time PCR amplification is as follows: first stage: UNG enzyme treatment at 50℃ for 2 min; second stage: pre-denaturation at 95℃ for 30 s; third stage: denaturation at 95℃ for 10 s; annealing and extension at 56℃ for 30 s, for a total of 45 cycles, with fluorescence signals collected at 56℃.

[0096] S3. Obtain and analyze the results.

[0097] The nucleic acids of the samples to be tested were subjected to real-time PCR using wild-type primers and probes for each gene, as well as mutant primers and probes, and the corresponding CT values ​​were obtained. The gene polymorphism of the test samples was determined by calculating the ΔCt values ​​of wild-type and mutant samples.

[0098] The effects of the composition, kit, and method for detecting human TPMT and NUDT15 gene polymorphisms of the present invention are studied below through specific embodiments.

[0099] Example 1:

[0100] This embodiment designs specific upstream and downstream primers and probes based on the rs1800462 (238G>C) site, rs1800460 (460G>A) site, and rs1142345 (719A>G) site of the TPMT gene and the rs116855232 (415C>T) site of the NUDT15 gene, and provides compositions for detecting polymorphisms of the human TPMT gene and NUDT15 gene, including composition 1 and composition 2, the sequences of which are shown in Table 1.

[0101] Table 1 Primer and probe sequence list

[0102]

[0103]

[0104] Example 2:

[0105] This embodiment provides a kit for detecting polymorphisms in the human TPMT and NUDT15 genes, including the composition provided in Example 1, nucleic acid amplification reaction solution, negative control, and positive control.

[0106] The nucleic acid amplification reaction solution includes: 40 mmol / L tris(hydroxymethyl)aminomethane hydrochloride solution, 3 mmol / L magnesium chloride solution, 70 mmol / L potassium chloride solution, 2 mmol / L dNTP / dUTP, 5 U / μL DNA polymerase, and 0.2 U / μL UNG enzyme.

[0107] The positive control contains a plasmid DNA mixture including 8 SNP target sequences, as detailed below:

[0108] TPMT gene 238G plasmid sequence (SEQ ID NO:17):

[0109] GCTTTCCTGCATGTTCTTTGAAACCCTATGAACCTGAATTCATATAAATTCCTCTAAATTAAAGAAAATATATGCTTACTCTAATATAACCCTCTATTTAGTCATTTGAAAACATAATTTAAGTGTAAATGTATGATTTTATGCAGGTTT G CAGACCGGGGACACAGTGTAGTTGGTGTGGAAATCAGTGAACTTGGGATACAAGAATTTTTTACAGAGCAGAATCTTTCTTACTCAGAAGAACCAATCACCGAAATTCCTGGAACCAAAGTATTTAAGGTTTGTTTTGATTTGGGTAAA

[0110] TPMT gene 238C plasmid sequence (SEQ ID NO:18):

[0111] GCTTTCCTGCATGTTCTTTGAAACCCTATGAACCTGAATTCATATAAATTCCTCTAAATTAAAGAAAATATATGCTTACTCTAATATAACCCTCTATTTAGTCATTTGAAAACATAATTTAAGTGTAAATGTATGATTTTATGCAGGTTT C CAGACCGGGGACACAGTGTAGTTGGTGTGGAAATCAGTGAACTTGGGATACAAGAATTTTTTACAGAGCAGAATCTTTCTTACTCAGAAGAACCAATCACCGAAATTCCTGGAACCAAAGTATTTAAGGTTTGTTTTGATTTGGGTAAA

[0112] TPMT gene 460G plasmid sequence (SEQ ID NO:19):

[0113] CCTAATACCTTGACGATTGTTGAAGTACCAGCATGCACCATGGGGGACGCTGCTCATCTTCTTAAAGATTTGATTTTTCTCCCATAAAATGTTTTTTCTCTTTCTGGTAGGACAAATATTGGCAAATTTGACATGATTTGGGATAGAGGA GCATTAGTTGCCATCAATCCAGGTGATCGCAAATGGTAAGTAATTTTTCTTTTTTTGTTTAGCTGTCTTAATTTTTTAGTATACTATACTTTTTCTGGGTTCTAGAAAATCAGCTTAGACTTCTATGAGTTTGAAATAGGTTATTATGTT

[0114] TPMT gene 460A plasmid sequence (SEQ ID NO:20):

[0115] CCTAATACCTTGACGATTGTTGAAGTACCAGCATGCACCATGGGGGACGCTGCTCATCTTCTTAAAGATTTGATTTTTCTCCCATAAAATGTTTTTTCTCTTTCTGGTAGGACAAATATTGGCAAATTTGACATGATTTGGGATAGAGGA A CATTAGTTGCCATCAATCCAGGTGATCGCAAATGGTAAGTAATTTTTCTTTTTTTGTTTAGCTGTCTTAATTTTTTAGTATACTATACTTTTTCTGGGTTCTAGAAAATCAGCTTAGACTTCTATGAGTTTGAAATAGGTTATTATGTT

[0116] TPMT gene 719A plasmid sequence (SEQ ID NO:21):

[0117] AGAATCCCTGATGTCATTCTTCATAGTATTTTAACATGTTACTCTTTCTTGTTTCAGGTAAAATATGCAATATACGTTGTCTTGAGAAGGTTGATGCTTTTGAAGAACGACATAAAAGTTGGGGAATTGACTGTCTTTTTGAAAAGTTAT A TCTACTTACAGAAAAGTAAATGAGACATAGATAAAATAAAATCACACTGACATGTTTTTGAGGAATTGAAAATTATGCTAAAGCCTGAAAATGTAATGGATGAATTTTTAAAATTGTTTATAAATCATATGATAGATCTTTACTAAAAA

[0118] TPMT gene 719G plasmid sequence (SEQ ID NO:22):

[0119] AGAATCCCTGATGTCATTCTTCATAGTATTTTAACATGTTACTCTTTCTTGTTTCAGGTAAAATATGCAATATACGTTGTCTTGAGAAGGTTGATGCTTTTGAAGAACGACATAAAAGTTGGGGAATTGACTGTCTTTTTGAAAAGTTAT G TCTACTTACAGAAAAGTAAATGAGACATAGATAAAATAAAATCACACTGACATGTTTTTGAGGAATTGAAAATTATGCTAAAGCCTGAAAATGTAATGGATGAATTTTTAAAATTGTTTATAAATCATATGATAGATCTTTACTAAAAA

[0120] NUDT15 gene 415C plasmid sequence (SEQ ID NO:23):

[0121] AATTTTTTCTAAATATAGGTTAGCTTACCCAAATAAACACCCTTTGTTTTCTGTTATCTAAATAAATTGATTTAGCATCTTTCTTTTCTAGGTTGGGAGTGGGTTCCTTGGGAAGAACTACCTCCCCTGGACCAGCTTTTCTGGGGACTG C GTTGTTTAAAAGAACAAGGCTATGATCCATTTAAAGAAGATCTGAACCATCTGGTGGGATACAAAGGAAATCATCTCTAGGTGGCCGAGAAGATTTGATTTTCTTTAAAAAGACAAGAATAAGGTCTGGTTAGGGAATGAAAAATGTAT

[0122] NUDT15 gene 415T plasmid sequence (SEQ ID NO:24):

[0123] AATTTTTTCTAAATATAGGTTAGCTTACCCAAATAAACACCCTTTGTTTTCTGTTATCTAAATAAATTGATTTAGCATCTTTCTTTTCTAGGTTGGGAGTGGGTTCCTTGGGAAGAACTACCTCCCCTGGACCAGCTTTTCTGGGGACTG TGTTGTTTAAAAGAACAAGGCTATGATCCATTTAAAGAAGATCTGAACCATCTGGTGGGATACAAAGGAAATCATCTCTAGGTGGCCGAGAAGATTTGATTTTCTTTAAAAAGACAAGAATAAGGTCTGGTTAGGGAATGAAAAATGTAT

[0124] Negative control: TE dilution.

[0125] Example 3:

[0126] This embodiment, based on the kit provided in Embodiment 2, provides a method for detecting human TPMT and NUDT15 gene polymorphisms for non-disease diagnosis and treatment purposes, specifically including the following steps.

[0127] 1. Reagent preparation

[0128] Based on the number of samples to be tested, negative controls, and positive controls, the nucleic acid amplification reaction solution (9 μL / test) was thoroughly mixed with Composition 1 (9 μL / test) and Composition 2 (9 μL / test) from the primer and probe composition to form test reagent ① and test reagent ②. Test reagent ① and test reagent ② were dispensed into the corresponding PCR reaction tubes at a dispensing volume of 18 μL / well, with 2 wells constituting 1 test. After brief centrifugation, they were ready for use.

[0129] 2. Sample processing and loading

[0130] (1) In this embodiment, nucleic acid extraction reagents and nucleic acid extraction kits (magnetic bead method) from Wuhan Haijili Biotechnology Co., Ltd. were used to extract nucleic acid from EDTA anticoagulated whole blood and oral swabs respectively.

[0131] (2) Add the nucleic acid of the sample to be tested, the negative control, and the positive control to the corresponding two PCR reaction tubes in sequence at a rate of 2 μL / tube, for a total volume of 20 μL / tube. Tightly cap the PCR reaction tubes, invert them to mix, and centrifuge briefly at low speed to ensure that there are no droplets on the tube walls and no air bubbles in the liquid inside the tubes.

[0132] 3. PCR amplification and result analysis

[0133] (1) Place the PCR reaction tube in the real-time fluorescence quantitative PCR instrument and set up four fluorescence detection channels: FAM, VIC, ROX, and CY5.

[0134] (2) The reaction procedure for fluorescent PCR amplification is as follows: the first stage is UNG enzyme treatment at 50℃ for 2 min; the second stage is pre-denaturation at 95℃ for 30 s; the third stage is denaturation at 95℃ for 10 s; annealing and extension at 56℃ for 30 s, for a total of 45 cycles, and the fluorescence signal is collected at 56℃.

[0135] (3) After the reaction, the CT values ​​of each signal channel (FAM, VIC, ROX, CY5) in detection reagent ① and detection reagent ② were obtained, and the polymorphisms at sites 238, 460, 719 of the TPMT gene and site 415 of the NUDT15 gene in the test sample were determined according to the ΔCt values ​​of detection reagent ① and ② in each signal channel. The specific gene polymorphism detection results are shown in Table 2.

[0136] Table 2 Results of gene polymorphism detection

[0137]

[0138] Example 4:

[0139] This embodiment uses the same kit and method as in Example 3 to detect TPMT 719 heterozygous and NUDT15415 wild-type EDTA-anticoagulated whole blood samples. The amplification results of each detection channel are as follows: Figure 1 As shown in the figure, the composition of the present invention can effectively detect polymorphisms of the human TPMT and NUDT15 genes in whole blood samples.

[0140] Example 5:

[0141] This embodiment uses the same kit and method as in Example 3 to detect TPMT wild-type and NUDT15415 heterozygous oral swab samples. The amplification results of each detection channel are as follows: Figure 2 As shown in the figure, the composition of the present invention can effectively detect the polymorphisms of the human TPMT gene and NUDT15 gene in oral swab samples.

[0142] Example 6:

[0143] This embodiment uses the same kit and method as in Example 3 to detect the positive control plasmid. The positive control is a mixture of 8 plasmids containing four SNP sites, which does not require nucleic acid extraction. The amplification results of each detection channel are as follows: Figure 3 As shown in the figure, the composition of the present invention can effectively detect the positive control plasmid, indicating that the composition of the present invention can be used to detect polymorphisms in the human TPMT gene and NUDT15 gene.

[0144] Example 7:

[0145] In this embodiment, the same kit and method as in Example 3 were used to test 8 whole blood samples with unknown test results, and the results were compared with the Sanger sequencing results. The results are shown in Table 3.

[0146] Table 38 test results of whole blood samples

[0147]

[0148] As shown in Table 3, the detection results of the nucleic acid detection kit for TPMT and NUDT15 gene polymorphisms related to human mercaptopurine drug metabolism in this invention are completely consistent with the Sanger sequencing results of TPMT gene rs1800462 (238G>C), rs1800460 (460G>A), rs1142345 (719A>G), and NUDT15 gene rs116855232 (415C>T) sites, indicating high accuracy of the kit.

[0149] Example 8:

[0150] Nucleic acid was extracted from sample 6 in Example 7 using nucleic acid extraction reagent and diluted to a concentration of 0.5 ng / μL. Detection was performed using the same method as in Example 3, and the amplification results for each detection channel are as follows: Figure 4 As shown in the figure, when the nucleic acid concentration in the sample is 0.5 ng / μL, the composition of the present invention can still ensure the accuracy of detection.

[0151] The above examples are merely illustrative of the present invention and do not constitute a limitation on the scope of protection of the present invention. All designs that are the same as or similar to the present invention are within the scope of protection of the present invention.

Claims

1. A composition for detecting polymorphisms in the human TPMT and NUDT15 genes, characterized in that, The composition comprises: (1) The upstream primer of wild-type ARMS for TPMT gene 238 as shown in SEQ ID NO:1, the downstream primer for TPMT gene 238 as shown in SEQ ID NO:3, and the probe for TPMT gene 238 as shown in SEQ ID NO:4; (2) The upstream primer of the TPMT gene 238 mutant ARMS as shown in SEQ ID NO:2, the downstream primer of the TPMT gene 238 as shown in SEQ ID NO:3, and the probe of the TPMT gene 238 as shown in SEQ ID NO:4; (3) Upstream primers for wild-type ARMS of TPMT gene 460 as shown in SEQ ID NO:5, downstream primers for TPMT gene 460 as shown in SEQ ID NO:7, and probes for TPMT gene 460 as shown in SEQ ID NO:8; (4) The upstream primer of the TPMT gene 460 mutant ARMS as shown in SEQ ID NO:6, the downstream primer of the TPMT gene 460 as shown in SEQ ID NO:7, and the probe of the TPMT gene 460 as shown in SEQ ID NO:8; (5) Upstream primers for wild-type ARMS of TPMT gene 719 as shown in SEQ ID NO:9, downstream primers for TPMT gene 719 as shown in SEQ ID NO:11, and probes for TPMT gene 719 as shown in SEQ ID NO:12; (6) Upstream primers for TPMT gene 719 mutant ARMS as shown in SEQ ID NO:10, downstream primers for TPMT gene 719 as shown in SEQ ID NO:11, and probes for TPMT gene 719 as shown in SEQ ID NO:12; (7) The upstream primer of wild-type ARMS of NUDT15 gene 415 as shown in SEQ ID NO:13, the downstream primer of NUDT15 gene 415 as shown in SEQ ID NO:15, and the probe of NUDT15 gene 415 as shown in SEQ ID NO:16; (8) The upstream primer of the NUDT15 gene 415 mutant ARMS as shown in SEQ ID NO:14, the downstream primer of the NUDT15 gene 415 as shown in SEQ ID NO:15, and the probe of the NUDT15 gene 415 as shown in SEQ ID NO:

16.

2. The composition for detecting human TPMT and NUDT15 gene polymorphisms as described in claim 1, characterized in that: The composition exists in combination, wherein (1), (4), (5), and (8) form one group; and (2), (3), (6), and (7) form another group, wherein the fluorescent reporter groups of the probes in each group are different from each other.

3. The composition for detecting human TPMT and NUDT15 gene polymorphisms as described in claim 2, characterized in that: For example, the fluorescent reporter group of the TPMT gene 238 common probe shown in SEQ ID NO:4 is FAM and the quencher group is MGB; the fluorescent reporter group of the TPMT gene 460 common probe shown in SEQ ID NO:8 is VIC and the quencher group is MGB; the fluorescent reporter group of the TPMT gene 719 common probe shown in SEQ ID NO:12 is ROX and the quencher group is MGB; and the fluorescent reporter group of the NUDT15 gene 415 common probe shown in SEQ ID NO:16 is SX670 and the quencher group is MGB.

4. A kit for detecting polymorphisms in the human TPMT and NUDT15 genes, characterized in that, Includes the composition according to any one of claims 1-3.

5. The kit for detecting human TPMT and NUDT15 gene polymorphisms as described in claim 4, characterized in that: In the composition, (1), (4), (5), and (8) form one group; (2), (3), (6), and (7) form another group; the two groups are packaged separately.

6. The kit for detecting human TPMT and NUDT15 gene polymorphisms as described in claim 4, characterized in that: The amount of primers used in the composition is 0.2–0.3 μmol / L; the amount of probes used in the composition is 0.1–0.2 μmol / L.

7. The kit for detecting human TPMT and NUDT15 gene polymorphisms as described in claim 4, characterized in that: It also includes a nucleic acid amplification reaction solution; the components of the nucleic acid amplification reaction solution include tris(hydroxymethyl)aminomethane hydrochloride, magnesium chloride, potassium chloride, dNTP / dUTP, DNA polymerase, and uracil-N-glycosylation enzyme.

8. The kit for detecting human TPMT gene and NUDT15 gene polymorphism as described in claim 4, characterized in that: It also includes negative and positive controls.

9. A method for detecting human TPMT and NUDT15 gene polymorphisms for non-disease diagnosis and treatment purposes, characterized in that, Based on the composition according to any one of claims 1-3 or the kit according to any one of claims 4-8, the specific steps include: S1. Extract nucleic acid from the sample to be tested; S2. Perform quantitative real-time PCR on nucleic acids using the described composition or kit; S3. Obtain and analyze the results.

10. The method for detecting human TPMT and NUDT15 gene polymorphisms for non-disease diagnosis and treatment purposes as described in claim 9, characterized in that, The reaction procedure for the quantitative real-time PCR amplification is as follows: the first stage is UNG enzyme treatment at 50℃ for 2 min; the second stage is pre-denaturation at 95℃ for 30 s; the third stage is denaturation at 95℃ for 10 s, followed by annealing and extension at 56℃ for 30 s, for a total of 45 cycles; the fluorescence signal is collected at 56℃.

Citation Information

Patent Citations

  • Composition, kit and method for detecting polymorphism of human TPMT gene and NUDT15 gene

    CN111235264A

  • Primer probe combination and method for detecting single nucleotide polymorphism of mercaptopurine medication gene

    CN116855600A

  • TPMT (thiopurine S-methyltransferase) genetic polymorphism detection kit

    CN105316426A

  • Composition, kit and method for detecting polymorphism of human TPMT gene and NUDT15 gene

    CN116497109A