Molecular markers for wheat ARF12-2B yield regulation and its application

By detecting specific SNP sites and haplotypes in the wheat genome, KASP molecular marker technology was used to identify the low expression activity of the ARF12-2B gene, which solved the problem of efficient breeding of high-yield wheat, and achieved efficient breeding and yield improvement.

CN120026127BActive Publication Date: 2025-08-26INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510472086.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-16
Publication Date
2025-08-26
Estimated Expiration
2045-04-16

AI Technical Summary

Technical Problem

It is difficult for the prior art to efficiently identify and select low-expression active haplotypes of ARF12-2B genes related to wheat yield, resulting in low breeding efficiency in high yield wheat.

Method used

By detecting the SNP polymorphism or genotype in the wheat genome, especially the combination of SNP1, InDel2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10 and other loci, the ARF12-2B-Hap1, ARF12-2B-Hap2, and ARF12-2B-Hap3 haplotypes were identified, and KASP molecular marker technology was used to perform genotyping to screen high-yield wheat varieties.

Benefits of technology

It improves the selection efficiency of wheat breeding, saves costs, and significantly improves wheat yield, especially the number of ears, ear grains and thousands of grain weight, shortens the breeding process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The present invention discloses a molecular marker for regulating wheat ARF12-2B yield and its application. The present invention relates to a molecular marker for regulating wheat ARF12-2B yield in the field of nucleic acid detection and its application. The material for detecting the polymorphism or genotype of SNP in the wheat genome or the material for detecting haplotype of the present invention is used as follows: (1) identifying or assisting in identifying wheat yield; (2) screening or breeding wheat plants or lines or strains or varieties with high yield; (3) wheat breeding; (4) preparing products for identifying or assisting in identifying wheat yield; (5) preparing products for screening or breeding wheat plants or lines or strains or varieties with high yield; (6) preparing products for wheat breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a molecular marker for regulating wheat ARF12-2B yield in the field of nucleic acid detection and an application thereof. Background Art

[0002] wheat( Triticum aestivum Wheat (L.) is the world's most widely distributed and cultivated grain crop. Increasing yield has always been a key goal of wheat breeding. Wheat yield is composed of three components: number of ears per mu, number of grains per ear, and 1000-grain weight. Plant traits, such as plant height, also influence yield stability and potential.

[0003] Using gene editing technology, the wheat auxin response factor (ARF) gene has been confirmed ARF12-2B Regulating yield-related traits, its knockout can reduce plant height and increase ear length, number of grains per ear, and 1000-grain weight, which indicates that ARF12-2B Genes play a key role in balancing plant type and yield traits. ARF12-2B The development of efficient molecular markers based on haplotypes with low expression activity will provide important genetic tools for high-yield wheat breeding. Through marker-assisted selection, high-yield wheat varieties with compact plant types, high number of grains per ear, and high 1000-grain weight can be precisely selected, significantly increasing yield potential. Summary of the Invention

[0004] The main problem to be solved by the present invention is how to identify wheat yield.

[0005] In order to solve the above problems, the present invention provides the use of a substance for detecting the polymorphism or genotype of SNPs in the wheat genome or a substance for detecting haplotypes in any of the following:

[0006] (1) Identify or assist in identifying wheat yield;

[0007] (2) Screening or breeding high-yielding wheat plants, lines, strains, or varieties;

[0008] (3) Wheat breeding;

[0009] (4) Prepare products for identifying or assisting in identifying wheat yield;

[0010] (5) preparing products for screening or breeding high-yielding wheat plants, lines, strains or varieties;

[0011] (6) Preparation of wheat breeding products;

[0012] The SNPs are 10 SNPs in the wheat genome, namely SNP1, InDel2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9 and SNP10, wherein SNP1 is the 766557690th nucleotide in the Chinese spring wheat reference genome sequence RefSeq v1.0, and its nucleotide type is C or G; InDel2 is the 766557721st nucleotide in the Chinese spring wheat reference genome sequence RefSeq v1.0, and its nucleotide type is missing C or containing C; SNP3 is the 766557726th nucleotide in the Chinese spring wheat reference genome sequence RefSeq v1.0, and its nucleotide type is C or G; SNP4 is the 766565798th nucleotide in the Chinese spring wheat reference genome sequence RefSeq v1.0, and its nucleotide type is A or G; SNP5 is the 766565799th nucleotide in the Chinese spring wheat reference genome sequence RefSeq v1.0, the nucleotide type is T or C, the SNP6 is the nucleotide type 766566233 in the Chinese spring wheat reference genome sequence RefSeq v1.0, the nucleotide type is C or T, the SNP7 is the nucleotide type 766566285 in the Chinese spring wheat reference genome sequence RefSeq v1.0, the nucleotide type is T or C, the SNP8 is the nucleotide type 766566413 in the Chinese spring wheat reference genome sequence RefSeq v1.0, the nucleotide type is T or C, the SNP9 is the nucleotide type 766566434 in the Chinese spring wheat reference genome sequence RefSeq v1.0, the nucleotide type is T or C, and the SNP10 is the nucleotide type 766566458 in the Chinese spring wheat reference genome sequence RefSeq v1.0, the nucleotide type is T or C;

[0013] The haplotype is a polymorphic combination of the 10 SNPs, namely, the SNP1, the InDel2, the SNP3, the SNP4, the SNP5, the SNP6, the SNP7, the SNP8, the SNP9, and the SNP10 on a chromosome of wheat.

[0014] The haplotype includes a haplotype ARF12-2B-Hap1, ARF12-2B-Hap2, ARF12-2B-Hap3 .

[0015] The haplotype ARF12-2B-Hap1 The haplotype is one in which the genotype of SNP1 is CC (homozygous type in which the 92nd nucleotide of SEQ ID No: 7 in the sequence list is C) and the genotype of SNP8 is TT (homozygous type in which the 37th nucleotide of SEQ ID No: 8 in the sequence list is T);

[0016] The haplotype ARF12-2B-Hap2 The haplotype is one in which the genotype of SNP1 is CC (the homozygous type in which the 92nd nucleotide of SEQ ID No: 7 in the sequence list is C) and the genotype of SNP8 is CC (the homozygous type in which the 37th nucleotide of SEQ ID No: 8 in the sequence list is C);

[0017] The haplotype ARF12-2B-Hap3 The genotype of SNP1 is GG (homozygous type in which the 92nd nucleotide of SEQ ID No: 7 in the sequence list is G) and the genotype of SNP8 is CC (homozygous type in which the 37th nucleotide of SEQ ID No: 8 in the sequence list is C).

[0018] The present invention also provides a method for identifying or assisting in identifying wheat yield, which is method A or method B:

[0019] The method A is a method for identifying or assisting in identifying wheat yield, comprising detecting the genotypes of the aforementioned SNP1 and SNP8 in the wheat to be tested, and identifying or assisting in identifying the wheat yield based on the genotype of the wheat to be tested: the yield of wheat with the genotype CCTT or CCCC is higher or is potentially higher than that of wheat with the genotype GGCC;

[0020] The genotype CCTT is a combined genotype in which the genotype of SNP1 is CC (homozygous for C at position 92 of SEQ ID No: 7 in the sequence list) and the genotype of SNP8 is TT (homozygous for T at position 37 of SEQ ID No: 8 in the sequence list);

[0021] The genotype CCCC is a combined genotype in which the genotype of SNP1 is CC (the 92nd nucleotide of SEQ ID No: 7 in the sequence list is a homozygous C) and the genotype of SNP8 is CC (the 37th nucleotide of SEQ ID No: 8 in the sequence list is a homozygous C);

[0022] The genotype GGCC is a combined genotype in which the genotype of SNP1 is GG (homozygous for G at position 92 of SEQ ID No: 7 in the sequence list) and the genotype of SNP8 is CC (homozygous for C at position 37 of SEQ ID No: 8 in the sequence list);

[0023] The method B is a method for identifying or assisting in identifying wheat yield, comprising detecting the haplotypes described above in the wheat to be tested, and identifying or assisting in identifying wheat yield based on the haplotypes of the wheat to be tested: haplotype ARF12-2B-Hap3 The corresponding homozygous genotype wheat yield is lower than or candidate lower than the haplotype ARF12-2B-Hap1 Corresponding homozygous wheat genotypes and haplotypes ARF12-2B-Hap2the corresponding homozygous genotype of wheat;

[0024] The haplotype ARF12-2B-Hap3 The haplotype is a GG genotype of the SNP1 (homozygous type in which the 92nd nucleotide of SEQ ID No: 7 in the sequence list is G) and a CC genotype of the SNP8 (homozygous type in which the 37th nucleotide of SEQ ID No: 8 in the sequence list is C).

[0025] The haplotype ARF12-2B-Hap1 The haplotype is one in which the genotype of SNP1 is CC (homozygous type in which the 92nd nucleotide of SEQ ID No: 7 in the sequence list is C) and the genotype of SNP8 is TT (homozygous type in which the 37th nucleotide of SEQ ID No: 8 in the sequence list is T);

[0026] The haplotype ARF12-2B-Hap2 The genotype of SNP1 is CC (the homozygous type in which the 92nd nucleotide of SEQ ID No: 7 in the sequence listing is C) and the genotype of SNP8 is CC (the homozygous type in which the 37th nucleotide of SEQ ID No: 8 in the sequence listing is C).

[0027] In the above method or application, the wheat is a wheat variety or strain.

[0028] The application of the above-mentioned method in wheat breeding also falls within the scope of protection claimed by the present invention.

[0029] The present invention also provides a method for wheat breeding, which can be M1 and M2:

[0030] M1. The method comprises detecting the genotype of the aforementioned SNP in the wheat genome, selecting wheat with the genotype of CCTT or CCCC as a parent for breeding, wherein the genotype of SNP1 is CC (homozygous for C at position 92 of SEQ ID No: 7 in the sequence listing) and the genotype of SNP8 is a combined genotype of TT or CC (homozygous for T at position 37 of SEQ ID No: 8 in the sequence listing, or homozygous for C at position 37 of SEQ ID No: 8 in the sequence listing), and the breeding purpose of the method comprises breeding wheat with high wheat yield;

[0031] M2. The method includes detecting the type of the haplotype described above in the wheat genome, and selecting wheat of haplotype ARF12-2B-Hap1 or ARF12-2B-Hap2 as a parent for breeding, wherein the ARF12-2B-Hap1 is a haplotype in which the genotype of SNP1 is CC (the 92nd nucleotide of SEQ ID No: 7 in the sequence listing is a homozygous type of C) and the genotype of SNP8 is TT (the 37th nucleotide of SEQ ID No: 8 in the sequence listing is a homozygous type of T); the ARF12-2B-Hap2 is a haplotype in which the genotype of SNP1 is CC (the 92nd nucleotide of SEQ ID No: 7 in the sequence listing is a homozygous type of C) and the genotype of SNP8 is CC (the 37th nucleotide of SEQ ID No: 8 in the sequence listing is a homozygous type of C).

[0032] The present invention also provides a product for detecting the polymorphism or genotype of the SNP described above, wherein the product contains the substance described above, and the product is any one of:

[0033] C1) Products for detecting single nucleotide polymorphisms or genotypes associated with wheat yield;

[0034] C2) Products that identify or assist in identifying wheat yield;

[0035] C3) Products used for wheat breeding;

[0036] C4) Products that screen or breed wheat plants, lines, strains or varieties for high wheat yield.

[0037] In the above applications or products, the substances are as follows: D1), D2) or D3):

[0038] D1) the substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP1 and a primer composition for amplifying a wheat genomic DNA fragment including the SNP8;

[0039] D2) the substance is a PCR reagent containing the primer combination described in D1);

[0040] D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0041] In the above application or product, the primer composition for amplifying a wheat genomic DNA fragment including SNP1, InDel2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9 or SNP10 consists of the following primer set 1 or primer set 2;

[0042] 1) The primer set 1 consists of primer F1, primer F2 and primer R1, and amplifies a wheat genomic DNA fragment including the SNP1;

[0043] 2) The primer set 2 consists of primer F3, primer F4 and primer R2, and amplifies the wheat genomic DNA fragment including the SNP8;

[0044] The primer F1 is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-39 of sequence 1 in the sequence list;

[0045] The primer F2 is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-39 in sequence 2 in the sequence list;

[0046] The primer R1 is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list;

[0047] The primer F3 is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-40 of sequence 4 in the sequence list;

[0048] The primer F4 is a single-stranded DNA molecule whose nucleotide sequence is sequence 5 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-40 of sequence 5 in the sequence list;

[0049] The nucleotide sequence of the primer R2 is a single-stranded DNA molecule of sequence 6 in the sequence table.

[0050] In a specific embodiment, the wheat genomic DNA to be tested is used as a template, and PCR amplification is performed using KASP primer set 1 and primer set 2 respectively.

[0051] The PCR reaction system included: 2.0 μL KASP 2× Master Mix (LGC, Catalog No.: 13448166), 0.048 μL KASP primer set (a mixture of three primers with a total concentration of 50 μM, in which the molar ratio of two forward primers to one reverse primer was 2:2:5), and 2.0 μL template DNA (50 ng / μL).

[0052] The PCR reaction program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, 61°C-55°C (touchdown program was selected, decreasing 0.6°C per cycle) for 1 min, and amplification for 10 cycles; denaturation at 94°C for 20 s, 55°C for 1 min, and continued amplification for 31 cycles.

[0053] The present invention also provides a DNA molecule, the nucleotide sequence of which is sequence 7 or sequence 8 in the sequence list.

[0054] The present invention also provides the use of the aforementioned DNA molecule in any of the following:

[0055] (1) Identify or assist in identifying wheat yield;

[0056] (2) Screening or breeding high-yielding wheat plants, lines, strains, or varieties;

[0057] (3) Wheat breeding;

[0058] (4) Prepare products for identifying or assisting in identifying wheat yield;

[0059] (5) preparing products for screening or breeding high-yielding wheat plants, lines, strains or varieties;

[0060] (6) Preparation of wheat breeding products.

[0061] Using two groups of wheat ARF12-2B Molecular markers of genes K-2B-SNP1 and K-2B-SNP8 A population consisting of 165 wheat lines from the Huanghuai region of my country was genotyped, and genetic effect analysis found that ARF12-2B-Hap1 and ARF12-2B-Hap2 Haplotype compared to ARF12-2B-Hap3 The haplotype has lower plant height and number of ears per mu, but higher yield and 1000-grain weight, which provides a molecular tool for wheat marker-assisted breeding.

[0062] By applying the KASP molecular marker developed by the present invention, efficient screening ARF12-2B The superior alleles of the gene can predict the yield-related traits of wheat, which not only saves costs but also greatly improves the selection efficiency and accelerates the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 It's wheat ARF12-2B Gene mutation sites and haplotype typing results.

[0064] Figure 2 This is the result of the microplate reader typing test of the KASP product. DETAILED DESCRIPTION

[0065] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0066] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0067] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.

[0068] The phenotypic data of the 165 natural populations and yield-related traits in the Huanghuai wheat region in the following examples have been recorded in: Li F, Wen W, Liu J, Zhang Y, Cao S, He Z, Rasheed A, Jin H, Zhang C, Yan J, Zhang P, Wan Y, Xia X (2019) Genetic architecture of grain yield in breadwheat based on genome-wide association studies. BMC Plant Biology 19(1):168. The public can obtain the biological materials from the applicant for use only in repeating the experiments of the present invention and cannot be used for other purposes.

[0069] The data in the following examples were processed using SPSS statistical software. The experimental results were expressed as mean ± standard deviation, and one-way analysis of variance and Duncan's multiple comparisons were used. Different lowercase letters indicate significant differences at the 0.05 level.

[0070] Example 1, wheat ARF12-2B Identification of gene polymorphic sites and haplotypes

[0071] ARF transcription factor encoding gene ARF12-2B Wheat genome ID ( TraesCS2B02G578500 ) was input into the wheat genome variation database (Wheat-SnpHub-Portal, http: / / wheat.cau.edu.cn / Wheat_SnpHub_Portal / ), 183 varieties (MP group and NC-CC group) in the database were selected, and the variation information of 1 Kb upstream and downstream of the gene and the gene open reading frame was retrieved. A total of 10 variation sites were found, which were recorded as SNP1, Indel 2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9 and SNP10 ( Figure 1), the physical positions of these 10 variant sites in the Chinese spring wheat reference genome sequence RefSeq v1.0 are 766557690, 766557721, 766557726, 766565798, 766565957, 766566233, 766566285, 766566413, 766566434 and 766566458. These variant information form three haplotypes ( Figure 1 ),in, ARF12-2B-Hap1 The allelic variant bases at positions 766557690, 766557721, 766557726, 766565798, 766565957, 766566233, 766566285, 766566413, 766566434, and 766566458 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are C, C deletion, C, A, T, C, T, T, T, and T, respectively. ARF12-2B-Hap2 In the Chinese spring wheat reference genome sequence RefSeq v1.0, the allelic variant bases at positions 766557690, 766557721, 766557726, 766565798, 766565957, 766566233, 766566285, 766566413, 766566434, and 766566458 are C, T deletion C, G, G, C, T, C, C, T, and C, respectively. ARF12-2B-Hap3 The allelic variant bases at positions 766557690, 766557721, 766557726, 766565798, 766565957, 766566233, 766566285, 766566413, 766566434 and 766566458 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are G, C, C, A, T, C, T, C, C and T, respectively.

[0072] Example 2, identification ARF12-2B Development of haplotype molecular markers and their specific primer sets

[0073] 1. KASP primer set design

[0074] The present invention uses Polymarker (https: / / www.polymarker.info / ) to design two sets of KASPs for wheat identification at SNP1 (position 766557690 in the Chinese spring wheat reference genome sequence RefSeq v1.0) and SNP8 (position 766566413 in the Chinese spring wheat reference genome sequence RefSeq v1.0) on wheat chromosome 2B. ARF12-2B Haplotype primer set K-2B-SNP1 and K-2B-SNP8 The primer sequence specificity was evaluated using WheatOmics (http: / / 202.194.139.32 / ). The KASP primer set consisted of forward primers F1 and F2 and reverse primer R.

[0075] The following KASP primer set 1 was designed for SNP1 (position 766557690 in the Chinese spring wheat reference genome sequence RefSeq v1.0):

[0076] Forward primer F1: 5'- GAAGGTGACCAAGTTCATGCT CTCTCACAAATCCGCCCG-3' (SEQ ID No: 1, the underlined portion is the specific recognition sequence of the FAM fluorescent probe);

[0077] Forward primer F2: 5'- GAAGGTCGGAGTCAACGGATT CTCTCACAAATCCGCCCC-3' (SEQ ID No: 2, the underlined part is the specific recognition sequence of the HEX fluorescent probe);

[0078] Reverse primer R1: 5′-GTCTCGTTGGCCGGCTTG-3′ (SEQ ID No: 3).

[0079] K-2B-SNP1 The marker is the 92nd nucleotide from the 5' end of SEQ ID No: 7 in the wheat genome (corresponding to the last base at the 3' end of the two forward primers), which is G or C. In SEQ ID No: 7, s represents G or C. If the wheat to be tested is based on K-2B-SNP1 The marker shows a blue fluorescent signal, then the wheat SNP1 The genotype of the locus is CC homozygous; if the wheat to be tested is based on K-2B-SNP1 The marker shows a red fluorescent signal, then the wheat SNP1 The genotype of the locus is homozygous GG.

[0080] The sequence information of SEQ ID No:7 is as follows: 5'-GTCTCGTTGGCCGGCTTGCGGGAGTGGCCGGCGGCTGACGCGGTGGCTTTGGTTGTTGCAGAATGCGGCGGATTTGAGGATGGGGTTCCGCsGGGCGGATTTGTGAGAGGGGTGCTTGGTTTTTGGTC-3'.

[0081] (The bold bases are the sequences submitted to Polymarker for designing KASP primers, and the underlined bases are the KASP primer sequences)

[0082] The above nucleic acid sequences of SEQ ID No: 1, SEQ ID No: 2 and SEQ ID No: 3 are antisense DNA sequences, and the nucleic acid sequence of SEQ ID No: 7 is a positive sense DNA sequence.

[0083] The following KASP primer set 2 was designed for SNP8 (position 766566413 in the Chinese spring wheat reference genome sequence RefSeq v1.0):

[0084] Forward primer F3: 5'- GAAGGTGACCAAGTTCATGCT GGGCTCGGGTTTGCTTAAT-3' (SEQ ID No: 4, the underlined portion is the specific recognition sequence of the FAM fluorescent probe);

[0085] Forward primer F4: 5'- GAAGGTCGGAGTCAACGGATT GGGCTCGGGTTTGCTTAAC-3' (SEQ ID No: 5, the underlined portion is the specific recognition sequence of the HEX fluorescent probe);

[0086] Reverse primer R2: 5′-CAATTTTGCTCTCAAGAGAACCA-3′ (SEQ ID No: 6).

[0087] K-2B-SNP8 The marker is the 37th nucleotide from the 5' end of SEQ ID No: 8 in the wheat genome (corresponding to the last base at the 3' end of the two forward primers), which is T or C. In SEQ ID No: 8, y represents T or C. If the wheat to be tested is based on K-2B-SNP8 The marker shows a blue fluorescent signal, then the wheat to be tested is based on SNP8 The genotype of the locus is TT homozygous; if the wheat to be tested is based on K-2B-SNP8 The marker shows a red fluorescent signal, then the wheat SNP8 The genotype of the locus is CC homozygous.

[0088] The sequence information of SEQ ID No: 8 is as follows: 5'-ACAGTCACTGTCTTTTGGGGGCTCGGGTTTGCTTAAyTCACCCACAAGTAAAGATGGTTCTCTTGAGAGCAAAATTG-3'.

[0089] 2. Identification of wheat haplotypes

[0090] (1) Using the molecular markers and primers from step 1, identify the haplotype of wheat to be tested. The specific steps are as follows:

[0091] Using the wheat genomic DNA to be tested as a template, the detection method in step 1 was used. K-2B-SNP1 Mark and K-2B-SNP8 PCR amplification was performed using the labeled primer set.

[0092] KASP reaction system: 2.0 μL KASP 2× Master Mix (LGC, Catalog No.: 13448166), 0.048 μL KASP primer set (3 primers mixed, total concentration 50 μM, with two forward primers and one reverse primer in a molar ratio of 2:2:5), and 2.0 μL template DNA (50 ng / μL).

[0093] The KASP reaction program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, 61°C-55°C (touch-down program was used, decreasing 0.6°C per cycle) for 1 min, and amplification for 10 cycles; denaturation at 94°C for 20 s, 55°C for 1 min, and continued amplification for 31 cycles.

[0094] Two blank control groups (NTC) were set up for each reaction.

[0095] (2) Fluorescence signals were detected on a PHERAstar Plus autofocus fluorescence multifunctional microplate reader (BMG Labtech GmbH, Ortenberg, Germany) and typing was performed using KlusterCaller software (LGC, Hoddesdon, UK). When the temperature of the PCR amplification product dropped below 40°C, the fluorescence value was read by scanning the FAM and HEX beams of the microplate reader (the FAM fluorescent label was observed at an excitation wavelength of 485 nm and an emission wavelength of 520 nm, and the HEX fluorescent label was observed at an excitation wavelength of 528 nm and an emission wavelength of 560 nm). The color of the fluorescence signal was used to determine the wheat strain to be tested. SNP1 and SNP8 Genotype of the locus.

[0096] The specific judgment principles are as follows:

[0097] a. If the wheat to be tested is based on K-2B-SNP1 The marker shows a blue fluorescent signal, then the wheat SNP1 The genotype of the locus is CC homozygous; if the wheat to be tested is based on K-2B-SNP1 The marker shows a red fluorescent signal, then the wheat SNP1 The genotype of the locus is homozygous GG;

[0098] b. If the wheat to be tested is based on K-2B-SNP8 The marker shows a blue fluorescent signal, then the wheat to be tested is based on SNP8 The genotype of the locus is TT homozygous; if the wheat to be tested is based on K-2B-SNP8 The marker shows a red fluorescent signal, then the wheat SNP8 The genotype of the locus is CC homozygous.

[0099] ARF12-2B Haplotypes include the following three types: ARF12-2B-Hap1 、 ARF12-2B-Hap2 、 ARF12-2B- Hap3 .

[0100] Haplotype ARF12-2B-Hap1 The genotype of SNP1 is CCTT, that is, the genotype of SNP1 is CC (the 92nd nucleotide of SEQ ID No: 7 in the sequence list is a homozygous type of C) and the genotype of SNP8 is TT (the 37th nucleotide of SEQ ID No: 1 in the sequence list is a homozygous type of T).

[0101] Haplotype ARF12-2B-Hap2 The genotype of is CCCC, that is, the genotype of SNP1 is CC (the 92nd nucleotide of SEQ ID No: 7 in the sequence list is a homozygous type of C) and the genotype of SNP8 is CC (the 37th nucleotide of SEQ ID No: 8 in the sequence list is a homozygous type of C).

[0102] Haplotype ​ The genotype of SNP1 is GGCC, that is, the genotype of SNP1 is GG (the 92nd nucleotide of SEQ ID No: 7 in the sequence list is a homozygous type of G) and the genotype of SNP8 is CC (the 37th nucleotide of SEQ ID No: 8 in the sequence list is a homozygous type of C).

[0103] Example 3, molecular markers ​ and ​ Application of specific primer sets in identification of natural populations of wheat ​ Application in haplotype and phenotype identification

[0104] 1. Field phenotyping and data analysis of 165 natural populations in the Huanghuai wheat region

[0105] 165 natural wheat varieties from the Huanghuai wheat region were planted in Anyang, Henan, and Suixi, Anhui, in 2012-2013 and 2013-2014, and in Anyang, Henan, and Gaoyi, Hebei, in 2014-2015. A completely randomized block design with three replicates was used, with single-row plots, 1.5 m long and 0.2 m wide rows, and 50 grains per row. Field management practices followed local wheat field management practices.

[0106] Phenotypic data for yield-related traits were provided by Li Faji of our laboratory as mentioned above (Li F, Wen W, Liu J, Zhang Y, Cao S, He Z, Rasheed A, Jin H, Zhang C, Yan J, Zhang P, Wan Y, Xia X. Genetic architecture of grain yield in bread wheat based on genome-wide association studies. BMC Plant Biol. 2019 Apr 29;19(1):168. doi:10.1186 / s12870-019-1781-3). BLUE values ​​for phenotypic data for yield components across multiple environments are shown in Table 1.

[0107] 2. Molecular markers ​ and ​ Detection of genotypes of wheat varieties in the Huanghuai region

[0108] 165 wheat varieties from the Huanghuai wheat region were used as test wheat. Genotyping was performed according to the method in Example 2 to determine the haplotype of each wheat variety. The genotyping results of SNP1 and SNP8 are shown in Tables 1 and ​ .

[0109] 3. Wheat ​ Association analysis between gene haplotypes and yield-related traits

[0110] SPSS statistical software was used to analyze the variance and Duncan's multiple comparisons according to the typing results and phenotypic data. ​ Genetic effects of gene haplotypes on yield-related traits. The results of genetic analysis of yield-related traits are shown in Table 2. The same lowercase letters indicate no significant difference at the 0.05 level, and different lowercase letters indicate significant difference at the 0.05 level.

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117] Note: Statistical analysis was performed using one-way ANOVA. ​ The same lowercase letters after the phenotypic values ​​of different haplotypes of the gene indicate no significant difference at the 0.05 level, and different lowercase letters indicate significant difference at the 0.05 level.

[0118] In summary, the haplotype analysis results showed that:

[0119] (1) Compared with haplotype ​ , ​ and ​ Yield increased significantly by 11.1% and 13.6%;

[0120] (2) Compared with haplotype ​ , ​ and ​ Thousand-grain weight increased significantly by 8.8% and 6.4%;

[0121] (3) Compared with haplotype ​ , ​ and ​ The number of ears per mu decreased significantly by 9.0% and 8.9%;

[0122] (4) Compared with haplotype ​ , ​ and ​ The number of grains per ear increased by 4.8% and 6.7%;

[0123] (5) Compared with haplotype ​ , ​ and ​ Plant height decreased significantly by 12.8% and 15.8%;

[0124] If high-yield wheat varieties are selected, haploid ​ or / and <h2 style=";text-align:left;direction:ltr">ARF12-2B-Hap2 Wheat varieties are used as parents for breeding to improve breeding efficiency, accelerate the breeding process, and provide new possibilities for efficient screening and breeding of high-yield wheat varieties.

[0125] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. Use of a substance for detecting SNP polymorphism or genotype in a wheat genome or a substance for detecting haplotype in any of the following: (1) Identify or assist in identifying wheat yield; (2) Screening or breeding high-yielding wheat plants, lines, strains, or varieties; (3) Wheat breeding; (4) Prepare products for identifying or assisting in identifying wheat yield; (5) preparing products for screening or breeding high-yielding wheat plants, lines, strains or varieties; (6) Preparation of wheat breeding products; The SNPs are two SNPs in the wheat genome, namely SNP1 and SNP8, wherein SNP1 is the 766557690th nucleotide on chromosome 2B in the Chinese spring wheat reference genome sequence RefSeq v1.0, and its nucleotide type is C or G; and SNP8 is the 766566413th nucleotide on chromosome 2B in the Chinese spring wheat reference genome sequence RefSeq v1.0, and its nucleotide type is T or C; The haplotype is a polymorphic combination of two variations, SNP1 and SNP8, on a chromosome of wheat.

2. The use according to claim 1, characterized in that The wheat is a wheat variety or strain.

3. A method for identifying or assisting in identifying wheat yield, characterized in that: The method is method A or method B: The method A is a method for identifying or assisting in identifying wheat yield, comprising detecting the genotypes of SNP1 and SNP8 in the wheat to be tested, and identifying or assisting in identifying the wheat yield based on the genotype of the wheat to be tested: the yield of wheat with a genotype of CCTT or CCCC is higher or is potentially higher than that of wheat with a genotype of GGCC; The SNP1 is the 766557690th nucleotide on chromosome 2B in the Chinese spring wheat reference genome sequence RefSeq v1.0, and its nucleotide type is C or G. The SNP8 is the 766566413th nucleotide on chromosome 2B in the Chinese spring wheat reference genome sequence RefSeq v1.0, and its nucleotide type is T or C. The genotype CCTT is a combined genotype in which the genotype of SNP1 is CC, i.e., the homozygous type of the 92nd nucleotide of SEQ ID No: 7 in the sequence list is C, and the genotype of SNP8 is TT, i.e., the homozygous type of the 37th nucleotide of SEQ ID No: 8 in the sequence list is T; The genotype CCCC is a combined genotype in which the genotype of SNP1 is CC, i.e., the homozygous type in which the 92nd nucleotide of SEQ ID No: 7 in the sequence list is C, and the genotype of SNP8 is CC, i.e., the homozygous type in which the 37th nucleotide of SEQ ID No: 8 in the sequence list is C; The genotype GGCC is a combined genotype in which the genotype of SNP1 is GG, i.e., the homozygous type in which the 92nd nucleotide of SEQ ID No: 7 in the sequence list is G, and the genotype of SNP8 is CC, i.e., the homozygous type in which the 37th nucleotide of SEQ ID No: 8 in the sequence list is C; The method B is a method for identifying or assisting in identifying wheat yield, comprising identifying or assisting in identifying wheat yield based on the haplotype of the wheat to be tested: haplotype ARF12-2B-Hap3 The corresponding homozygous genotype wheat yield is lower than or candidate lower than the haplotype ARF12-2B-Hap1 Corresponding homozygous wheat genotypes and haplotypes ARF12-2B-Hap2 the corresponding homozygous genotype of wheat; The haplotype ARF12-2B-Hap1 The genotype of SNP1 is CC, i.e., the homozygous type of the 92nd nucleotide of SEQ ID No: 7 in the sequence list is C, and the genotype of SNP8 is TT, i.e., the homozygous haplotype of the 37th nucleotide of SEQ ID No: 8 in the sequence list is T; The haplotype ARF12-2B-Hap2 The genotype of SNP1 is CC, that is, the 92nd nucleotide of SEQ ID No: 7 in the sequence list is a homozygous C, and the genotype of SNP8 is CC, that is, the 37th nucleotide of SEQ ID No: 8 in the sequence list is a homozygous haplotype; The haplotype ARF12-2B-Hap3 The genotype of SNP1 is GG, i.e., the homozygous type of the 92nd nucleotide of SEQ ID No: 7 in the sequence list is G, and the genotype of SNP8 is CC, i.e., the homozygous haplotype of the 37th nucleotide of SEQ ID No: 8 in the sequence list is C; The SNP1 is the 766557690th nucleotide on chromosome 2B in the Chinese spring wheat reference genome sequence RefSeq v1.0, and its nucleotide type is C or G. The SNP8 is the 766566413th nucleotide on chromosome 2B in the Chinese spring wheat reference genome sequence RefSeq v1.0, and its nucleotide type is T or C.

4. The method according to claim 3, characterized in that The wheat is a wheat variety or strain.

5. A method for wheat breeding, characterized in that: The methods are M1 and M2: M1. The method includes detecting the genotype of SNPs in the wheat genome, selecting wheat with a genotype of CCTT or CCCC as a parent for breeding, wherein the SNPs are two SNPs in the wheat genome, namely, SNP1 and SNP8, wherein SNP1 is the 766557690th nucleotide on chromosome 2B in the Chinese spring wheat reference genome sequence RefSeq v1.0, and the nucleotide type thereof is C or G, and SNP8 is the 766566413th nucleotide on chromosome 2B in the Chinese spring wheat reference genome sequence RefSeq v1.0, and the nucleotide type thereof is T or C, and the genotype of SNP1 is CC, i.e., the 92nd nucleotide of SEQ ID No: 7 in the sequence listing is a homozygous type of C and the genotype of SNP8 is TT or CC, i.e., the 37th nucleotide of SEQ ID No: 8 in the sequence listing is a homozygous type of T, or ...8 is CC, i.e., the 92nd nucleotide of SEQ ID No: 7 in the sequence listing is a homozygous type of C, and the genotype of SNP8 is TT or CC, i.e., the 37th nucleotide of SEQ ID No: 8 in the sequence listing is a homozygous type of T, or the genotype of SNP1 is CC, i.e., the 92nd nucleotide of SEQ ID No: 7 in the sequence listing is a homozygous type of C, and the geno No. 8 has a homozygous genotype of C at position 37, and the breeding purpose of the method includes breeding wheat with high wheat yield; M2, the method includes detecting the type of haplotype in the wheat genome, selecting haplotype ARF12-2B-Hap1 or ARF12-2B-Hap2 Wheat is used as a parent for breeding, ARF12-2B-Hap1 The genotype of SNP1 is CC, that is, the 92nd nucleotide of SEQ ID No: 7 in the sequence list is a homozygous C, and the genotype of SNP8 is TT, that is, the 37th nucleotide of SEQ ID No: 8 in the sequence list is a homozygous haplotype; ARF12-2B-Hap2 The genotype of SNP1 is CC, that is, the 92nd nucleotide of SEQ ID No: 7 in the sequence list is a homozygous type of C and the genotype of SNP8 is CC, that is, the 37th nucleotide of SEQ ID No: 8 in the sequence list is a homozygous haplotype of C; the SNP1 is the 766557690th nucleotide on chromosome 2B in the Chinese spring wheat reference genome sequence RefSeq v1.0, and its nucleotide type is C or G, and the SNP8 is the 766566413th nucleotide on chromosome 2B in the Chinese spring wheat reference genome sequence RefSeq v1.0, and its nucleotide type is T or C.

6. A product for detecting the polymorphism or genotype of a single nucleotide polymorphism (SNP), comprising a substance for detecting the polymorphism or genotype of a single nucleotide polymorphism (SNP) in the wheat genome or a substance for detecting the haplotype of a single nucleotide polymorphism (SNP). The product is any of: C1) Products for detecting single nucleotide polymorphisms or genotypes associated with wheat yield; C2) Products that identify or assist in identifying wheat yield; C3) Products used for wheat breeding; C4) Products that screen or breed wheat plants, lines, strains or varieties for high wheat yield; The SNPs are two SNPs in the wheat genome, named SNP1 and SNP8 respectively. The SNP1 is the 766557690th nucleotide on chromosome 2B in the Chinese spring wheat reference genome sequence RefSeq v1.0, and its nucleotide type is C or G. The SNP8 is the 766566413th nucleotide on chromosome 2B in the Chinese spring wheat reference genome sequence RefSeq v1.0, and its nucleotide type is T or C.

7. The product according to claim 6, characterized in that: The substance is as follows D1), D2) or D3): D1) the substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP1 and a primer composition for amplifying a wheat genomic DNA fragment including the SNP8; D2) the substance is a PCR reagent containing the primer combination described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

8. The product according to claim 7, characterized in that The primer composition for amplifying the wheat genomic DNA fragment including SNP1 and SNP8 consists of the following primer set 1 or primer set 2; 1) The primer set 1 consists of primer F1, primer F2 and primer R1, and amplifies a wheat genomic DNA fragment including the SNP1; 2) The primer set 2 consists of primer F3, primer F4 and primer R2, and amplifies the wheat genomic DNA fragment including the SNP8; The primer F1 is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-39 of sequence 1 in the sequence list; The primer F2 is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-39 in sequence 2 in the sequence list; The primer R1 is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list; The primer F3 is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-40 of sequence 4 in the sequence list; The primer F4 is a single-stranded DNA molecule whose nucleotide sequence is sequence 5 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-40 of sequence 5 in the sequence list; The nucleotide sequence of the primer R2 is a single-stranded DNA molecule of sequence 6 in the sequence table.

Citation Information

Patent Citations

  • Wheat TaARF12 gene and application thereof

    CN110846323A