Cow low-temperature adaptability related molecular marker, screening method and application thereof

Abstract

The invention belongs to the technical field of animal molecular breeding, and relates to a cattle low-temperature adaptability related molecular marker, a screening method and application thereof. Specifically, a cattle high-density SNP chip is utilized to carry out genetic typing on cattle varieties in different regions, two genomic selection signal analysis methods of FLK and hapFLK are integrated, genomic selection signals among cattle in different temperature regions or in the cattle varieties are compared, regions subjected to strong selection and positive selection genes are identified, and a CRISPR / cas9 gene knockout mouse model is utilized to verify the function of the HSPA12B gene. According to the method, a functional gene and molecular markers (g.51906414T > C, g.51910621A > G and g.51913699G > A) suitable for low temperature are screened out. According to the invention, a new target is provided for analyzing a molecular mechanism adapted to cattle at low temperature, a scientific basis and a simple and rapid detection method are provided for screening and cultivating special cattle varieties with low-temperature resistance, and meanwhile, a new reference is provided for cultivating new low-temperature-resistant varieties of other livestock and poultry.

Description

Technical Field

[0001] The invention belongs to the technical field of animal molecular breeding, and relates to a molecular marker related to low temperature adaptability of cattle, a screening method and application thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Cattle are one of the most important domestic animals in my country. After thousands of years of natural and artificial selection, a variety of local cattle breeds adapted to the local environment of my country have been domesticated. For example, Yanbian cattle and Mongolian cattle in the low-temperature areas of the north, and Tibetan cattle in the high-altitude areas are all unique low-temperature resistant local cattle breeds in my country and are extremely valuable genetic resources. Studies have shown that cattle need to consume a lot of energy to maintain core body temperature in severe cold climates (Qi et al., 2015). If they are in a state of cold stress, their metabolism will accelerate, urination and defecation will increase, production performance will be significantly reduced, and immune response will be impaired (Liu et al., 2023). The lower the temperature, the higher the risk of death of cattle (Morignat et al., 2015). In the face of increasingly extreme climate change and frequent extreme cold waves, studying the molecular mechanisms of cattle's low-temperature adaptation can reduce the economic losses caused by extreme cold weather to cattle farming, and at the same time make important contributions to the genetic improvement of modern cattle breeds.

[0004] Tens of thousands of years of climate change have produced different selection pressures in the adaptive evolution of animals. These selection pressures will leave selection marks such as reduced genetic polymorphism and linkage disequilibrium in the genome of animals, which are called genomic selection signals. Some research teams have used genome-wide association studies (GWAS) based on cattle cold adaptation to identify genes that may be related to cattle adaptation to cold environments (Igoshin et al., 2019; Huang et al., 2023). However, the strategy of mining genes related to cold adaptation using technologies such as GWAS relies heavily on phenotypes, especially the phenotypic records of local cattle breeds are often incomplete or even missing, which poses a major challenge to the identification of target genes. In contrast, the genomic selection signal analysis strategy does not require strict reliance on phenotypic data to identify genes related to the target trait. This strategy is more convenient and reliable for mining genes from an evolutionary perspective. Common genomic selection signal analysis methods are mainly based on allele frequency spectra, linkage disequilibrium, population differentiation, and genomic heterozygosity.

[0005] Adaptation to low temperature environment is a complex biological process. Mammals in low temperature areas usually have long hair and thick fat layers, especially hypertrophic fat layers, which provide animals with sufficient energy to resist the cold. Adipose tissue can be divided into two categories: one is white adipose tissue (WAT) that stores energy in the form of triglycerides, and the other is brown adipose tissue (BAT) that can maintain the body's core temperature through non-shivering heat production (Cheng et al., 2021). Brown-like adipocytes are present in the subcutaneous adipose tissue at the tail root, perirenal and groin of newborn calves such as Angus cattle, Brahman cattle and Chinese Holstein cattle, and low temperature causes the volume of adipocytes to shrink and the degree of browning of fat to deepen (Smith et al., 2004; Cao et al., 2017). After cold exposure, the volume of subcutaneous adipocytes in adult Jinjiang cattle decreased, and the expression levels of browning-specific genes (UCP1, PRDM16 and PGC-1α) and lipolysis regulator (HSL) increased significantly (Li et al., 2023). The above evidence shows that fat browning and heat production are indispensable physiological activities for cattle to cope with low temperature environments. Summary of the invention

[0006] In view of the above problems, the present invention provides a molecular marker related to low temperature adaptability of cattle, a screening method and its application. Specifically, the present invention performs genotyping on local cattle DNA samples based on the Illumina BovineHD 777K SNP gene chip, integrates two genomic selection signal analysis methods of FLK and hapFLK, compares and analyzes the genomic selection signals between cattle breeds in high and low temperature areas and within cattle breeds, identifies regions and genes subject to strong positive selection, and uses a gene knockout mouse model to verify gene function, thereby screening functional genes adapted to low temperature environments and their related molecular markers. Based on the above research results, the present invention is completed.

[0007] Specifically, the present invention is achieved through the following technical solutions:

[0008] The first aspect of the present invention provides a molecular marker related to low temperature adaptability of cattle, including the HSPA12B gene (NCBI: AC_000170.1) and single nucleotide polymorphic sites located on the HSPA12B gene (NCBI: AC_000170.1), which are g.51906414T>C, g.51910621A>G, and g.51913699G>A respectively.

[0009] The second aspect of the present invention provides a primer for detecting molecular markers related to low temperature adaptability of cattle, the primer comprising an upstream primer and a downstream primer.

[0010] The third aspect of the present invention provides a detection kit, which at least comprises the above-mentioned primers.

[0011] A fourth aspect of the present invention provides the use of the above-mentioned primers or detection kit in screening cattle individuals with the ability to adapt to low temperatures.

[0012] A fifth aspect of the present invention provides a method for molecular markers related to low temperature adaptability of cattle, the method at least comprising:

[0013] Genotyping of individual cattle DNA samples using SNP chips;

[0014] Based on FLK and hapFLK genomic selection signal analysis;

[0015] Identify genetic variants under positive selection and regions of differential selection;

[0016] Candidate genes and SNP markers were screened based on the candidate gene screening strategy.

[0017] In the sixth aspect of the present invention, there is provided the use of the above-mentioned molecular markers, primers or detection kits in the selection and breeding of cold-resistant cattle breeds and genetic improvement.

[0018] One or more of the above technical solutions have the following beneficial technical effects:

[0019] The above technical solution specifically targets the genetic characteristics of low temperature adaptation of cattle breeds, selects local cattle breeds distributed in the south or north from the three perspectives of genome evolution, selection and adaptation, divides high and low temperature zones according to the local annual average temperature, integrates multi-genomic selection signal analysis methods, and efficiently and accurately screens the key gene HSPA12B and related molecular markers for low temperature adaptation. The method is reasonably designed, and the detection method designed based on key genes and molecular markers is easy to operate and has high accuracy.

[0020] The above method can effectively screen out cattle individuals with low temperature adaptability, which is of great significance for the selection and breeding of cold-resistant cattle breeds in low-temperature areas and genetic improvement. The present invention provides a high-quality technical solution for the cultivation of characteristic germplasm resources, which can greatly shorten the breeding time, and also provides a practical technical solution for the cultivation of other new livestock and poultry breeds, which has great practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. The embodiments of the present invention are described in detail below in conjunction with the accompanying drawings, wherein:

[0022] Figure 1 This is the selection signal of the HSPA12B gene region of 25 local cattle breeds in Example 1 (FLK analysis results).

[0023] Figure 2 This is the selection signal of the HSPA12B gene region of 25 local cattle breeds in Example 1 (hapFLK analysis results).

[0024] Figure 3 This is the PCR sequencing detection result of the SNP (g.51910621A>G) of the cold adaptation candidate gene HSPA12B in Example 1.

[0025] Figure 4 This is the result of electrophoresis detection of PCR products for screening cold adaptation candidate gene HSPA12B knockout mice in Example 1.

[0026] Figure 5 These are the western blot results of the HSPA12B protein expression levels in various tissues of wild-type mice in Example 1.

[0027] Figure 6 These are the western blot results of HSPA12B protein levels in the interscapular brown adipose tissue (iBAT) of wild-type mice treated at 10°C and 22°C in Example 1.

[0028] Figure 7 The results of monitoring the body temperature of wild-type mice and HSPA12B knockout mice subjected to short-term treatment at 10°C for 72 hours in Example 1.

[0029] Figure 8 The results of body temperature monitoring of wild-type mice and HSPA12B knockout mice treated at 10°C for 28 days in Example 1.

[0030] Fig. 9 The weight results of wild-type mice and HSPA12B knockout mice after treatment at 10°C and 22°C in Example 1.

[0031] Fig.10 These are the weights and body weight percentages of brown adipose tissue (iBAT), subcutaneous adipose tissue (sWAT) and epididymal adipose tissue (eWAT) of wild-type mice and HSPA12B knockout mice after treatment at 10°C and 22°C in Example 1.

[0032] Fig.11 These are the H&E staining results of brown adipose tissue (iBAT), subcutaneous adipose tissue (sWAT) and epididymal adipose tissue (eWAT) of wild-type mice and HSPA12B knockout mice treated at 10°C and 22°C in Example 1. DETAILED DESCRIPTION

[0033] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0034] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0035] As mentioned above, there are few studies on the molecular mechanism of cold adaptation in cattle. The cold adaptation process involves multi-level regulation of the body, and the specific mechanism is relatively complex. Currently, there is no screening method for cold-adaptive cattle breeds.

[0036] In view of this, in a typical embodiment of the present invention, a molecular marker related to low temperature adaptability of cattle is provided, including HSPA12B gene (NCBI: AC_000170.1) and single nucleotide polymorphic sites located on HSPA12B gene (NCBI: AC_000170.1), which are g.51906414T>C, g.51910621A>G, and g.51913699G>A. Among them, g.51910621A>G has the strongest correlation with the low temperature adaptability trait of cattle, and is therefore most suitable as a molecular marker for low temperature adaptability of cattle.

[0037] In another specific embodiment of the present invention, a primer for detecting molecular markers related to low temperature adaptability of cattle is provided, wherein the primer comprises an upstream primer and a downstream primer.

[0038] In another specific embodiment of the present invention, a detection kit is provided, which at least comprises the above-mentioned primers. Furthermore, the detection kit may also include a sampling tool, a genomic DNA extraction reagent and / or a PCR reaction reagent, etc., which are not specifically limited here.

[0039] In another specific embodiment of the present invention, there is provided use of the above primers or detection kit in screening cattle individuals with the ability to adapt to low temperatures.

[0040] Specifically, the application method includes:

[0041] Extract blood DNA from different cattle individuals;

[0042] The primers or kit for detecting the molecular markers are used to identify the genotype of the markers and screen cattle individuals with low temperature adaptability.

[0043] In another specific embodiment of the present invention, a method for molecular markers related to low temperature adaptability of cattle is provided, the method at least comprising:

[0044] Genotyping of individual cattle DNA samples using SNP chips;

[0045] Based on FLK and hapFLK genomic selection signal analysis;

[0046] Identify genetic variants under positive selection and regions of differential selection;

[0047] Candidate genes and SNP markers were screened based on the candidate gene screening strategy.

[0048] In another specific embodiment of the present invention, direct sequencing of PCR products is used to perform genotyping on the cattle g.51910621 locus to screen cattle individuals having the low temperature adaptation molecular marker.

[0049] In another specific embodiment of the present invention, there is provided the use of the above-mentioned molecular markers, primers or detection kits in the selection and breeding of cold-resistant cattle breeds and genetic improvement.

[0050] Furthermore, the application is to screen cattle individuals or breeds that are adaptable to temperature (low temperature or high temperature).

[0051] The present invention will be further described in detail below in conjunction with specific embodiments. It should be noted that the specific embodiments are intended to explain the present invention rather than to limit it.

[0052] Example 1

[0053] 1. Collection of local cattle samples

[0054] A total of 337 cattle from 25 local breeds were selected and their blood genomic DNA was extracted. The cattle samples were divided into a high temperature adaptation group (annual average temperature > 18°C) and a low temperature adaptation group (annual average temperature < 10.5°C) according to the annual average temperature. The specific information of the cattle breeds is as follows:

[0055]

[0056] 2. Genotyping of DNA samples using SNP chips

[0057] Illumina BovineHD 777K high-density SNP chip was used to genotype DNA samples. The python program PEDDA_ROW was used to extract the genotype results from the genotype test result file Finalreport.txt. The SNPs data were filtered using Plink1.9 (http: / / zzz.bwh.harvard.edu / plink / plink2.shtml) software. First, SNPs on X, Y and mitochondrial chromosomes and SNPs that were not uniquely located to UMD3.1 were removed. SNPs with a SNP detection rate of less than 90% or a minimum allele frequency of less than 0.05 were removed. After filtering, the remaining autosomal SNPs were subjected to subsequent analysis.

[0058] 3. Analysis of FLK and hapFLK selection signals in the genome of cattle breeds in high and low temperature areas

[0059] The FLK and hapFLK genomic selection signal analysis methods were used to compare the selection signal values ​​corresponding to the SNPs of cattle in high (above 18℃) and low (below 10.3℃) temperature areas, respectively, to obtain differential selection signals. Taking Nelore as a distant population, the genotype data of 25 local breeds were analyzed using the FLK and hapFLK analysis methods, SNPs selection signals were collected, and whole genome and local genome regional evolutionary trees were constructed. Genes under positive selection in cattle breeds in low temperature areas were analyzed as candidate genes. The P value was calculated by fitting the whole genome standard normal distribution in R.

[0060] 4. Identification of genetic variation under positive selection and differential selection regions and screening of candidate genes and molecular markers

[0061] The FLK and hapFLK selection signal analysis methods were used to compare cattle herds in high and low temperature areas, and the top 0.1% of SNPs that were highly selected were screened, with a total of 182 candidate genes anchored. Among them, the HSPA12B gene is located on chromosome 13 (AC_000170.1:c51901882-51918896). Using the FLK and hapFLK selection signal analysis methods, three SNPs were screened, namely g.51906414T>C, g.51910621A>G, and g.51913699G>A, among which g.51910621A>G had the strongest selection signal value.

[0062] 5. Verification of positive selection signals in differentially selected regions

[0063] The selection status of 25 cattle breeds was analyzed using FLK and hapFLK selection signal analysis methods. The results showed that: in the FLK analysis ( Figure 1), HSPA12B gene was strongly positively selected in cattle breeds such as Yanbian cattle, Anxi cattle, Tibet cattle and Apaijiaza cattle in low temperature areas; in hapKLK analysis ( Figure 2 ), which is under strong positive selection in the Anxi cattle and Shigatse cattle breeds in low-temperature areas.

[0064] 6. SNP sequencing identification method of cold adaptation gene HSPA12B

[0065] (1) Twenty local cattle breeds from high and low temperature areas were selected, blood was collected and blood DNA was extracted.

[0066] (2) Design a pair of PCR primers to amplify the DNA fragment containing the target SNP (g.51910621) site.

[0067] SEQ ID NO.2:F:5'-CCTTGGAAACTTGTGCTGGA-3'

[0068] SEQ ID NO.3:R:5'-GTATCCCTTCTTGTGTCCTC-3'

[0069] (3) The PCR amplification system was 25ul, including 1.0ul (10μmol / L) of upstream primer, 1.0ul (10μmol / L) of downstream primer, 1μl (-50ug / L) of DNA template, 10.0μL of 2×Taq PCR Master Mix, and 9.5μL of ddH2O. The PCR amplification conditions were: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 30s, and this step was repeated for 35 cycles; 72℃ extension for 10min. The length of the target fragment obtained by amplification was 554bp, and the PCR product was detected by 1% agarose gel electrophoresis.

[0070] (4) The PCR products were directly sequenced and the sequence results were compared with the cattle HSPA12B gene sequence provided by the NCBI GenBank database. The SNP (g.51910621) loci of each sample were genotyped to screen individuals with A>G mutation. The homozygous genotype GG is the dominant genotype for low temperature adaptation, and this individual is a low temperature tolerant cattle individual ( Figure 3 ).

[0071] 7. Verification of the cold adaptation function of HSPA12B gene

[0072] (1) Using CRISPR / Cas9 gene editing technology to construct Hspa12b gene knockout mice, two pairs of guide RNA (gRNA) were designed and synthesized by a biological company for large-scale knockout of the Hspa12b gene:

[0073] SEQ ID NO.5: gRNA1: 5'-AGACAGGTGTCCCGCTAGGCTGG-3'

[0074] SEQ ID NO.6: gRNA2: 5'-TATGCGACTCATGCGTGAGATGG-3'

[0075] SEQ ID NO.7: gRNA3: 5'-TTTGCTAAGGGTCATAGGATGGG-3'

[0076] SEQ ID NO.8: gRNA4: 5'-AGTGGTGTCATAAGGGATAGAGG-3'

[0077] Synthesize Cas9 mRNA and gRNA of Hspa12b gene and dilute to 100ng / uL and 50ng / uL, mix them in a volume ratio of 1:1, inject the RNA mixture into the fertilized egg of the mouse in the one-cell stage by microinjection technology, and then implant it into the oviduct of pseudo-pregnant mouse by embryo transplantation. After the mouse is born, extract the mouse tail DNA for gene detection to determine the effectiveness of gene knockout. The F0 generation heterozygotes of knockout mice are mated with wild-type mice of the same strain to obtain the F1 generation, and the F1 generation heterozygotes are mated to obtain the F2 generation homozygous knockout mice. The two pairs of primer sequences for detecting the effectiveness of mouse sequence knockout are:

[0078] SEQ ID NO.9: F1:5'-CACTTTGTACAGACCCACACATAA-3'

[0079] SEQ ID NO.10: R1:5'-TCATTCATAGCCTCACAGGACATC-3'

[0080] SEQ ID NO.11: F2:5'-GGAGGGGATGTTGAACTGTA-3'

[0081] SEQ ID NO.12: R2:5'-AGCAGGACTAACGGGAACTA-3'

[0082] The products after PCR amplification were detected by 1% agarose gel electrophoresis. The amplified products of F1 and R1 were 489 bp. If only the 489 bp product band was present, the mouse was determined to be a homozygous mutant knockout mouse. The amplified products of F2 and R2 were 729 bp. If only the 729 bp product band was present, the mouse was determined to be a wild-type mouse. If both of the above bands were present, the mouse was determined to be a heterozygous mutant knockout mouse ( Figure 4 ).

[0083] (2) Total protein was extracted from the heart, liver, spleen, lung, kidney, epididymal white adipose tissue (eWAT), inguinal subcutaneous adipose tissue (sWAT), and interscapular brown adipose tissue (iBAT) of wild-type mice, and the distribution of HSPA12B in each tissue was analyzed. The results showed that the protein was highly expressed in iBAT ( Figure 5 ). After 4 weeks of 10℃ cold treatment, the HSPA12B protein level in brown adipose tissue increased significantly ( Figure 6 ), indicating that the level of HSPA12B in brown adipose tissue of mice can be induced by low temperature.

[0084] (3) 8-week-old Hspa12b - / - The WT mice and mice were placed in 22℃ and 10℃ environments, respectively, and their core body temperatures were monitored and body temperature data were collected. The results showed that regardless of short-term ( Figure 7 ) or long term ( Figure 8 ) low temperature treatment, Hspa12b - / - All mice were able to maintain a relatively high basal body temperature, indicating that the deletion of the Hspa12b gene promoted the maintenance of the core body temperature of mice and made them more adaptable to low temperature environments.

[0085] (4) 8-week-old Hspa12b - / - The WT mice and the 22℃ and 10℃ mice were placed in the environment for 4 weeks and then killed. The weight of the mice decreased after Hspa12b gene deletion in the 22℃ environment. - / - The weight loss of mice was more significant ( Fig. 9 ). iBAT, sWAT, and eWAT tissues of mice were collected and weighed, and it was found that Hspa12b - / - The ratio of each fat tissue to body weight of mice was significantly lower than that of wild type ( Fig.10 ). The histomorphological results of the three types of adipose tissue showed that after low temperature induction, Hspa12b - / - The volume of fat cells in multiple parts of mice decreased, the number of intracellular lipid droplets increased, and the degree of browning increased significantly ( Fig.11 The above results indicate that Hspa12b plays an inhibitory role in the browning of adipose tissue. It should be pointed out that the expression level of Hspa12b gene in wild-type mice is increased by low temperature induction. Combined with the phenotype of mice after the gene is deleted, it can be speculated that Hspa12b is involved in regulating a body temperature balance mechanism in low temperature adaptation, that is, as the degree of low temperature-induced fat browning deepens, Hspa12b needs a higher expression level to inhibit browning, prevent excessive browning of adipose tissue, and thus maintain the body temperature balance.

[0086] Nucleotide sequences used in the present invention and their description

[0087] SEQ ID NO.1:

[0088] ATGTGGAGGGAGCAGAGAAAGGGGAAGGACAGTCCACATTCATGCAG GTCAAGTCCCCTGTATCTTTGGGGC A ATGACCCTTGGCTGTCTTTCCATATA GCCTCCCAGGCCCTGGTGAAGCCTGCTGATCCTCCATCC (sequence of the g.51910621A>G site in the HSPA12B gene on chromosome 13 of cattle, the site is located at the 73rd position (5'-3') of the sequence, and the 73rd nucleotide is A or G)

[0089] SEQ ID NO.2:

[0090] F: 5'-CCTTGGAAACTTGTGCTGGA-3' (primer F for amplifying the upstream nucleotide sequence of the bovine HSPA12B gene molecular marker)

[0091] SEQ ID NO.3:

[0092] R:5'-GTATCCCTTCTTGTGTCCTC-3' (primer R to amplify the upstream nucleotide sequence of the bovine HSPA12B gene molecular marker)

[0093] SEQ ID NO.4:

[0094] GTATCCCTTCTTGTGTCCTCAGCCCTAGCAACAGGCCCAGCGTGGCCTCAGCTGTGTGTGCTGACAAGCTGGGATGCCATTCAGCTCCTAGAAAGCTCTAAAGTCCTAGGGCCTTTGTGGCCTCAGATGGATGTGGAGGGAGCAGAGAAAGGGGAAGGACAGTCCACATTCATGCAGGTCAAGTCCCCTGTATCTTTGGGGC AATGACCCTTGGCTGTCTTTCCATATAGCCTCCCAGGCCCTGGTGAAGCCTGCTGATCCTCCATCCCAGTCTGAGTTGGGAGCTTTGGCATCTTCCACCTACAGGCTACAGTCTCACTAAGATACATTCAAAGGATCAGGGTCTTGAGGCCTGAAGGGAGGTATCTAACAAACGTTTTGTTCAAACAAAACTCAACAAACTTCATCAGAATGGATTTTTTCAAACAGCTCTTTCATGACAACTGTGTGACTTGTCAATTCAGCTAACCTCCCTAGTATTTCATTTGAGATGTTGAACCTAGGACTGCCTCAAGGAACCTACTACATAGAAATTCCAGCACAAGTTTCCAAGG (SEQ ID NO. 2 and SEQ ID NO. 3 primers amplified PCR product sequence, size 554 bp, g.51910621A>G site is located at the 203rd position of the sequence)

[0095] SEQ ID NO.5:

[0096] gRNA1: 5'-AGACAGGTGTCCCGCTAGGCTGG-3' (guide RNA (gRNA) sequence 1 for constructing HSPA12B knockout mice using CRISPR / Cas9 gene editing technology)

[0097] SEQ ID NO.6:

[0098] gRNA2: 5'-TATGCGACTCATGCGTGAGATGG-3' (guide RNA (gRNA) sequence 2 for constructing HSPA12B knockout mice using CRISPR / Cas9 gene editing technology)

[0099] SEQ ID NO.7:

[0100] gRNA3: 5'-TTTGCTAAGGGTCATAGGATGGG-3' (guide RNA (gRNA) sequence for constructing HSPA12B knockout mice using CRISPR / Cas9 gene editing technology 2)

[0101] SEQ ID NO.8:

[0102] gRNA4: 5'-AGTGGTGTCATAAGGGATAGAGG-3' (guide RNA (gRNA) sequence for constructing HSPA12B knockout mice using CRISPR / Cas9 gene editing technology 2)

[0103] SEQ ID NO.9:

[0104] F1: 5'-CACTTTGTACAGACCCACACATAA-3' (primer sequence F1 for detecting the effectiveness of mouse HSPA12B gene sequence knockout)

[0105] SEQ ID NO.10:

[0106] R1: 5'-TCATTCATAGCCTCACAGGACATC-3' (primer sequence R1 for detecting the effectiveness of mouse HSPA12B gene sequence knockout)

[0107] SEQ ID NO.11:

[0108] F2: 5'-GGAGGGGATGTTGAACTGTA-3' (primer sequence F2 for detecting the effectiveness of mouse HSPA12B gene sequence knockout)

[0109] SEQ ID NO.12:

[0110] R2: 5'-AGCAGGACTAACGGGAACTA-3' (primer sequence R2 for detecting the effectiveness of mouse HSPA12B gene sequence knockout)

[0111] SEQ ID NO.13:

[0112] CACTTTGTACAGACCCACACATAACATGCCTCGGCTATCACAGGACCACTGCCAAGGATCACTTGGTTGGGCTGAGAGAGCACAGCCTGCGGTGGCCCAGGATACAGCCAATCAGACCCACTGACAAGGGTCTTTGTGCCGGACCCCGCCACTTCTGTTGCCAGCCTTCCTAGCCCCATCCATTGATATCAGGGTCTCGGCACCATCCCATCACGCATGAGTCGCATAAGCCAAGCAGACAGCAGAGTGGGATAGAGAAGAGTTTGTGTCCACCCCTTTATACACCATGCGAACAATCACATCTGCATTTCCTGTTGGGCATTCCCAACAGGATTTCCATGGAGCTATGGGTAGGGAACAAGGACCCCTGTCTAGAAGTGGCAGCAAACAGCGGGGGCCAACCTGTGTCTCCTTCACCACCCACAGTGTGAACCTCGTGAAGTGGTCCTCACAGGGGATGCTCCG GATGTCCTGTGAGGCTATGAATGA (The sequence of the PCR product amplified by primers SEQ ID NO.9 and SEQ ID NO.10, with a size of 489bp)

[0113] SEQ ID NO.14:

[0114] GGAGGGGATGTTGAACTGTAGTCTTCCTGACCCTGTTCCTCTGGTACCCAGACACACTGCAGCTGTGCCCAGGCACTTTGTACAGACCCACACATAACATGCCTCGGCTATCACAGGACCACTGCCAAGGATCACTTGGTTGGGCTGAGAGAGCACAGCCTGCGGTGGCCCAGGATACAGCCAATCAGACCC ACTGACAAGGGTCTTTGTGCCGGACCCCGCCACTTCTGTTGCCAGCCTTCCTAGCCCCATCCATTGATATCAGGGTCTCGGCACCATCCCATCCTATGACCCTTAGCAAAACTTAACATGATGGTGGCTAGTGATTTGGTAGACAGGTGTCCCGCTAGGCTGGCCTTTCTGT CCCACAAGTGTTTGAGTCAAACCAGACCTGAGACCCTCCTGGAGACTGCTCTGCTTCCCAGCCCCGGCCTGGCCCTTCAGGGCGCTCTCAGAAACCCTCCTGCCCCCAGTGCTAATGTGAGTGTATGTGTGTGTGCTGAGACAGGAAATCAAAATTCCTGGTGCTGTGGATA TCCCGAGACACAGAGTTGGGCTGGGAGTAGGTGCTGCCTTCCCCTGGTCCTGTTTGTTCCTTTGGGGGGTGGGGAAGCTCCCTCAAGTCCTGATTAGGACCATGTGGCCCAACTTAATAGCAGAAAGGAACAGCCAGCCTCTGGGCCAAATGTCCCATGTCACAGCATCTG TAGTTCCCGTTAGTCCTGCT (SEQ ID NO.11 and SEQ ID NO.12 primers amplified the PCR product sequence, size 729bp)

[0115] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the above-described technical solutions can be modified or some of the technical features can be replaced by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A molecular marker related to low temperature adaptability of cattle, characterized in that: Including the single nucleotide polymorphism sites located in the HSPA12B gene (NCBI: AC_000170.1) and the HSPA12B gene, which are g.51906414T>C, g.51910621A>G, and g.51913699G>A.

2. The molecular marker associated with low temperature adaptability of cattle according to claim 1, characterized in that: The molecular marker related to cattle's low temperature adaptability is g.51910621A>G.

3. A primer for detecting the molecular marker related to low temperature adaptability of cattle according to claim 1 or 2, characterized in that: The primers include an upstream primer and a downstream primer; The upstream primer is the following a1) or a2): a1) a single-stranded DNA molecule shown in SEQ ID NO.2; a2) a DNA molecule in which one or more nucleotides of SEQ ID NO.2 are replaced and / or deleted and / or added and has the same function as SEQ ID NO.2; The downstream primer is the following a3) or a4): a3) a single-stranded DNA molecule shown in SEQ ID NO.3; a4) A DNA molecule in which one or more nucleotides in SEQ ID NO. 3 are substituted and / or deleted and / or added and which has the same function as SEQ ID NO.

3.

4. A detection kit, characterized in that: The detection kit at least comprises the primers according to claim 3.

5. The detection kit according to claim 4, characterized in that The detection kit also includes a sampling tool, a genomic DNA extraction reagent and / or a PCR reaction reagent.

6. Use of the primers according to claim 3 or the detection kit according to claim 4 in screening cattle individuals or breeds with low temperature adaptability.

7. The use according to claim 6, characterized in that The application methods include: Extract blood DNA from different cattle individuals; The primers or kit for detecting the molecular markers are used to identify the genotype of the markers and screen cattle individuals with low temperature adaptability.

8. A method for molecular markers related to low temperature adaptability of cattle, characterized in that: The method at least comprises: Genotyping of individual cattle DNA samples using SNP chips; Based on FLK and hapFLK genomic selection signal analysis; Identify genetic variants under positive selection and regions of differential selection; Candidate genes and SNP markers were screened based on the candidate gene screening strategy.

9. The method according to claim 8, characterized in that The PCR product direct sequencing method was used to genotype the cattle g.51910621 locus and screen cattle individuals with this cold adaptation molecular marker.

10. Use of the molecular marker according to claim 1 or 2, the primer according to claim 3 or the detection kit according to any one of claims 4 to 5 in the selection and breeding of cattle breeds and genetic improvement; Furthermore, the application is to screen cattle individuals or breeds that are adaptable to temperature (low temperature or high temperature).

Images