Application of SNP site in promoter region of IRS1 gene as molecular genetic marker for pig sexual maturity

CN119979718BActive Publication Date: 2026-06-05NAT ANIMAL HUSBANDRY TERMINAL +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NAT ANIMAL HUSBANDRY TERMINAL
Filing Date
2025-02-25
Publication Date
2026-06-05

Smart Images

  • Figure CN119979718B_ABST
    Figure CN119979718B_ABST
Patent Text Reader

Abstract

The application discloses application of an IRS1 gene promoter region SNP site as a pig sexual maturity molecular genetic marker. The present application takes the IRS1 gene promoter region as a research object, and studies the correlation between the IRS1 gene promoter region and sow sexual maturity by using molecular and cell biology methods: it is found that g.128307611C>A and g.128307308C>T are significantly correlated with the age of sexual maturity of Duhei pig populations; then, the influence of different genotypes of the above sites on the activity of the IRS1 gene promoter is studied by transfecting different vectors. Further, the sow ovarian granulosa cells are taken as experimental materials, and experimental techniques such as transcriptome sequencing, total iron colorimetry and malondialdehyde colorimetry are used to study the influence of the IRS1 gene on the transcription level and ferroptosis of the sow ovarian granulosa cells, and it is found that the IRS1 gene influences the different genes of the cell transcriptome, and is mainly enriched in signal pathways such as iron ion homeostasis, and inhibits the ferroptosis of the cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of cell engineering and genetic engineering technology, specifically involving the application of SNP sites in the promoter region of the IRS1 gene as molecular genetic markers for porcine sexual maturity. Background Technology

[0002] The first estrus and ovulation of an egg in a female mammal marks the animal's sexual maturity and reproductive capacity. The follicle is the basic structural and functional unit of the ovary. A single layer of flattened granulosa cells within the follicle proliferates and differentiates, eventually causing the follicle to mature and rupture, releasing follicular fluid and the oocyte. However, only a very small number of follicles develop to maturity and ovulate. During development, granulosa cells initiate programmed cell death, regulating follicle atresia and degeneration. When 10% of the granulosa cells in a follicle undergo apoptosis, the follicle is considered to have entered atresia. Single nucleotide polymorphisms (SNPs) refer to DNA sequence polymorphisms caused by mutations such as deletions, transitions, insertions, and transversions of a single nucleotide. They are third-generation molecular genetic markers. These biseleural molecular markers have advantages such as abundant loci, genetic stability, and ease of detection, allowing SNPs to provide greater information in the study of genetic variation in organisms. They can be used to analyze more complex genetic problems and are currently one of the most commonly used methods for assessing genetic polymorphism in biological populations.

[0003] The insulin receptor substrate protein family (IRS) consists of phosphorylated proteins involved in insulin signal transduction. Phosphorylated IRS proteins bind to the SH2 domains of other proteins, exhibiting different functions depending on the location of this domain within the protein structure. IRS1, as the most important representative of this protein family, is also an activator of the PI3K / AKT signaling pathway. miR-195 targets and binds to IRS1, downregulating its expression and inhibiting PI3K / AKT signal transduction, thereby promoting vascular endothelial cell senescence and leading to atherosclerosis. Overexpression of lncRNAPEG13 attenuates the inhibitory effect of ox-LDL (a lncRNAPEG13 inhibitor) on IRS1 and PI3K / AKT signaling, significantly enhancing HUVEC cell viability, promoting angiogenesis, and inhibiting cell senescence; however, knockdown of IRS1 reverses this effect. In studies on lung adenocarcinoma, IRS1 binding to FBXL16 increases IGF1 / AKT signaling, promoting lung cancer cell growth and migration. However, the association between the SNP site in the IRS1 gene promoter region and sow sexual maturation remains unreported. Summary of the Invention

[0004] In order to overcome the shortcomings and deficiencies of the prior art, one of the objectives of this invention is to provide SNP molecular markers related to sexual maturity in pigs.

[0005] The second objective of this invention is to provide the application of the aforementioned SNP molecular markers related to sexual maturity in pigs.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] SNP molecular markers associated with sexual maturity in pigs include at least one of the following SNP molecular markers:

[0008] (1) SNP site corresponding to the g.128307611 site on chromosome 15 of the pig reference genome Sscrofa11.1 (i.e., the promoter region of the pig insulin receptor substrate 1 (IRS1) gene -290bp) with C>A mutation;

[0009] (2) The SNP site corresponding to the g.128307308 site on chromosome 15 of the pig reference genome Sscrofa11.1 (i.e., 13bp of the promoter region of the pig insulin receptor substrate 1 (IRS1) gene) with C>T mutation.

[0010] The applications of the aforementioned SNP molecular markers related to porcine sexual maturity include at least one of the following applications:

[0011] A. Application in assessing the age of puberty in pigs;

[0012] B. Application in determining the onset of estrus in pigs;

[0013] C. Application in the selection and breeding of high-yielding pig breeds.

[0014] Furthermore, in application A, the genotype at locus g.128307611 is detected, and individuals with genotype CA have a shorter age at puberty than individuals with genotype CC and AA; and / or, the genotype at locus g.128307308 is detected, and individuals with genotype CC have a shorter age at puberty than individuals with genotype TT.

[0015] Furthermore, in application B, the genotype at locus g.128307611 is detected, and pigs with genotype CA start estrus faster than those with genotype CC and AA; and / or, the genotype at locus g.128307308 is detected, and pigs with genotype CC start estrus faster than those with genotype TT.

[0016] Furthermore, in the application C, the genotype at the g.128307611 locus is detected, and individuals with the genotype CA are selected as breeding pigs; and / or, the genotype at the g.128307308 locus is detected, and individuals with the genotype CC are selected as breeding pigs.

[0017] Furthermore, the pigs mentioned include any one of Duroc and its synthetic lines.

[0018] The above applications are for non-diagnostic purposes.

[0019] A primer for identifying the aforementioned SNP molecular markers associated with porcine sexual maturity includes:

[0020] F: 5′-ACGTCTCCGTAGCTCAAGTC-3′;

[0021] R: 5′-TCCCCCTGCCCAAGGATATT-3′.

[0022] Application of the IRS1 gene in regulating ferroptosis in porcine ovarian granulosa cells, wherein the application is any one or more of the following:

[0023] I. Application of IRS1 gene overexpression in inhibiting ferroptosis in ovarian granulosa cells in vitro;

[0024] II. Application of knocking down the IRS1 gene to promote ferroptosis in ovarian granulosa cells in vitro.

[0025] Furthermore, the overexpression of the IRS1 gene is achieved by the following method: ligating the nucleic acid molecule encoding the porcine IRS1 gene to the pcDNA3.1 plasmid to construct an overexpression vector; and then transfecting the overexpression vector containing the IRS1 gene into porcine ovarian granulosa cells cultured in vitro.

[0026] Furthermore, the knockdown of the IRS1 gene is achieved by transfecting siRNA, the siRNA sequence of which is as follows: IRS1-siRNA: 5′-GCCUAUGCCAGCAUCAGUUTT-3′.

[0027] The promotion or inhibition of ferroptosis is determined by measuring the total iron and malondialdehyde (MDA) content and comparing the mRNA and protein expression levels of pathway marker genes.

[0028] The verification results of this invention are as follows:

[0029] 1. Two SNP sites were discovered in the promoter region of the IRS1 gene.

[0030] 2. In the Duhei pig population, individuals with the CA genotype at the g.128307611C>A locus reached sexual maturity at a significantly earlier age than individuals with the CC and AA genotypes; individuals with the CC genotype at the g.128307308C>T locus reached sexual maturity at a significantly earlier age than individuals with the TT genotype.

[0031] 3. No potential transcription factor binding sites were predicted before the mutation of g.128307611C>A site, but it may bind to transcription factors RAP1 and C / EBPalp after the mutation; g.128307308C>T site may bind to transcription factors AP-2α and SP1 before and after the mutation.

[0032] 4. Compared with the control group wild-type WT-7611 cells, the IRS1 gene promoter activity of the mutant vector Mut-7611 group was not significantly different; the activity of the Mut-7308 group was significantly higher than that of the WT-7308 group.

[0033] 5. By transfecting sow ovarian granulosa cells with the overexpression vector at 1000 ng / mL, qRT-PCR was used to detect the expression level of IRS1. The results showed that transfection with pcDNA3.1-IRS1 had good transfection efficiency and significant differences. Subsequent studies selected 1000 ng / mL as the transfection concentration for pcDNA3.1-IRS1.

[0034] 6. Synthesize interfering IRS1 fragments / controls (IRS1-siRNA / siRNA-NC), screen and detect their interference efficiency. As shown in the attached figure, transfecting the gene interference fragment into sow ovarian granulosa cells and using qRT-PCR, the IRS1-siRNA fragment exhibits good interference effect and will be used for subsequent experiments.

[0035] IRS1-siRNA: 5′-GCCUAUGCCAGCAUCAGUUTT-3′;

[0036] 7. In the pcDNA3.1-IRS1 group, 331 genes were significantly upregulated and 31 genes were significantly downregulated. The differentially expressed genes are mainly involved in signaling pathways such as iron homeostasis, cell proliferation, and programmed cell death.

[0037] 8. 240 genes were significantly upregulated and 393 genes were significantly downregulated in the siRNA-IRS1 group. The differentially expressed genes are mainly involved in biological processes such as cell migration, epithelial cell differentiation, inorganic cation transmembrane transport and regulation of GTPase activity.

[0038] 9. Total iron ion levels decreased in the pcDNA3.1-IRS1 group and increased in the siRNA-IRS1 group, but neither group showed statistical significance.

[0039] 10. The MDA level in the pcDNA3.1-IRS1 group was not significantly different from that in the control group, while the MDA level in the siRNA-IRS1 group was significantly higher than that in the control group.

[0040] 11. Compared with the control group, overexpression of IRS1 significantly increased the mRNA and protein expression levels of the SLC7A11 gene and significantly decreased the mRNA and protein expression levels of the p53 gene; while knockdown of IRS1 significantly decreased the mRNA and protein levels of the SLC7A11 gene and significantly increased the mRNA expression level of the p53 gene, with no significant difference in protein expression levels. In conclusion, IRS1 can inhibit ferroptosis.

[0041] The present invention has the following advantages and effects compared with the prior art:

[0042] 1. This invention uses Duroc black pig ear-like tissue (Duroc × Country Black Pig) as experimental material and employs Sanger sequencing technology to discover SNP sites in the promoter region of the IRS1 gene, studying the relationship between SNP sites and the sexual maturity age of Duroc black pig populations. Combining trait association analysis and population genetic structure analysis, it was found that the g.128307611C>A site and the g.128307308C>T site are significantly associated with the sexual maturity age of Duroc black pig populations.

[0043] 2. This invention focuses on the two SNP sites mentioned above, employing molecular and cell biology methods to study their application in sow ovarian granulosa cells: potential transcription factor binding sites were predicted using bioinformatics websites; transfection of WT-7611, Mut-7611, WT-7308, and Mut-7308 vectors revealed no significant change in IRS1 gene promoter activity in the Mut-7611 group; however, cell activity in the Mut-7308 group was significantly higher than that in the WT-7308 group. This research has significant application value for studying the IRS1 gene promoter SNP sites and their impact on sow sexual maturation.

[0044] 3. This invention uses sow ovarian granulosa cells as experimental material and employs experimental techniques such as transcriptome sequencing, total iron colorimetry, malondialdehyde (MDA) colorimetry, qRT-PCR, and Western blotting to study the effects of the IRS1 gene on the transcriptional level and ferroptosis of sow ovarian granulosa cells. It was found that the IRS1 gene affects differentially expressed genes in the cell transcriptome, mainly enriching in signaling pathways such as iron ion homeostasis, and inhibiting ferroptosis.

[0045] 4. The technical solution of this invention is well-designed and the results are reliable. Attached Figure Description

[0046] Figure 1 This is a diagram showing the PCR amplification results of the IRS1 gene promoter region.

[0047] Figure 2 This is a diagram showing the effect of SNP sites on the promoter activity of the IRS1 gene.

[0048] Figure 3 This is a graph showing the efficiency of the overexpression vector pcDNA3.1-IRS1.

[0049] Figure 4 This is a graph showing the efficiency of the interfering fragment IRS1-siRNA.

[0050] Figure 5 This is a graph analyzing the effects of IRS1 gene overexpression / interference on the transcriptional level of porcine ovarian granulosa cells; where a and b represent the effects of IRS1 overexpression on the transcriptional level of sow ovarian granulosa cells; and c and d represent the effects of IRS1 interference on the transcriptional level of sow ovarian granulosa cells.

[0051] Figure 6 This is a graph showing the total iron ion level in porcine ovarian granulosa cells as determined by the total iron colorimetric assay for the effect of overexpression / interference with the IRS1 gene.

[0052] Figure 7 This is a graph showing the malondialdehyde (MDA) level in porcine ovarian granulosa cells as detected by a colorimetric assay using the malondialdehyde (MDA) assay.

[0053] Figure 8 This is a diagram showing the effect of IRS1 overexpression / interference on the key gene levels of the ferroptosis signaling pathway in porcine ovarian granulosa cells; where a is the effect of IRS1 overexpression / interference on the transcriptional level of key genes in the ferroptosis signaling pathway in sow ovarian granulosa cells; and b is the effect of IRS1 overexpression / interference on the protein expression level of key genes in the ferroptosis signaling pathway in sow ovarian granulosa cells. Detailed Implementation

[0054] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions. Unless otherwise stated, the reagents and raw materials used in the present invention are commercially available.

[0055] In this invention, statistical methods are applied to analyze the results of three independent experiments in each embodiment, and the "mean ± standard deviation" is calculated respectively. One-way ANOVA is used to analyze the significance of differences (in the figure, "*" indicates P<0.05, and "**" indicates P<0.01).

[0056] The test samples collected in the following examples were ear samples from Duroc and local black pigs (referred to as Duroc-Black pigs). The sampling location was at the Niujiaowan R&D Farm of Guangdong Yihao Food Co., Ltd., and all pigs were fed and managed according to the same standards.

[0057] This invention uses R language (v4.03) and a generalized linear model (GLM) to analyze the genetic association between SNPs and puberty. The model is as follows:

[0058] Yij=L+Gj

[0059] Where Yij is the observed age of puberty in the i-th animal, L is the mean age of puberty, and Gj represents the genotype effect. Different genotypes are encoded as dummy variables using categorical variable coding. Statistical data are expressed as mean ± standard deviation.

[0060] Example 1: DNA Extraction

[0061] This invention uses the traditional chloroform method to extract DNA from the sow genome. The specific steps are as follows:

[0062] (1) Tissue sample processing: Take about 0.2g of pig ear tissue sample and put it into a labeled 2ml centrifuge tube. Use sterile ophthalmic surgical scissors to thoroughly and evenly cut the ear sample into small pieces in the centrifuge tube.

[0063] (2) Tissue lysis and digestion: Add 1 ml of tissue lysis buffer to the centrifuge tube from step (1). Then, add 40 mL of 20 mg / ml proteinase K, immediately cap the centrifuge tube, and gently invert it several times to ensure that the proteinase K and tissue lysis buffer are thoroughly mixed. Place the centrifuge tube in a preheated 56°C water bath overnight for digestion until the ear-like tissue is completely dissolved.

[0064] (3) After the sample is completely digested, place it in a low-temperature centrifuge at 4℃ and centrifuge at 12000rpm for 10min.

[0065] (4) Take 950 μL of supernatant, add an equal volume of Tris saturated phenol, shake well for 10 min, and place in a low temperature centrifuge at 4℃ and centrifuge at 12000 rpm for 10 min.

[0066] (5) Take 900 μL of supernatant into a new 2 ml centrifuge tube, add 900 μL of phenol-form mixture of equal volume, shake well for 10 min, and centrifuge at 12000 rpm for 10 min in a low temperature centrifuge at 4℃.

[0067] (6) Take 850 μL of supernatant into a new 2 ml centrifuge tube, add 850 μL of phenol-form mixture of equal volume, shake well for 10 min, and centrifuge at 12000 rpm for 10 min in a low temperature centrifuge at 4℃.

[0068] (7) Take 800 μL of supernatant into a new 2 ml centrifuge tube, add 800 μL of phenol-form mixture of equal volume, shake well for 10 min, and centrifuge at 12000 rpm for 10 min in a low temperature centrifuge at 4℃.

[0069] (8) Take 750 μL of supernatant and quickly add 800 μL of pre-cooled anhydrous ethanol. Gently invert the mixture to mix until a white precipitate forms.

[0070] (9) Gently pick out the precipitated DNA precipitate with a pipette tip, transfer it to a 1.5ml centrifuge tube, add 800μL of 75% alcohol to rinse, and centrifuge at 12000rpm for 10min in a 4℃ low-temperature centrifuge.

[0071] (10) Remove excess alcohol, place in a clean bench fume hood, and open the centrifuge tube cap to ventilate for a moment. Add 200 μL of preheated Elution Buffer to 37°C and dissolve thoroughly by pipetting. Store in a -20°C refrigerator.

[0072] Experimental Example 2: RNA Extraction

[0073] The specific procedure for extracting RNA using Trizol as the lysis buffer is as follows:

[0074] (1) Treatment of adherent cells: Taking a 6-well plate as an example, add 500 μL of Trizol to each well, place the cell culture plate on ice and let it stand for 10-15 min, then use a pipette to detach the cells from the same treatment group and collect them together, place them in a 4°C low-temperature centrifuge at 12000 rpm for 5 min, and carefully transfer the supernatant to a new 1.5 mL RNase-free tube, without aspirating impurities;

[0075] (2) Mix chloroform and Trizol at a ratio of 1:5, add 1 mL of the mixed chloroform to the supernatant, shake to mix, then let stand on ice for 5 min, centrifuge at 12000 rpm for 5 min in a low temperature centrifuge at 4℃, and carefully transfer the upper aqueous phase to a new 1.5 mL RNase-free tube.

[0076] (3) Add 1 mL of a mixture of isopropanol and Trizol (isopropanol: Trizol = 1:2), gently invert and mix, let stand on ice for 10 min, centrifuge at 12000 rpm for 10 min in a 4℃ low-temperature centrifuge, and discard the supernatant.

[0077] (4) Add 1 mL of 75% ethanol-DEPC (75% ethanol:DEPC = 1:1) pre-cooled to 4℃, gently pipette the RNA precipitate, wash the RNA, and then centrifuge at 12000 rpm for 15 min in a 4℃ low-temperature centrifuge and discard the supernatant.

[0078] (5) Open the centrifuge tube lid and let the RNA dry at room temperature for 5-10 minutes to evaporate as much ethanol as possible, but also to prevent the RNA from precipitating and drying out excessively.

[0079] (6) Add 30 μL of DEPC water pre-cooled to 4°C to dissolve the RNA precipitate and store it in a -80°C freezer.

[0080] Example 3: Genomic DNA and RNA quality detection and concentration determination

[0081] (1) Detection of RNA and DNA integrity by agarose gel electrophoresis

[0082] Preparation of 1% agarose gel: Add 1×TAE buffer and agarose powder to an Erlenmeyer flask in the specified ratio, heat in a microwave oven for 3-5 minutes until completely dissolved, remove and cool briefly, add 1-3 μL of EB staining agent, gently shake well, pour into a plate, insert a comb, and let stand at room temperature for 30 minutes before use. Take 5 μL of the DNA or RNA solution to be tested, add 1 μL of 6×Loading Buffer and mix well. Place the 1% agarose gel in an electrophoresis tank for sample loading, and run the electrophoresis apparatus at 150V / cm for 25 minutes. After electrophoresis, observe the gel in a UV analyzer and take photos for storage. DNA samples should show only one band, and RNA samples should show three small RNA bands (28S, 18S, and 5S) with no obvious degradation traces before or after.

[0083] (2) Detection of genomic DNA concentration and purity

[0084] NanoDrop 2000 UV spectrophotometer (Thermo): Turn on the instrument and select the measurement type for double-stranded nucleic acid (DNA) or single-stranded nucleic acid (RNA). Pipette 1 μL of Elution Buffer to clean the detection base and press the Blank button for calibration. Gently wipe the base with qualitative filter paper and add 1 μL of the DNA or RNA sample to be tested. Press the Measure button to perform the measurement.

[0085] After measurement, clean the detection base with Elution Buffer and turn off the instrument. Acceptable DNA / RNA sample standards: A260 / A230 ratio between 1.8 and 2.2, and A260 / A280 ratio between 1.7 and 2.1.

[0086] Example 4: Cloning of the promoter region sequence of the porcine IRS1 gene

[0087] The promoter region sequence of the porcine IRS1 gene (Gene ID: 100512686) was searched in the NCBI database, and specific primers for cloning the IRS1 gene promoter sequence were designed. The primer sequences are as follows:

[0088] F: 5′-ACGTCTCCGTAGCTCAAGTC-3′;

[0089] R: 5′-TCCCCCTGCCCAAGGATATT-3′.

[0090] The promoter region of the IRS1 gene was amplified using extracted Duhei pig ear DNA as a template.

[0091] Example 5: Culture of granulosa cells from sow ovaries

[0092] (1) Ovaries of healthy commercial sows were collected from Kongwangji Slaughterhouse in Huangpu District, Guangzhou. Ovaries with a red and shiny surface, good health, normal development and moderate size were selected. They were stored in PBS containing 1% double antibiotics and kept at low temperature with ice packs around them. They were then quickly brought back to the cell culture room for subsequent experiments.

[0093] (2) Wash the sow ovaries 2-3 times with PBS containing 1% penicillin and antibiotics, then soak them in 75% alcohol for 30 seconds, and finally wash the ovaries with PBS containing 1% penicillin and antibiotics until the solution is clear and transparent. After sealing, quickly transfer them to the clean bench in the cell culture room for operation.

[0094] (3) Add 4 mL of DMEM culture medium to a 15 mL centrifuge tube, use forceps to pick up the ovary, use a disposable 1 mL sterile syringe to draw 1.5 mL of follicular fluid, inject it into the 15 mL centrifuge tube containing the prepared culture medium, centrifuge at 1000 rpm for 5 min, and discard the supernatant.

[0095] (4) Add 3 mL of PBS containing 2% penicillin and antibiotics to resuspend and wash the cells, centrifuge at 1000 rpm for 5 min, and discard the supernatant;

[0096] (5) Repeat the above steps once;

[0097] (6) Add 1 mL of complete culture medium and gently pipette to resuspend the cells. Seed them on a 75 cm incubator. 2 The cells were cultured in cell culture flasks in a 37°C, 5% CO2 cell culture incubator.

[0098] (7) After culturing for 48 hours, observe the cell adhesion using an inverted microscope, and change the medium or plate culture according to the growth status.

[0099] Example 6: Inoculation and Transfection of Recombinant Plasmids

[0100] 1. Inoculation and transfection of recombinant plasmids with mutant sites

[0101] (1) When the cell confluence reaches 70-80%, discard the old culture medium and wash the adherent cells 1-2 times with PBS containing 2% penicillin and antibiotics.

[0102] (2) Steps ② to ⑥ in the same passage culture process;

[0103] (3) Gently pipet on an appropriate amount of complete culture medium to resuspend the cells, inoculate an appropriate amount of cell suspension into a cell culture plate, gently shake to distribute the cells evenly, place in a 37℃, 5% CO2 incubator, observe after 24 hours, and conduct subsequent experiments based on their growth.

[0104] (4) Transfection can only be performed when the cell confluence reaches 70-80%;

[0105] (5) Press The instructions for kit 3000 specify the preparation of transfection reagents, including solution A: Opti-MEM and Lipofectamine. TM Mix 3000 thoroughly; Prepare solution B: Gently mix Opti-MEM, recombinant plasmid, pGL-TK plasmid and P3000, add solution A to solution B, gently pipette to mix, incubate at room temperature in the dark for 15 min, add to cell culture plate, and transfect (each treatment group needs at least 3 replicates). After transfection, incubate at 37℃ in a 5% CO2 incubator.

[0106] The pRL-TK plasmid was a commercially available plasmid obtained from the Guangdong Provincial Key Laboratory of Agricultural Animal Genomics and Molecular Breeding. The recombinant plasmids included wild-type and mutant vectors at the g.128307611C>A site, named WT-7611 and Mut-7611; and wild-type and mutant vectors at the g.128307308C>T site, named WT-7308 and Mut-7308. All were synthesized by Wuhan Jinkairui Biotechnology Co., Ltd., using the pGL3-basic base plasmid and KpnI and XhoI cloning sites. The target sequences are as follows:

[0107] WT-7611 target sequence: GTGCAACGTTGGGACTTGGCAGCTCGCCTCCCCCTGCCCAAGGATATTTAATTTGCCTCGGGAATCGCTACTTCCAGAGGGGAACTCAGGAGGGAAGGCGCGCGTGCCTGGAGGGGCAACGCGGGGACCCCCGGCCGCCGCCGC CTGCGCGCCGGACTCCAGCCCTGGCGGCGAGCGATGCATCTTCTCCTTCCCAGCCGCGGCGGCTGAGAAGAGATTTGGCTCCCCGAGGATCCCGGGCTGCACTCACGCCGGACGCGCTGCCTCCCCCCAGGGCATGAAACGCCAGTAAACTCCGG

[0108] Mut-7611 target sequence: GTGCAACGTTGGGACTTGGCAGCTCGCCTCCCCCTGCCCAAGGATATTTAATTTGCCTCGGGAATCGCTACTTCCAGAGGGGAACTCAGGAGGGAAGGCGCGCGTGCCTGGAGGGGCAACGCGGGGACCCCCGGCCGCCGCCGCCTGCGCGCCGGACTCCAGCCCTGGCGGCGAGAGATGCATCTTCTCTCCTTCCCAGCCGCGGCGGCTGAGAAGAGATTTGGCTCCCCGAGGATCCGGGCTGCACTCACGCCGGACGCGCTGCCTCCCCCCAGGGCATGAAACGCCAGTAAACTCCGG

[0109] WT-7308 target sequence: CAGCTGCTGCGTCCTCCCTCGGCTGCCCCTCCCCGGCGCGGAGGGCGGCGTGGATTTCGGAGTCGGGGTTTCTGCCGCCTCCAGCCCTGTTTGCATGTGCGGGGCCGCGGCGAGGAGCCTCCGCCCCCCACCCGGTTGTTTTTCGGCGCCTCCCTCTCCTCGGCGGCGGTGGCGGCGGCAGCATGGCGAGCCCTCCCGAGACGGATGGCTTCTCGGACGTGCGCAAGGTGGGCTACCTGCGCAAACCCAAGAGCATGCACAAGCGCTTTTTCG

[0110] Mut-7308 target sequence: CAGCTGCTGCGTCCTCCCTCGGCTGCCCCTCCCCGGCGCGGAGGGCGGCGTGGATTTCGGAGTCGGGGTTTCTGCCGCCTCCAGCCCTGTTTGCATGTGCGGGGCCGCGGCGAGGAGCCTCCGCCCCCCACCCGGTTGTTTTTCGGCGCCTCCCTCTCTTCGGCGGCGGTGGCGGCGGCAGCATGGCGAGCCCTCCCGAGACGGATGGCTTCTCGGACGTGCGCAAGGTGGGCTACCTGCGCAAACCCAAGAGCATGCACAAGCGCTTTTTCG。

[0111] (6) Conduct subsequent experiments according to the expected experimental plan.

[0112] 2. Inoculation and transfection with pcDNA3.1-IRS1 or IRS1-siRNA

[0113] When the confluence of porcine GCs reaches approximately 80%, discard the culture medium in the flask and wash twice with PBS containing 1% penicillin-streptomycin, then discard the PBS. Add 3 mL of trypsin to the flask, place it in a cell culture incubator for 5 minutes of digestion, and observe cell adhesion under a microscope. When most cells appear round and float with the liquid, digestion is complete. Add 4 mL of complete culture medium to stop digestion. After agitating the culture flask wall with a pipette tip, transfer the mixture in the flask to a 15 mL centrifuge tube and centrifuge at 1000 rpm for 5 minutes at room temperature. Discard the supernatant, wash twice with PBS containing 1% penicillin-streptomycin, then discard the supernatant. Add 3 mL of complete culture medium to resuspend the cells and seed them into cell culture plates. Gently shake in a cross pattern to mix, then incubate statically in a 37°C, 5% CO2 incubator. After 24 hours, observe cell adhesion and growth. When the confluence of GCs reaches 70-80%, discard the complete culture medium, wash twice with PBS, and add incomplete culture medium.

[0114] Preparation of solution A: Opti-MEM and Lipofectamine TM Mix thoroughly with P3000. Prepare solution B: Mix Opti-MEM, overexpression plasmid, and P3000, or Opti-MEM and small RNA fragment, and gently mix. Add solution A to solution B, gently pipette to mix, and incubate at room temperature in the dark for 15 min. The construction of the overexpression plasmid is as follows:

[0115] Basic plasmid: pcDNA3.1 plasmid

[0116] Insertion sites: BstEII and NotI

[0117]

[0118] The siRNA sequence of the small RNA fragment is as follows: 5′-GCCUAUGCCAGCAUCAGUUTT-3′.

[0119] Add the AB solution mixture to the cell culture plate, gently shake in a cross shape to thoroughly mix the mixture with the culture medium, and then place the culture plate in a 5% CO2 incubator for 24 hours of transfection. Conduct subsequent experiments according to the experimental design.

[0120] Example 7: Dual-fluorescence activity detection of recombinant plasmids in the IRS1 gene promoter region

[0121] Refer to the instructions for the dual-luciferase assay kit to detect the dual-luciferase activity of the recombinant plasmid in the IRS1 gene promoter region. The steps are as follows:

[0122] (1) 24 h after transfection, discard the culture medium, wash the cells twice with PBS containing 1% penicillin and antibiotics, add 100 μL of cell lysis buffer to each well, gently shake the cell culture plate to completely cover the cells with cell lysis buffer, and incubate the cell culture plate on ice for 5 min.

[0123] (2) Take 50 μL of cell lysis buffer and add it to a dual fluorescence detection plate. Add 75 μL of Luciferase AssayReagent to each well, gently pipette to mix, incubate at room temperature for 15 min, and then detect the luminescence value.

[0124] (3) Add 75 μL of Stop& to each of the above wells. Reagent was gently mixed by pipetting and incubated at room temperature for 15 minutes, followed by detection of luminescence value.

[0125] (4) Calculation: Relative activity of firefly luciferase = luminescence value of firefly luciferase / luminescence value of kidney luciferase.

[0126] Experiment Example 8: Strand-Specific Transcriptome Sequencing

[0127] (1) Take a certain amount of Total RNA sample and use oligodT to obtain mRNA from the total RNA;

[0128] (2) mRNA disruption;

[0129] (3) Fragmented mRNA is added to random primers for the synthesis of cDNA one strand;

[0130] (4) cDNA double strand synthesis, using dUTP instead of dTTP;

[0131] (5) End repair, addition of "A" and adapter ligation of double-stranded cDNA;

[0132] (6) PCR and PCR product recovery;

[0133] (7) Document quality inspection;

[0134] (8) Cycloning of library products;

[0135] (9) Circular DNA molecules replicate through rolling circles to form DNA nanospheres (DNB) 10. Sequencing on the DNBSEQ platform.

[0136] Experiment Example 9: Detection of Total Iron Ion Levels in Cells

[0137] (1) Reagent preparation

[0138] ① Before testing, remove the reagents and allow them to return to room temperature.

[0139] ② Prepare 100 μmol / L iron standard: Mix 20 μL of reagent III with 1980 μL of ddH2O until homogeneous. Prepare as needed and use immediately.

[0140] ③ Dilution of standards at different concentrations:

[0141] Table 1. Standard Dilution System

[0142]

[0143] (2) Sample processing

[0144] Cell sample: Collect approximately 1×102 6 Add 200 μL of reagent one to each cell, mix thoroughly, place on an ice box for 10 min to lyse, centrifuge at 15000×g for 10 min at 4℃, and collect the supernatant.

[0145] (3) Operation steps

[0146] ① Standard wells: Add 80 μL of different concentrations of standard to the corresponding wells of the microplate. ② Assay wells: Add 80 μL of the sample to be tested to the corresponding wells of the microplate.

[0147] ② Add 80 μL of reagent II to each well.

[0148] ③ Gently shake to mix, and incubate in a 37℃ constant temperature incubator for 40 minutes.

[0149] ④ Use an ELISA reader to measure the OD value of each well at 593 nm.

[0150] (4) Calculate the total iron ion content in the cells (nmol / 10) 6 ):

[0151]

[0152] Note: Fitting curve for standard sample: y = ax + b

[0153] y: OD value of standard sample - OD value of blank sample (OD value when the concentration of standard sample is 0)

[0154] x: Concentration of the standard

[0155] a: Slope of the standard curve

[0156] b: Intercept of the standard curve

[0157] ΔA: Absolute OD value of the sample – OD value of the measurement well – OD value of the blank well

[0158] N: Number of cell samples used for lysis (in terms of cell count) / 10 6

[0159] V: Reagent volume added during cell sample processing (mL)

[0160] f: Dilution factor of the sample before it is added to the detection system

[0161] Experimental Example 10: Detection of Malondialdehyde (MDA) Levels

[0162] (1) Reagent preparation:

[0163] ① Before testing, remove the reagents and allow them to return to room temperature.

[0164] ② Reagent 1 may solidify when stored in a 4°C refrigerator. It can be heated in a 37°C constant temperature water bath until the liquid melts and becomes transparent before use.

[0165] ③ If reagent 3 precipitates, it needs to be dissolved by heating in an 80℃ constant temperature water bath and then cooled before use.

[0166] ④ Preparation of Reagent Two Application Solution:

[0167] Reagent 2: Double distilled water = 1.2:34, store at 4℃ for 3 months.

[0168] ⑤ Preparation of working solution: Prepare the solution according to the ratio of Reagent 1: Reagent 2 application solution: Reagent 3 = 0.2:3:1, and use immediately after preparation.

[0169] (2) Sample preparation

[0170] Take at least 3×10 6 Collect cells, discard the cell culture medium, digest the cells with trypsin, transfer the cells from the same treatment group to a 1.5 mL sterile centrifuge tube, add 500 μL of reagent five extraction solution, mix by inverting for 2 min, and manually homogenize the cells using an ultrasonic homogenizer or a glass homogenizer to prepare a suspension for testing.

[0171] Note: Ultrasonic crushing: The ultrasonic crusher can be configured with parameters of 90W, 4s / cycle, 2s interval, and 10min total time.

[0172] (3) Operation steps

[0173] ① Add 100 μL of anhydrous ethanol (blank tube), 100 μL of 10 nmol / mL standard (standard tube), and 100 μL of the sample to be tested (sample tube) to the corresponding 1.5 mL EP tubes.

[0174] ② Add 1 mL of working solution to each tube in ①.

[0175] ③ Wrap the EP tube opening with aluminum foil, invert it to mix well, and bathe it in a 100℃ water bath for 40 minutes.

[0176] ④ Cool to room temperature and centrifuge at 1078×g for 10 min.

[0177] ⑤ Transfer 250 μL of the supernatant to a 96-well plate. (Do not add the precipitate to the microplate).

[0178] ⑥ Measure the OD value of the test solution at 532 nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0179] (4) Calculate the malondialdehyde content in the cells (nmol / mgprot):

[0180]

[0181] ΔA1: OD value of the test tube - OD value of the blank tube

[0182] ΔA2: OD value of standard tube - OD value of blank tube

[0183] C: Concentration of standard (10 nmol / mL)

[0184] f: Dilution factor of the sample before it was added to the detection system

[0185] Cpr: Protein concentration of the sample to be tested (mgprot / mL)

[0186] Experimental Example 11: qRT-PCR detection of gene expression

[0187] Based on the CDS region sequence information of the target gene provided by the NCBI database, quantitative primers for the target gene were designed using the primer-blast function on the NCBI website, with GAPDH as an internal control. The length of the qRT-PCR product generally does not exceed 300bp.

[0188] Table 2 List of qRT-PCR primers

[0189]

[0190] Note: All the primers mentioned above belong to the pig species.

[0191] The qRT-PCR procedure was performed according to the Maxima SYBR Green qPCR Master Mix reagent instructions. The qRT-PCR reaction system is shown in Appendix Table 3. Ct values ​​of the internal reference gene and the target gene were obtained from the qRT-PCR, and the relative expression level of the target gene was calculated using the 2-ΔΔCt method.

[0192] Relative expression level = 2 -[(实验组目的基因Ct值-实验组内参Ct值)-(对照组目的基因Ct值-对照组内参Ct值)]

[0193] Table 3 qRT-PCR reaction system

[0194]

[0195]

[0196] Note: The reaction program is 95℃ for 15 min; 95℃ for 5 s, 60℃ for 1 min, for 40 cycles.

[0197] Experiment Example 12: Western Blot

[0198] (1) Total protein extraction (using a 6-well plate as an example):

[0199] ① Discard the culture medium and wash each well with an appropriate amount of PBS 2-3 times.

[0200] ② Add 100 μL of protein lysis buffer (protease inhibitor: RIPA = 1:100) to each well, and place the cell culture plate on a shaker at 4°C and gently shake for 15–20 min.

[0201] ③ Use a pipette to repeatedly blow the cells in the wells to ensure that the proteins are fully lysed. Collect the cells from the same treatment group into the same 1.5 mL centrifuge tube, centrifuge at 4℃ and 12000 rpm for 10 min, and take the supernatant for subsequent experiments.

[0202] (2) Protein quantification:

[0203] ① Preparation of working solution: According to the BCA protein concentration assay kit, mix reagent A and reagent B at a volume ratio of 50:1 to prepare BCA working solution.

[0204] ② Prepare a 96-well plate and add 0, 1, 2, 4, 8, 12, 16, and 20 μL of 0.5 mg / mL protein standard to the corresponding wells, and then fill each well with PBS solution to a final volume of 20 μL.

[0205] ③ Add 2 μL of the protein sample to be tested to the corresponding well, and then fill each well with PBS solution to a total of 20 μL.

[0206] ④ Add 200 μL of BCA working solution to each sample well and standard well.

[0207] ⑤ Place the 96-well plate in a 37°C incubator for 30 minutes to allow the BCA working solution to react with the protein in a colorimetric reaction.

[0208] ⑥ Use an ELISA reader to measure the absorbance (A562) of each well at a wavelength of 570 nm. Plot a standard curve based on different concentrations of protein standards and their corresponding A562 values, and calculate the original concentration of the protein samples.

[0209] (3) Protein denaturation: Calculate the volume of ddH2O and 5×SDS loading buffer to be added to 20μg protein sample based on the protein concentration obtained in the protein quantification test, and boil the above mixture in boiling water at 95-100℃ for 5-10 minutes.

[0210] (4) SDS-PAGE electrophoresis: Add the treated protein sample to the precast protein gel and perform electrophoresis at 140V for 45 minutes. After electrophoresis, cut the gel band containing the target protein according to the position marked by the protein marker.

[0211] (5) Transfer: In eBlot TM The film transfer was performed on the L1 rapid wet transfer instrument, using the instrument's default settings for the transfer program.

[0212] (6) Sealing: Prepare 5% skim milk powder in advance. After the transfer is completed, wash the membrane once with 1×TBST and immerse the membrane in milk powder at room temperature for 1-2 hours.

[0213] (7) Primary antibody incubation: Prepare primary antibody with 1×TBST according to the instructions. After blocking, wash with 1×TBST for 8 min, repeat 3 times, and incubate overnight (12-16 h) at 4℃.

[0214] (8) Secondary antibody incubation: Prepare secondary antibody with 1×TBST according to the instructions. After primary antibody incubation, wash with 1×TBST for 8 min, repeat 3 times; then immerse the membrane in secondary antibody and incubate at room temperature for 1-2 h.

[0215] (9) Exposure and result analysis: Prepare the chemiluminescence solution according to the instructions of the BCL chromogenic kit. After the secondary antibody incubation, wash with 1×TBST for 8 min, repeat 3 times; expose the protein samples using a chemiluminescence analyzer, process the images obtained from the exposure using ImageJ software, and analyze the gray value of the target protein.

[0216] Results analysis:

[0217] 1. Using DNA from Duhei pig ear tissue as a template, primers were designed based on the porcine IRS1 promoter sequence published on NCBI for PCR amplification. The band positions were observed by agarose gel electrophoresis. The 867bp (-406 / +461) porcine IRS1 gene promoter region sequence was obtained. Figure 1 ).

[0218] 2. According to Table 4, at the C>A site of g.128307611, the C mutation to A was found, resulting in 3 genotypes: CC, CA, and AA, with 2 alleles. Among them, the mutated base A is the minor allele. At the C>T site of g.128307308, the C mutation to T was found, resulting in 2 genotypes: CC and TT, with 2 alleles. Among them, the mutated base T is the minor allele.

[0219] 3. The analytical criteria for population genetic structure indicators are as follows: a polymorphism information content (PIC) > 0.25 indicates that the locus is moderately polymorphic, and a PIC < 0.25 indicates that the locus is lowly polymorphic. A PIC > 0.05 indicates that the population genetic variation at the locus is in Hardy-Weinberg equilibrium (Table 5).

[0220] 4. This statistical analysis was based on the genotypic results of a population of 142 Dubai pigs with recorded sexual maturity ages. One-way ANOVA was used to analyze the association between the sexual maturity age and genotype of each individual (Table 6). In the Dubai pig population, individuals with the CA genotype at the g.128307611C>A locus reached sexual maturity significantly earlier than those with the CC and AA genotypes; individuals with the TT genotype at the g.128307308C>T locus reached sexual maturity significantly earlier than those with the CC genotype.

[0221] 5. To investigate the effect of the mutation site on the IRS1 gene promoter activity, pGL3-basic vectors containing wild-type and mutant sequences of the mutation site were constructed by Kinkairui Biotechnology Co., Ltd. The wild-type and mutant vectors of the g.128307611C>A site were named WT-7611 and Mut-7611, respectively; the wild-type and mutant vectors of the g.128307308C>T site were named WT-7308 and Mut-7308, respectively.

[0222] The recombinant plasmids were transfected into granulosa cells of sow ovaries, with Mut-7611 as a control and Mut-7308 as a control. The IRS1 gene promoter activity was detected using a dual-luciferase assay. The results showed no significant change in IRS1 gene promoter activity in the Mut-7611 group; however, the IRS1 gene promoter activity in the Mut-7308 group was significantly higher than that in the WT-7308 group. Figure 2 ).

[0223] The ovarian granulosa cells mentioned above were obtained from healthy commercial sows (hereinafter the same) at Kongwangji Slaughterhouse in Huangpu District, Guangzhou.

[0224] 6. By transfecting sow ovarian granulosa cells with the overexpression vector at 1000 ng / mL, qRT-PCR detection of IRS1 expression revealed that transfection with pcDNA3.1-IRS1 showed good transfection efficiency and significant differences. Subsequent studies selected 1000 ng / mL as the transfection concentration for pcDNA3.1-IRS1. Figure 3 ).

[0225] The overexpression vector was synthesized by Guangzhou Dongze Biotechnology Co., Ltd.

[0226] 7. Synthesize interfering IRS1 fragments / controls (IRS1-siRNA / siRNA-NC), screen and detect their interference efficiency. As shown in the attached figure, transfecting the gene interference fragment into sow ovarian granulosa cells and using qRT-PCR, the IRS1-siRNA fragment exhibits good interference effect and will be used for subsequent experiments. Figure 4 ).

[0227] IRS1-siRNA: 5′-GCCUAUGCCAGCAUCAGUUTT-3′;

[0228] The aforementioned small interfering RNA fragment was synthesized by Guangzhou Dongze Biotechnology Co., Ltd.

[0229] 8. Transfect the above-mentioned pcDNA3.1-IRS1 or IRS1-siRNA into sow ovarian granulosa cells, respectively, with pcDNA3.1 or siRNA-NC as controls. The effects of IRS1 on transcriptional levels and ferroptosis in sow ovarian granulosa cells were detected by strand-specific transcriptome sequencing, total iron colorimetry, malondialdehyde (MDA) colorimetry, qRT-PCR, and Western Blot.

[0230] 9. In the pcDNA3.1-IRS1 group, 331 genes were significantly upregulated and 31 genes were significantly downregulated. The differentially expressed genes are mainly involved in signaling pathways such as iron homeostasis, cell proliferation, and programmed cell death. Figure 5 (a, b)

[0231] 10. 240 genes were significantly upregulated and 393 genes were significantly downregulated in the IRS1-siRNA group. These differentially expressed genes are mainly involved in biological processes such as cell migration, epithelial cell differentiation, inorganic cation transmembrane transport, and the regulation of GTPase activity. Figure 5 (c, d)

[0232] 11. Total iron ion levels decreased in the pcDNA3.1-IRS1 group and increased in the IRS1-siRNA group, but neither change reached statistical significance. Figure 6 ).

[0233] 12. The MDA level in the pcDNA3.1-IRS1 group was not significantly different from that in the control group, while the MDA level in the IRS1-siRNA group was significantly higher than that in the control group. Figure 7 ).

[0234] 13. Compared with the control group, overexpression of IRS1 significantly increased the mRNA and protein expression levels of SLC7A11 and significantly decreased the mRNA and protein expression levels of p53; while knockdown of IRS1 significantly decreased the mRNA and protein levels of SLC7A11 and significantly increased the mRNA expression level of p53, with no significant difference in protein expression levels. In conclusion, IRS1 can inhibit ferroptosis. Figure 8 ).

[0235] In summary, the g.128307308C>T mutation in IRS1 may alter its binding to transcription factors, leading to changes in promoter activity, affecting the transcription and translation of target genes, and consequently regulating the transduction of ferroptosis signaling pathway in granulosa cells, thus affecting the sexual maturation of sows.

[0236] Table 4. Statistical results of SNP site typing in the IRS1 gene promoter region.

[0237]

[0238] Table 5. Analysis of population genetic structure indicators

[0239]

[0240] Table 6. Effects of IRS1 gene polymorphisms on the age of sexual maturity in Duroc pigs.

[0241]

[0242] Note: All values ​​in the table above are expressed as arithmetic mean ± standard deviation. a and b in the table represent within-group differences.

[0243] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a SNP molecular marker related to sexual maturity in pigs, characterized in that: The SNP molecular markers associated with sexual maturity in pigs include at least one of the following SNP molecular markers: (1) The SNP site corresponding to the C>A mutation at site g.128307611 on chromosome 15 of the pig reference genome Sscrofa11.1; (2) The SNP site corresponding to the C>T mutation at site g.128307308 on chromosome 15 of the pig reference genome Sscrofa11.1; The application described is in assessing the age of puberty in pigs: detecting the genotype at locus g.128307611, individuals with genotype CA have a shorter age of puberty than individuals with genotype CC and AA; and / or, detecting the genotype at locus g.128307308, individuals with genotype CC have a shorter age of puberty than individuals with genotype TT. The pigs mentioned are a two-way cross between Duroc and country black pigs.

2. The application of a SNP molecular marker related to sexual maturity in pigs, characterized in that: The SNP molecular markers associated with sexual maturity in pigs include at least one of the following SNP molecular markers: (1) The SNP site corresponding to the C>A mutation at site g.128307611 on chromosome 15 of the pig reference genome Sscrofa11.1; (2) The SNP site corresponding to the C>T mutation at site g.128307308 on chromosome 15 of the pig reference genome Sscrofa11.1; The application described is in determining the onset of puberty in pigs: detecting the genotype at locus g.128307611, with individuals of genotype CA starting puberty faster than those of genotypes CC and AA; and / or, detecting the genotype at locus g.128307308, with individuals of genotype CC starting puberty faster than those of genotype TT. The pigs mentioned are a two-way cross between Duroc and country black pigs.

3. The application of a SNP molecular marker related to sexual maturity in pigs, characterized in that: The SNP molecular markers associated with sexual maturity in pigs include at least one of the following SNP molecular markers: (1) The SNP site corresponding to the C>A mutation at site g.128307611 on chromosome 15 of the pig reference genome Sscrofa11.1; (2) The SNP site corresponding to the C>T mutation at site g.128307308 on chromosome 15 of the pig reference genome Sscrofa11.1; The application described is in the selection of high-yielding pig breeds: detecting the genotype at the g.128307611 locus and selecting individuals with the genotype CA as breeding pigs; and / or, detecting the genotype at the g.128307308 locus and selecting individuals with the genotype CC as breeding pigs; The pigs mentioned are a two-way cross between Duroc and country black pigs.