A salt-tolerant strain of Debaryomyces hansenii producing HDMF

Abstract

The present invention discloses a salt-tolerant strain of Debaryomyces hansenii that produces HDMF, belonging to the field of microbial technology. The present invention provides a safe strain of Debaryomyces hansenii, JLFsz001, which can tolerate high salt concentrations and ferment to produce HDMF under both salt-free and salt-stress conditions. The present invention applies Debaryomyces hansenii JLFsz001 to simulated soy sauce fermentation to produce HDMF, increasing the HDMF content in the fermentation system by 34.44%. This strain has significant potential for enhancing the flavor of fermented foods or condiments.

Description

Technical Field

[0001] The invention relates to a salt-tolerant Debaryomyces hansenii yeast producing HDMF, belonging to the technical field of microorganisms. Background Art

[0002] 4-Hydroxy-2,5-dimethyl-3(2H)-furanone (HDMF or DMHF), also known as furaneol, is also known as pineapple ketone or strawberry ketone, with a molecular formula of C6H8O3. HDMF combines the unique structural features of furan and ketone and is a natural flavoring ingredient with a strong caramel-like odor. It is widely distributed in fruits such as strawberries, pineapples, mangoes, and raspberries. HDMF has also been found in numerous products, including wine, coffee, beer, liquor, soy sauce, and cheese. It can also be isolated from certain insects and bacteria. Due to its low odor threshold of 160 μg / L and strong flavor-enhancing properties, HDMF is widely used in various industries, including food, beverages, tobacco, and cosmetics.

[0003] Although HDMF is widely present in natural products, its low content and high isolation and extraction costs make natural extraction methods unsuitable for mass production. Most HDMF currently available on the market is chemically synthesized, but the complex chemical synthesis process results in an impure aroma, low yield, and the presence of significant amounts of residual solvent, making it unsuitable for use in food, beverages, and other products. In contrast, biosynthesis is widely used in food production. Compared to chemically synthesized HDMF, biosynthesized HDMF offers a purer, richer aroma, making it irreplaceable. Therefore, the production of natural HDMF through microbial fermentation holds great promise.

[0004] Current research shows that most microorganisms that produce HDMF are Saccharomyces rouxii, while there are few studies on the production of HDMF using Debaryomyces hansenii, which limits the application of Debaryomyces hansenii in aroma production. Summary of the Invention

[0005] The present invention provides a strain of Debaryomyces hansenii ( Debaryomyces hansenii ) JLFsz001 was deposited in Guangdong Provincial Microbiological Culture Collection on October 25, 2024, with the deposit number GDMCC No: 65351.

[0006] In one embodiment, the Debaryomyces hansenii JLFsz001 was isolated from a fermented soybean paste sample from a factory in Guangdong. Based on colony morphology, 26S rDNA sequencing results and biochemical identification, the strain Debaryomyces hansenii was identified and named Debaryomyces hansenii JLFsz001.

[0007] The present invention also provides a microbial preparation containing the Debaryomyces hansenii JLFsz001.

[0008] In one embodiment, the microbial preparation contains living cells of Debaryomyces hansenii JLFsz001.

[0009] The present invention also provides a method for producing HDMF by fermentation using the Debaryomyces hansenii JLFsz001, wherein the Debaryomyces hansenii JLFsz001 is inoculated into a culture medium and fermented at 28-30°C.

[0010] In one embodiment, the culture medium further contains fructose.

[0011] In one embodiment, the culture medium further contains sodium chloride.

[0012] In one embodiment, the concentration of sodium chloride in the culture medium is 60 g / L to 180 g / L of sodium chloride.

[0013] In one embodiment, the method comprises: inoculating the activated Debaryomyces hansenii JLFsz001 into a seed culture medium for cultivation to obtain a seed liquid, and then transferring the seed liquid into a fermentation culture medium at a volume ratio of 5% for fermentation culture.

[0014] In one embodiment, the seed culture medium contains: 5 g yeast extract, 5 g tryptone, 10 g glucose, 5 g MgSO4·7 H2O, and 4 g KH2PO4.

[0015] In one embodiment, the seed solution is cultured at 28-30° C. and 150-250 rpm.

[0016] In one embodiment, the fermentation medium contains: 15 g / L casein peptone, 120 g / L fructose, 5 g / L MgSO4·7 H2O, and 4 g / L KH2PO4.

[0017] In one embodiment, the culture conditions of the fermentation medium are 30° C., 150 rpm and culture for 11 days.

[0018] In one embodiment, the fermentation medium is supplemented with D-fructose at a content of 120 g / L.

[0019] The present invention also provides the use of the Debaryomyces hansenii JLFsz001 or the microbial agent in preparing fermented seasonings.

[0020] In one embodiment, the condiment includes but is not limited to soy sauce.

[0021] The present invention also provides use of the Debaryomyces hansenii JLFsz001 or the microbial agent in the preparation of 4-hydroxy-2,5-dimethyl-3(2H)-furanone (HDMF).

[0022] Beneficial effects:

[0023] (1) The present invention screened and obtained a strain of Debaryomyces hansenii JLFsz001, which does not produce hemolysis and meets the food safety requirements.

[0024] (2) The Debaryomyces hansenii JLFsz001 provided by the present invention has strong salt tolerance and can tolerate a salt concentration of 18%, and can be used for the fermentation of condiments in a salty environment.

[0025] (3) The Debaryomyces hansenii JLFsz001 provided by the present invention has the ability to produce HDMF. The HDMF yield under no salt stress conditions is 25.56±0.33 mg / L; under 6%, 12%, and 18% salt stress conditions, the HDMF yields are 20.2±0.51 mg / L, 24.0±0.54 mg / L, and 20.57±0.3 mg / L, respectively.

[0026] (4) The Debaryomyces hansenii JLFsz001 provided by the present invention can effectively adapt to the fermentation environment of soy sauce mash and increase the HDMF content in the soy sauce mash. In a simulated soy sauce fermentation system, the HDMF content in the fermentation system can be increased by 34.44%.

[0027] Biomaterial Deposit

[0028] Debaryomyces hansenii ( Debaryomyces hansenii )JLFsz001, taxonomic name is Debaryomyces hansenii , was deposited in the Guangdong Provincial Microbiological Culture Collection Center on October 25, 2024, with the deposit number GDMCC No: 65351, and the deposit address is Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is the colony morphology of Debaryomyces hansenii JLFsz001.

[0030] Figure 2 This is a microscopic morphological image of Debaryomyces hansenii JLFsz001.

[0031] Figure 3 This is the phylogenetic tree of Debaryomyces hansenii JLFsz001.

[0032] Figure 4This is the result of the hemolysis experiment of Debaryomyces hansenii JLFsz001.

[0033] Figure 5 This is the extreme salt tolerance result of Debaryomyces hansenii JLFsz001.

[0034] Figure 6 This is the liquid chromatogram of HDMF standard.

[0035] Figure 7 is the standard curve of HDMF.

[0036] Figure 8 This is a liquid chromatogram of HDMF production by Debaryomyces hansenii JLFsz001.

[0037] Figure 9 This is the liquid chromatogram of HDMF production by Debaryomyces hansenii JLFsz001 under salt stress conditions.

[0038] Figure 10 This is a graph showing the production of HDMF by Debaryomyces hansenii JFsz001 under different fermentation times and salt concentrations; different lowercase letters indicate differences in HDMF content among groups at different fermentation times, and different uppercase letters indicate differences in HDMF content at different salt concentrations at the same time; different letters indicate significant differences in HDME content ( p <0.05).

[0039] Figure 11 This is the result of Debaryomyces hansenii JLFsz001 producing HDMF in a simulated soy sauce fermentation environment. DETAILED DESCRIPTION

[0040] Culture medium:

[0041] Potato dextrose agar (PDA) medium: 300.0 g potatoes, 20.0 g glucose, 15.0 g agar, 0.1 g chloramphenicol, add 1 L of sterile water, stir and heat to boil until completely dissolved, and autoclave at 121°C for 15 min.

[0042] YPD / YEPD medium: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose. If making solid medium, add 2% agar powder and autoclave at 121°C for 15 min.

[0043] Seed culture medium: 5 g yeast extract, 5 g tryptone, 10 g glucose, 5 g MgSO4·7H2O, 4 g KH2PO4, 1 L distilled water; autoclave at 121°C for 15 min.

[0044] Fermentation medium: casein peptone 15 g, fructose 120 g, MgSO4·7H2O 5 g, KH2PO4 4 g, sodium chloride, distilled water 1 L; autoclave at 121°C for 15 min.

[0045] Example 1: Isolation, purification and identification of strains

[0046] 1. Isolation of strains:

[0047] (1) Sample source: The mash samples were collected from a soy sauce brewery in Guangdong. After collection, the samples were sealed in sterile sampling bottles and refrigerated at 4°C for later use.

[0048] (2) Sample enrichment culture: Weigh 10 g of sauce mash sample into a sterilized Erlenmeyer flask, add 90 mL of sterile saline, and shake on a shaker for 30 min.

[0049] (3) Dilution and coating: Use sterile physiological saline to dilute the enriched mash sample to different gradient concentrations, and the concentration gradient is set to 10 -1 -10 -7 , isolate and culture the yeast. Take 0.1 mL of the diluted bacterial solution and evenly spread it on the surface of PDA solid culture medium. Use sterile distilled water as a blank and culture at 30℃ for 48-72 hours. Set up three replicates for each sample.

[0050] (4) Purification of strains: After obvious colonies have grown on the plate, observe the colony morphology and color on the plate, and mark and record the single colonies with typical yeast characteristics. Then use an inoculation loop to pick a single colony and streak the plate for continuous subculture 3-5 times until a pure single colony is obtained. The colony morphology of strain JLFsz001 is shown in Figure 1 .

[0051] 2. Identification of strains:

[0052] The purified strains were identified in terms of morphological characteristics, physiological and biochemical characteristics, and molecular biology.

[0053] The strain was spread on PDA agar medium and the morphological characteristics of the colonies were observed after 3 days of culture. The purified colonies were picked and prepared, and the smears were stained with Lu's alkaline methylene blue stain (1%). After about 3 minutes, the morphology and budding of the strain were observed using a low-power microscope and then a high-power microscope, and the dead and live cells were distinguished by color. After staining for 0.5 hours, the staining was repeated to observe whether there was an increase in dead cells. The microscopic examination results of strain JLFsz001 are shown in Figure 2 .

[0054] 3. Molecular biology identification:

[0055] (1) Based on the growth characteristics and origin of the strain, 26S rRNA was used for identification. The primers were:

[0056] NL 1:GCATATCAATAAGCGGAGGAAAAG;

[0057] NL 4: GGTCCGTGTTTCAAGACGG.

[0058] The PCR reaction system (20 μL in total) includes: 1 μL bacterial solution; 10 μL enzyme; 1 μL NL 1 primer; 1 μL NL 4 primer; and 7 μL ddH2O.

[0059] (2) Add the above amplification system to the PCR tube in sequence, centrifuge to mix, place in the PCR instrument, and amplify according to the following procedure:

[0060] Pre-denaturation at 98°C for 10 min, denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 20 s, 30 cycles; extension at 72°C for 20 min; end at 12°C ∞;

[0061] (3) Gel electrophoresis verification: After PCR amplification, 3 μL of PCR product was thoroughly mixed with 1 μL of 6× Loading Buffer, loaded onto a 1% agarose gel, and electrophoresed at a constant voltage of 150 V for 30 min. Using a 2 K marker as a reference, the yeast 26S rDNA target fragment was considered successful if its length was around 300 bp.

[0062] (4) Sequencing: The refrigerated PCR products were sent to Shanghai Bioengineering Co., Ltd. for sequencing.

[0063] The sequencing results were compared with the National Center for Biotechnology Information (NCBI) database using BLAST. Based on the comparison results, the 26S rDNA sequences of the relevant model strains were downloaded from NCBI and aligned using MEGA 11 software to construct a phylogenetic tree of the strains, as shown in the following example: Figure 3 As shown, the strain obtained by screening was identified as Debaryomyces hansenii ( Debaryomyces hansenii ), named Debaryomyces hansenii JLFsz001.

[0064] Example 2: Safety evaluation of strain JLFsz001

[0065] Spread the bacterial suspension stored at -20°C onto YPD liquid medium and incubate at 30°C for 48 hours. Once selectable colonies have grown on the plate, use an inoculating loop to streak a colony onto Columbia blood agar plates and incubate at 30°C for 48 hours. Observe strain JLFsz001 for hemolysis, using Staphylococcus aureus as a positive control.

[0066] The results are as follows Figure 4 As shown, the screened strain JLFsz001 grew normally on Columbia blood agar plate culture medium and the agar around the strain did not show green and no transparent circle appeared, indicating that no hemolysis occurred; while the positive control strain grew normally on Columbia blood agar plate culture medium and the agar around the strain showed green and a transparent circle appeared, indicating that the control strain had hemolysis; the safety experiment results showed that the screened strain JLFsz001 was not a hemolytic strain.

[0067] Example 3: Study on the physiological and biochemical characteristics of strain JLFsz001

[0068] Take the activated strain in the logarithmic growth phase and inoculate it into YPD liquid medium with a salt content of 12% to make the OD 600 nm = 0.6~0.8, culture at 30℃ with shaking for 48 h, and measure OD 600 nm The absorbance value at . The salt tolerance growth efficiency of the strain was calculated using the growth efficiency of the strain as the ordinate and the salt concentration as the abscissa. The experiment was set up in triplicate. The calculation formula is as follows:

[0069] Growth efficiency (%) = (absorbance of 12% salt concentration bacterial solution - absorbance of blank) / (absorbance of salt-free culture medium - absorbance of blank) × 100.

[0070] The growth efficiency of Debaryomyces hansenii JLFsz001 = (2.87-0.1) / (4.49-0.1) = 63.05±1.69%.

[0071] Example 4: Investigation of the ultimate salt tolerance concentration of strain JLFsz001

[0072] This experiment used a solid plate method to determine the salt tolerance threshold of strain JLFsz001. Using references from the literature with appropriate modifications, we investigated the salt tolerance threshold of Debaryomyces hansenii JLFsz001, which exhibits a certain degree of salt tolerance at 18%. YPD solid medium was prepared with salt concentrations ranging from 190 g / L to 360 g / L, increasing in a 30 g / L gradient. A culture of Debaryomyces hansenii JLFsz001 activated to the logarithmic phase was evenly spread on the medium and incubated at 30°C. The maximum salt concentration at which colonies formed and the time of their appearance were recorded for each strain, approximating the strain's salt tolerance threshold. Three replicates were set up.

[0073] The results showed that ( Figure 5 ), the strain was able to grow on plates with a salt concentration of 240 g / L.

[0074] Example 5: Detection of HDMF and establishment of standard curve

[0075] Accurately weigh 0.01 g of HDMF standard and dilute to volume with methanol in a 5 mL volumetric flask to prepare a 2 mg / L solution. Accurately measure appropriate amounts of this solution and dilute to prepare HDMF standard solutions at 1, 2, 4, 8, 10, 20, and 40 mg / L, respectively. Plot a standard curve between HDMF concentration and peak area.

[0076] Liquid chromatography conditions: analytical high-pressure liquid chromatography; UV detector; C18 liquid chromatography column (250 mm×4.6 mm, 5 μm); detection wavelength 285 nm; injection volume 20 μL; flow rate 1.0 mL / min.

[0077] The liquid chromatography results of HDMF standards are shown in Figure 6 , the standard curve of HDMF is shown in Figure 7 .

[0078] Example 6: Fermentation production of HDMF by strain JLFsz001

[0079] Fermentation was carried out as follows:

[0080] (1) Activation of bacterial strains and seed culture: The strain JLFsz001 stored in a -80℃ refrigerator was inoculated into a YPD liquid culture tube and cultured at 30℃ and 150 r / min for 48 h to obtain the OD 600 nm = 0.6~0.8, and then transfer it to a 30 mL seed culture medium, culture at 30℃ and 150 r / min for 24 h to obtain the seed solution.

[0081] (2) Fermentation culture: Take the activated strain in the logarithmic growth phase and transfer the seed liquid to the fermentation medium according to the inoculation volume of 5% to make the OD after inoculation 600 nm =0.6~0.8, culture at 30℃, 150 r / min for 11 days, and the liquid volume is 100 mL.

[0082] (3) Fermentation broth pretreatment: Take 2 mL of fermentation culture medium and place it in a centrifuge tube. Centrifuge it at 8000 r / min and 4°C for 10 min. Then filter the supernatant through a 0.45 μm filter membrane and analyze it.

[0083] The liquid chromatography results of HDMF produced by strain JLFsz001 are shown in Figure 8The results showed that the HDMF production of strain JLFsz001 after 23 days of fermentation was 34.09±0.2 mg / L.

[0084] Example 7: Fermentation production of HDMF under salt stress conditions

[0085] Fermentation was carried out as follows:

[0086] (1) Activation of bacterial strains and seed culture: The strain JLFsz001 stored in a -80℃ refrigerator was inoculated into a YPD liquid culture tube and cultured at 30℃ and 150 r / min for 48 h to obtain the OD 600 nm = 0.6~0.8, transfer it to the seed culture medium, culture at 30℃ and 150 r / min for 24 h, and the liquid volume is 30 mL.

[0087] (2) Fermentation culture: Take the activated strain in the logarithmic growth phase from the seed culture medium, inoculate the seed liquid into 100 mL of fermentation medium with salt contents of 0%, 60 g / L, 120 g / L, and 180 g / L respectively according to the inoculation volume of 5%, so that the OD after inoculation is 600 nm = 0.6-0.8, 30°C, 150 rpm shaking. During the incubation period, samples were collected for pretreatment and assayed on day 2, 5, 8, 11, 14, 17, and 23. Three replicates were used.

[0088] (3) Detection of HDMF content in fermentation broth: Take 2 mL of fermentation culture broth and place it in a centrifuge tube. Centrifuge it at 8000 r / min for 10 min. Then filter the supernatant through a 0.45 μm filter membrane and detect it on a centrifuge.

[0089] The liquid chromatography results of HDMF production by strain JLFsz001 under salt stress conditions are shown in Figure 9 The results of HDMF production by strain JLFsz001 under different fermentation times and salt stress conditions are shown in Figure 10 The results showed that strain JLFsz001 produced 29.6±1.2 mg / L of HDMF after 8 days of fermentation in a medium with a salt concentration of 60 g / L; 28.27±0.35 mg / L after 11 days of fermentation in a medium with a salt concentration of 120 g / L; and 29.34±0.55 mg / L after 23 days of fermentation in a medium with a salt concentration of 180 g / L.

[0090] Example 8: Fermentation of HDMF by strains in a simulated soy sauce fermentation system

[0091] The HDMF production in actual soy sauce brewing was studied using the soy sauce mash simulation strain JLFsz001 which was preserved and fermented for 30 days in the laboratory.

[0092] Preparation of simulated soy sauce fermentation system:

[0093] The simulated fermented soy sauce system was prepared by adding 18% brine and 120 g / L fructose to the mash fermented for 30 days in the laboratory at a ratio of 1:1.

[0094] The strain JLFsz001 was inoculated into a simulated soy sauce fermentation system containing 120 g / L fructose and fermented at 30°C for 23 days. An equal amount of pure culture medium was inoculated into a simulated soy sauce fermentation system containing 120 g / L fructose as a control. The HDMF content after 23 days of fermentation was measured. The results showed that ( Figure 11 ), strain JLFsz001 can increase the HDMF content in the fermentation system by 34.44%.

[0095] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. Debaryomyces hansenii ( Debaryomyces hansenii ) JLFsz001 was deposited in Guangdong Provincial Microbiological Culture Collection on October 25, 2024, with the deposit number GDMCC No: 65351.

2. A microbial preparation containing the Debaryomyces hansenii JLFsz001 according to claim 1.

3. The microbial preparation according to claim 2, characterized in that The microbial preparation contains living cells of the Debaryomyces hansenii JLFsz001.

4. A method for preparing 4-hydroxy-2,5-dimethyl-3(2H)-furanone by fermentation, characterized in that: The Debaryomyces hansenii JLFsz001 according to claim 1 was inoculated into a culture medium and fermented at 28-30°C.

5. The method according to claim 4, characterized in that The medium also contained D-fructose.

6. The method according to claim 4 or 5, characterized in that The medium also contained sodium chloride.

7. Use of the Debaryomyces hansenii JLFsz001 according to claim 1 or the microbial preparation according to any one of claims 2 to 3 in the preparation of a fermented seasoning.

8. The use according to claim 7, characterized in that The condiment includes soy sauce.

9. Use of the Debaryomyces hansenii JLFsz001 according to claim 1 or the microbial preparation according to any one of claims 2 to 3 in the preparation of 4-hydroxy-2,5-dimethyl-3(2H)-furanone.

Images